Abstract
Triple-negative breast cancer (TNBC), the most aggressive molecular subtype of breast cancer, currently lacks effective therapeutic targets. While radiotherapy and chemotherapy remain the mainstay of treatment, therapy resistance frequently develops due to apoptosis evasion, leading to treatment failure. In this study, we demonstrate that luteolin, a naturally occurring flavonoid, effectively induces pyroptosis in TNBC cells through suppression of the AKT signaling pathway. Network pharmacology analysis and Western blot validation confirmed AKT pathway inhibition, with AKT agonists significantly reversing luteolin-induced pyroptosis. Mechanistically, luteolin upregulates the expression of GSDMD and NLRP3 while promoting the release of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α), indicating activation of the NLRP3 inflammasome-GSDMD pathway. Our findings highlight luteolin as a promising pyroptosis-inducing agent for TNBC therapy, providing novel insights into targeting the AKT-NLRP3-GSDMD axis to overcome treatment resistance and enhance antitumor immunity.
Supplementary Information
The online version contains supplementary material available at 10.1007/s12672-025-04098-3.
Keywords: Triple-negative breast cancer, Luteolin, Pyroptosis, AKT signaling
Introduction
Triple-negative breast cancer (TNBC) represents the most aggressive and treatment-resistant subtype of breast cancer, accounting for approximately 50% of breast cancer-related mortality [1]. Although current therapeutic modalities, including surgery, radiotherapy, and chemotherapy, have demonstrated efficacy in managing TNBC, patients with advanced or metastatic TNBC frequently develop resistance to both chemotherapy and radiotherapy. This resistance significantly contributes to poor prognosis and high recurrence rates, posing a major obstacle in the clinical management of TNBC [2, 3]. Consequently, there is an urgent need to explore effective therapeutic strategies from multiple perspectives to address the challenges associated with TNBC treatment.
In recent years, natural compounds have attracted much attention due to their multi-target action mechanisms, low toxicity, and wide biological activities, especially flavonoids [4]. Studies have shown that flavonoids can exert anti-tumor effects through various pathways such as regulating the cell cycle, inducing cell death, inhibiting angiogenesis, and modulating immune responses [5, 6]. Therefore, flavonoids are regarded as a potential breakthrough point for the treatment of TNBC, providing a new research direction for the development of safer and more effective treatment strategies. Luteolin, a naturally occurring flavonoid compound derived from plants and dietary sources, has demonstrated broad-spectrum antitumor effects through mechanisms including the inhibition of tumor cell proliferation, induction of cancer cell apoptosis, sensitization of drug-resistant cells, and suppression of cancer cell metastasis [7–9]. Pyroptosis, a recently recognized form of programmed cell death, has emerged as a promising therapeutic target in cancer treatment [10–13]. Unlike apoptosis, pyroptosis is an inflammatory programmed cell death characterized by the formation of cell membrane pores, cell swelling and rupture, and the release of large amounts of pro-inflammatory cytokines (such as IL-1 β and IL-18), thereby activating the immune response. In TNBC, induction of pyroptosis can not only directly kill tumor cells, but also enhance the immune system’s recognition and clearance of tumors by stimulating anti-tumor immune responses, which is particularly important for TNBC with strong immune suppression [14].
Although luteolin has been identified as an inhibitor of TNBC cell growth and metastasis, capable of inducing cancer cell apoptosis, its ability to trigger pyroptosis in TNBC cells and the underlying molecular mechanisms remain poorly understood. This study aims to investigate the potential of this naturally occurring, low-toxicity compound as a therapeutic agent for TNBC. This study aims to explore the molecular mechanism by which luteolin induces pyroptosis in TNBC, with a particular focus on its regulatory effect on the AKT signaling pathway. Through integrating in vitro and in vivo experiments, we systematically evaluated the induction effect of luteolin on pyroptosis in TNBC cells and deeply analyzed the molecular mechanism by which it mediates cell death through inhibition of the AKT signal.
Methods
Animals and models
Female BALB/c mice (n = 18, 20 ± 2 g, 4–5 weeks old) were maintained under standard conditions (25 ± 2 °C, 12 h light/dark cycle) with free access to food and water. All procedures were approved by the Animal Ethics Committee of Zhejiang Chinese Medical University. Mammary tumors were established by orthotopic injection (second left breast fat pad) of 4T1 cells (5 × 10⁵ cells in 50 µL PBS), and tumor growth was monitored every three days [15]. Tumor volume was calculated using the standard formula: (length × width²)/2. When tumor volumes reached ~ 100 mm³, mice were randomized into three groups (n = 6/group): vehicle control (normal saline, 10 mL/kg/day, i.p.), low-dose luteolin (10 mg/kg/day, i.p.), and high-dose luteolin (20 mg/kg/day, i.p.) [16, 17]. For intraperitoneal injection, a 25-gauge needle was used, and the injection site was the lower left quadrant of the mouse’s abdomen. After 35 days of treatment, mice were euthanized by CO₂ asphyxiation, and tumors, lungs, and spleens were collected for analysis.
Cell culture
We selected the human breast cancer cell line MDA-MB-231 and the murine breast cancer cell line 4T-1, which were obtained from the Shanghai Institute of Biological Sciences, Chinese Academy of Sciences. MDA-MB-231 (human) and 4T-1 (murine) cell lines, both of which are classical cell lines of TNBC. The cells were cultured in a 37 °C constant temperature incubator, with a 5% CO2 concentration maintained inside the incubator. They proliferated in a DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.
Cell viability assay
Cells were seeded in a 96-well plate at a density of 5 × 10⁴ cells per well and incubated overnight. Subsequently, the cells were treated with varying concentrations of luteolin (5 µmol/L, 10 µmol/L, 20 µmol/L, 40 µmol/L, and 80 µmol/L). At designated time points post-treatment (12 h, 24 h, and 48 h), 10 µL of CCK-8 reagent was added to each well, followed by incubation in the dark at 37 °C for 1 h. The optical density values of the samples were then measured at a wavelength of 450 nm using a spectrophotometer manufactured by BioTek (Vermont, USA). Cell viability was calculated by comparing the absorbance values of the treated groups with those of the untreated control group and expressed as a percentage relative to the control group. Each experimental condition was technically repeated 6 times, and the entire experiment was independently conducted twice to ensure the reliability and reproducibility of the data. The absorbance values were normalized to eliminate inter-experimental variations.
Wound-healing assay
MDA-MB-231 and 4T1 cells (5 × 10⁵ cells/well) were seeded in 6-well plates and cultured to 90–100% confluence. A standardized wound was created in the monolayer using a sterile 200 µL pipette tip. After washing with PBS to remove detached cells, the wounded monolayers were treated with luteolin (5, 10, and 20 µmol/mL) in serum-free DMEM. In addition, a solvent control group (DMSO) was set up to eliminate the influence of the solvent. Wound closure was monitored at 12 and 24 h post-treatment using an inverted phase-contrast microscope. Each experimental condition was technically repeated three times, and the entire experiment was independently conducted twice to ensure the reliability of the data. The wound closure was quantified using image analysis software (ImageJ), and the specific method was to measure the wound width at 0 h and 24 h, and calculate the closure rate: [((initial wound width - final wound width)/initial wound width) × 100%]. We have updated these details in the text. Thank you for your meticulous review.
Crystal violet staining
4T1 and MDA-MB-231 cells were seeded in 12-well plates at a density of 1,000 cells per well and allowed to adhere overnight. The cells were then treated with luteolin (at concentrations of 5, 10, and 20 µmol/L in complete medium) for 10 days, with the medium refreshed every 48 h. To account for potential solvent effects, a vehicle control group (treated with complete medium containing an equivalent volume of solvent) was included. Following the treatment period, the cells were fixed with 4% formaldehyde (15 min, room temperature) and stained with 0.1% crystal violet (15 min, room temperature). The absorbance was statistically analyzed using ImageJ software (version 1.53). Each treatment condition was repeated three times, and the entire experiment was independently repeated twice to ensure reproducibility.
Network pharmacology
Potential therapeutic targets of luteolin were identified by intersecting the predicted target genes from the Herb database with those from Swiss Target Prediction. The overlapping targets were then used to construct a protein-protein interaction (PPI) network using the STRING database (version 11.5), with subsequent visualization and topological analysis performed in Cytoscape software (version 3.9.1). To elucidate the biological functions and pathways associated with these targets, we conducted systematic enrichment analyses, including Gene Ontology (GO) terms (covering biological processes, molecular functions, and cellular components) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, with statistical significance set at p < 0.05 after false discovery rate correction.
Quantitative polymerase chain reaction
Total RNA was extracted from cells and tissues using TRIzol reagent according to the manufacturer’s protocol. RNA quality and concentration were determined spectrophotometrically (NanoDrop). First-strand cDNA synthesis was performed using a reverse transcription kit (5X RTase Reaction Buffer Mix, agbio) following the manufacturer’s instructions. qPCR amplification was carried out in a 20 µL reaction system containing SYBR Green master mix (2X SYBR Green Pro Taq HS Premix II, agbio) and gene-specific primers (sequences listed in Table 1) under the following thermal cycling conditions: initial denaturation at 95 °C for 60 s, followed by 40 cycles of 95 °C for 15 s (denaturation), 60 °C for 15 s (annealing), and 72 °C for 45 s (extension). β-actin served as the internal reference gene, and relative gene expression levels were calculated using the 2 − ΔΔCq method.
Table 1.
Primer sequence
| Gene name | Forward primers | Reverse primers |
|---|---|---|
| GSDMD | ATGGACTCCAAGGAGAAGCG | TCAGCTGCTGCTGCTGCTGC |
| NLRP3 | CAGCCAGAGTGATGTTTGCC | TGGGATTCTGCTGTCTTCGG |
| Caspase1 | ATGGCAGGACCTCAGGCAAC | TCAGCTTGGTGATCTGGAGC |
| Caspase4 | ATGGAGGACCTGAAGGAGCG | TCAGCTGCTGCTGCTGCTGC |
| IL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA |
| IL-1β | GCAACTGTTCCTGAACTCAAC | ATCTTTTGGGGTCCGTCAACT |
| IL-18 | GCTGGAGATCGTGAACTTGGA | TCCACGGGAAAGATTCGAAAG |
| TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
Western blot
Cellular and tissue lysates were prepared using RIPA buffer supplemented with protease inhibitor cocktail. Protein samples (30 µg total protein in 20 µL loading volume) were separated by 10% SDS-PAGE and subsequently transferred onto PVDF membranes. The membranes were blocked with 5% non-fat milk in TBST for 2 h at room temperature, followed by overnight incubation at 4 °C with the following primary antibodies: GSDMD-N (HUABIO HA721144 1:2000), NLRP3 (HUABIO ET1610 1:1000), cleaved Caspase-1 (Immunoway YC0022 1:1000), IL-1β (ZENBIO 516288 1:1000), AKT (CST 9272 1:1000), phospho-AKT (CST 4060 1:1000), and β-Actin (CST 4970 1:5000) as loading control. After washing, membranes were incubated with appropriate HRP-conjugated secondary antibodies (HUABIO HA1012 1:10000) for 1 h at room temperature. Protein bands were visualized using Immobilon Western HRP substrate and detected with a chemiluminescence imaging system. The band quantification analysis was performed using the ImageJ software (version 1.53), and the data were normalized to β-actin as the internal reference.
Immunofluorescence
Following 24-hour treatment with varying concentrations of luteolin, 4T1 cells were fixed in 4% paraformaldehyde at room temperature for 15 min, followed by permeabilization with 0.1% Triton X-100 for 10 min. After blocking with protein-free rapid blocking buffer for 1 h at room temperature, cells were incubated with primary antibodies (1:200 dilution) and corresponding secondary antibodies (HUABIO HA1122 1:500 dilution). Primary antibodies (CST 4060 p-Akt, ZENBIO 516288 IL-1β, HUABIO HA721144 GSDMD-N) were applied overnight at 4 °C. For nuclear counterstaining, cells were incubated with 1 µg/mL DAPI for 5 min at room temperature. Images were acquired using a confocal laser scanning microscope.
H&E staining and immunohistochemistry
Tissue sections were deparaffinized, rehydrated, and subjected to heat-induced antigen retrieval in citrate buffer (pH 6.0). After permeabilization with 0.1% Triton X-100 and blocking with 5% normal goat serum, endogenous peroxidase activity was quenched with 3% H₂O₂. Sections were incubated overnight at 4 °C with primary antibodies (CST 13110 PCNA, CST 11882 Ki67, HUABIO HA721144 GSDMD-N; 1:200 dilution), followed by HRP-conjugated secondary antibody (1:500) for 1 h at room temperature. Antigen-antibody complexes were visualized using DAB chromogen, counterstained with hematoxylin, dehydrated, and mounted for microscopic analysis of protein expression and subcellular localization.
Deparaffinized sections were stained with Mayer’s hematoxylin for 5 min, differentiated in 1% acid alcohol, blued in Scott’s solution, and counterstained with 1% eosin Y for 3 min. After dehydration through graded alcohols and xylene clearance, sections were mounted with resinous medium. Microscopic examination revealed nuclear (blue) and cytoplasmic/extracellular matrix (pink) morphology, enabling histopathological assessment of tissue architecture.
Statistical analysis
All experimental data are presented as mean ± standard deviation (SD). Statistical analyses were performed using one-way ANOVA followed by post-hoc tests: Least Significant Difference test for equal variances or Tamhane’s T2 test for unequal variances, implemented in SPSS software (version 22.0). A p-value < 0.05 was considered statistically significant.
Results
Luteolin inhibits the proliferation and migration of breast cancer cell lines in vitro
CCK-8 assay showed that luteolin treatment significantly inhibited the viability of breast cancer cells in a dose-dependent manner. At concentrations ≥ 10µmol/L, luteolin exhibited a marked cytotoxic effect, with a gradual decrease in cell viability over a period of 12 to 48 h (Fig. 1A), at a concentration of 20 µmol/L, the viability of 4T1 cells decreased to 73.1 ± 10.8% and the viability of MDA-MB-231 cells decreased to 79.4 ± 3.9% (p < 0.001, n = 6). The wound-healing assay showed that at a concentration of 5µmol/L, luteolin showed a modest inhibitory effect, whereas at a dose of 20µmol/L, it significantly reduced wound closure (Fig. 1B), at a concentration of 20 µmol/L, after 24 h of treatment, the relative healing area of 4-T1 cells decreased to 36.2 ± 6.8%, while that of MDA-MB-231 cells decreased to 31.0 ± 5.6% (p < 0.001, n = 6). Colony-formation assays showed that luteolin at 20µmol per liter resulted in fewer proliferating cells (Fig. 1C), at a concentration of 20 µmol/L, after 24 h of treatment, the Cloning plating efficiency of 4-T1 cells decreased to 44.4 ± 5.4%, while that of MDA-MB-231 cells decreased to 40.0 ± 6.4% (p < 0.001, n = 6).
Fig. 1.
Luteolin inhibits proliferation, migration of breast cancer cell lines in vitro. A effect of different concentrations of luteolin on the viability of breast cancer cells B effect of different concentrations of luteolin on the migration of breast cancer cells. C. Effect of different concentrations of luteolin on proliferation of breast cancer cells
Luteolin induces pyroptosis of breast cancer cells in vitro
Microscopy showed that 20µmol/L luteolin induced pyroptosis in 4T1 cells, including cell swelling and bubble-like projections (Fig. 2A). Quantitative PCR showed that luteolin upregulated pyroptosis-related markers in a concentration-dependent manner, indicating significant activation of the pyroptosis pathway (Fig. 2B), at a concentration of 20 µmol/L, the expression of NLRP3 increased by 2.8 ± 0.7 times, the expression of Caspase-1 increased by 1.5 ± 0.2 times, and the expression of GSDMD increased by 3.0 ± 1.1 times. Compared with the control group, all of these differences were statistically significant (n = 6). Immunofluorescence analysis confirmed that luteolin enhanced the expression of GSDMD-N and IL-1β in the cells, especially at 20µmol/L (Fig. 2C), at a concentration of 20 µmol/L, the fluorescence intensity of GSDMD-N increased by 4.0 ± 0.6 times, and the fluorescence intensity of IL-1β increased by 33.0 ± 0.5 times. Compared with the control group, there were significant differences (n = 6) (Fig. 2D). Western blotting further confirmed that luteolin induced pyroptosis in 4T1 cells, findings that indicate that luteolin exerts an antitumor effect by inducing pyroptosis (Fig. 2E), at a concentration of 20 µmol/L, the expression of NLRP3 increased by 2.2 ± 0.3 times, the expression of Caspase-1 increased by 3.5 ± 0.5 times, and the expression of GSDMD increased by 1.9 ± 0.2 times. Compared with the control group, all of these showed significant differences (n = 3).
Fig. 2.
Luteolin induces pyroptosis in 4T1 cells in vitro. A Morphological alterations in 4T1 cells treated with increasing concentrations of luteolin (representative phase-contrast microscopy images; scale bar: 50 μm). B qPCR analysis showing dose-dependent upregulation of pyroptosis-related genes (GSDMD, NLRP3, Caspase-1, and Caspase-4) in luteolin-treated 4T1 cells. C–D IF staining demonstrating enhanced expression of pyroptosis effector proteins (IL-1β and GSDMD-N terminal domain) following luteolin treatment (scale bar: 20 μm). E WB analysis confirming concentration-dependent cleavage of pyroptosis-associated proteins, including GSDMD-N, NLRP3, c-Caspase1, and c-IL-1β. (*p < 0.05, **p < 0.01 vs. untreated)
Luteolin network pharmacology
We identified 147 potential targets of luteolin by herb and Swiss Target Prediction (Fig. 3A). PPI network analysis revealed extensive interactions between luteolin target proteins, suggesting that luteolin may act through multitarget regulation rather than single-target action (Fig. 3B). The top 10 hub genes identified by network analysis (Fig. 3C). GO and KEGG were used to analyze these targets, and the results are shown in Fig. 3D–G. Detailed results can be found in Supplementary Table 1.2.
Fig. 3.
Network pharmacology analysis of luteolin. A Identification of luteolin-targeted genes from multiple databases. B PPI network of luteolin-targeted genes constructed using STRING database. C Top 10 hub genes identified from the PPI network based on degree centrality. D–F GO enrichment analysis of luteolin-targeted genes, highlighting biological processes (D), molecular functions (E), and cellular components (F). G KEGG pathway enrichment analysis of luteolin-targeted genes, revealing significant signaling pathways modulated by luteolin
Luteolin induces pyroptosis of breast cancer cells in vitro through AKT signaling
Immunofluorescence staining showed that luteolin treatment significantly reduced p-AKT fluorescence intensity in a dose-dependent manner (Fig. 4A), at a concentration of 20 µmol/L, the fluorescence intensity of p-AKT in 4T1 cells decreased to 0.27 ± 0.05 (Fig. 4B, n = 6), and the immunofluorescence results were confirmed by Western blot results: Luteolin treatment significantly inhibited AKT activation (Fig. 4C), the level of p-AKT protein decreased to 0.58 ± 0.01, showing a significant difference compared to the control group (n = 3).The AKT agonist (SC-79, 10µmol/L) significantly reversed luteolin-mediated pyroptosis (Fig. 4D). AKT activation downregulated the expression of luteolin-induced pyroptosis markers (Fig. 4E), compared with the group treated with luteolin alone, under the presence of SC-79, the GSDMD RNA level decreased by 40.5 ± 16.5%, the NLRP3 RNA level decreased by 36.2 ± 15.3%, and the Caspase1 RNA level decreased by 45.5 ± 10.2%. These results indicate that luteolin induces pyroptosis in 4T1 cells primarily by inhibiting AKT signaling, providing novel mechanistic insights into its antitumor activity.
Fig. 4.
Luteolin promotes pyroptosis in 4T1 cells by modulating AKT phosphorylation. A–B IF analysis showing dose-dependent reduction of p-AKT in 4T1 cells treated with luteolin (scale bar: 20 μm). C WB analysis confirming concentration-dependent suppression of p-AKT levels in luteolin-treated 4T1 cells. D Rescue experiments demonstrating that AKT agonist attenuates luteolin-induced pyroptosis in 4T1 cells (representative images and quantitative analysis). E qPCR analysis revealing that AKT agonist downregulates luteolin-induced expression of pyroptosis-related genes (GSDMD, Caspase-1, and NLRP3)
Luteolin inhibits the progression of breast cancer in mouse models
Our in vivo study showed that luteolin significantly inhibited tumor growth in a mouse model of 4T1 breast cancer. As shown in Fig. 5B, after 5 weeks of treatment, compared with the control group, the tumor volume in the luteolin treatment group (20 mg/kg) decreased by 36.8 ± 5.9%. This antitumor effect was visually confirmed by representative images of tumors from different treatment groups (Fig. 5C). Further analysis showed that luteolin treatment significantly reduced tumor weight (compared with the control group, it decreased by 29.3 ± 12.6%) and lung weight (compared with the control group, it decreased by 15.0 ± 4.0%), with minimal effect on spleen weight (Fig. 5D). Histopathological examination (Fig. 5E) showed that luteolin-treated tumor cells had reduced proliferation and decreased staining intensity for the proliferation markers PCNA and Ki67 on immunohistochemical analysis. Compared with the control group, the percentage of PCNA-positive cells in the high-dose luteolin treatment group decreased from 63.4 ± 5.0% to 39.9 ± 6.2% (p < 0.01, n = 5), and the percentage of Ki67-positive cells decreased from 49.2 ± 4.7% to 29.9 ± 3.6% (p < 0.001, n = 5).
Fig. 5.
Luteolin suppresses breast cancer progression in a murine model. A Schematic illustration of the experimental design for evaluating the anti-tumor effects of luteolin in vivo. B Tumor volume measurements in 4T1 breast cancer-bearing mice after 5 weeks of luteolin treatment. C Representative images of excised tumors from different treatment groups in the 4T1 breast cancer mouse model. D Quantitative analysis of tumor weight, lung weight, and spleen weight in 4T1 breast cancer-bearing mice across treatment groups. E Histopathological and immunohistochemical analysis of tumor tissues stained with H&E and markers of proliferation (PCNA and Ki67)
Luteolin promotes pyroptosis of breast cancer cells in tumor-bearing mice through AKT signaling
Our study showed that luteolin effectively promoted pyroptosis in cancer cells by regulating AKT signaling pathway. As shown in Fig. 6A, qPCR analysis showed that luteolin treatment significantly upregulated the expression of cytokines related to pyroptosis in tumor tissues compared with the control group, including IL-1β (upregulated by approximately 2-fold p < 0.001), TNF-α (upregulated by approximately 2-fold p < 0.01), IL-18 (upregulated by approximately 20-fold p < 0.001), and IL-6 (upregulated by approximately 3-fold p < 0.001). Immunohistochemical staining (Fig. 6B) clearly showed enhanced expression of GSDMD-N in tumors treated with luteolin. Compared with the control group, the average optical density value of GSDMD-N in the high-dose luteolin treatment group increased from 11.9 ± 2.3% to 52.3 ± 7.0% (n = 5). Western blot analysis (Fig. 6C-D) confirmed that luteolin treatment: (1) significantly inhibited AKT activation and reduced p-AKT levels. (2) up-regulating the expression of key GSDMD-N, NLRP3 and c-IL-1β. Compared with the control group, the expression of NLRP3 in the high-dose luteolin treatment group increased by 2.7 ± 0.6 times, the expression of c-IL-1β increased by 3.1 ± 0.2 times, the expression of GSDMD-N increased by 2.4 ± 0.5 times, and the expression of p-AKT decreased by 12.3 ± 0.5 times (n = 4).
Fig. 6.
Luteolin promotes pyroptosis in breast cancer cells via the AKT signaling pathway in tumor-bearing mice. A qPCR analysis of pro-inflammatory cytokine expression (IL-1β, TNF-α, IL-18, and IL-6) in tumor tissues from luteolin-treated mice. B IHC staining demonstrating the expression of the pyroptosis executioner protein GSDMD-N in tumor tissues (scale bar: 50 μm). C–D WB analysis of AKT, p-AKT, and pyroptosis-related proteins (IL-1β, GSDMD-N, and NLRP3) in tumor tissues, accompanied by quantitative statistical analysis
Discussion
TNBC represents the most aggressive molecular subtype of breast cancer, characterized by the absence of effective therapeutic targets. Radiotherapy and chemotherapy serve as primary treatment modalities for TNBC, effectively reducing tumor recurrence risk and improving patient survival rates [18]. However, the development of therapy resistance through apoptosis evasion frequently leads to diminished treatment efficacy and disease relapse, posing significant clinical challenges. Consequently, there is an urgent need to develop novel therapeutic strategies for TNBC management. Natural compounds derived from traditional Chinese medicine have demonstrated remarkable potential in cancer therapeutics [19, 20]. Our research reveals that luteolin can effectively induce pyroptosis in TNBC cells by suppressing AKT signaling pathway activation. This pharmacological discovery provides a theoretical basis for both target identification and drug development in TNBC treatment.
Pyroptosis represents a programmed cell death modality orchestrated by Gasdermin family proteins, marked by plasma membrane permeabilization, cellular swelling and rupture, and the extracellular release of pro-inflammatory cytokines. Within the canonical pyroptotic pathway, GSDMD undergoes proteolytic cleavage by activated Caspase-1, yielding N-terminal fragments that oligomerize to form membrane pores. These pores facilitate the unconventional secretion of key pro-inflammatory mediators, including IL-1β and IL-18, thereby amplifying the inflammatory cascade [21–23]. In recent years, this unique cell death mechanism has attracted much attention in the field of tumor biology, especially showing important application prospects in tumor immunotherapy [24–26]. In breast cancer, especially TNBC, the regulatory mechanism of pyroptosis is closely related to tumor progression, treatment resistance and immune regulation of tumor microenvironment. Studies have shown that pyroptosis of even a small number of tumor cells is sufficient to significantly alter the immune properties of the tumor microenvironment [27, 28]. This change is mainly achieved through the following mechanisms: when GSDME is expressed and activated in tumor cells, it acts as a “danger signal” molecule, which can effectively promote the recruitment and activation of immune cells to the tumor site. Together, these effects constitute a robust antitumor adaptive immune response [29]. Notably, certain malignancies are able to evade immune surveillance by inhibiting phagocytosis, and GSDME-mediated pyroptosis may become a key mechanism to overcome this immune escape. In this study, we obtained important experimental findings: high-dose luteolin treatment could significantly up-regulate the expression levels of GSDMD and NLRP3 in breast cancer cells, and promote the release of pro-inflammatory factors IL-1β, IL-6 and TNF-α. These results suggest that luteolin may induce pyroptosis by activating the NLRP3 inflammase-GSDMD pathway, thereby reshaping the tumor immune microenvironment. This finding provides an important theoretical basis for the development of immunotherapy strategies for breast cancer based on pyroptosis induction.
To investigate the molecular mechanism of luteolin in TNBC, we performed a network pharmacology analysis and found that luteolin may regulate AKT signaling pathway. Western blot results showed that luteolin significantly reduced the p-AKT/AKT ratio in the tumor tissues of breast cancer mice, which was also confirmed by in vitro cell experiments. At the same time, AKT agonist on breast cancer cells prevented luteolin-induced tumor cell pyroptosis. Several studies have shown that promoting AKT signaling can affect pyroptosis in breast cancer cells, which is consistent with our experimental results. These studies link AKT pathway regulation to pyroptosis regulation in cancer, reinforcing AKT as a key node for the antitumor effects of luteolin.
Although this study elucidates the mechanism by which luteolin induces pyroptosis in TNBC cells through AKT signaling pathway inhibition, several limitations should be acknowledged. Firstly, the sample size of the in vivo experiments was small and the evaluation endpoints were limited, which prevented the provision of survival benefit data. Secondly, while our in vitro experiments have demonstrated luteolin’s pro-pyroptotic effects in breast cancer cells, the absence of in vivo studies precludes validation of its immunomodulatory impact on the tumor microenvironment. In future studies, we will use flow cytometry to analyze the composition and functional dynamics of tumor-infiltrating lymphocytes, and use immunohistochemical staining to quantify the expression of key immune markers. Furthermore, the suboptimal bioavailability of luteolin presents significant challenges for clinical translation, necessitating formulation optimization and advanced drug delivery strategies. In the future, the efficacy of this treatment will need to be verified in larger-scale animal models. Special attention will be given to studying the synergistic effect when combined with standard therapies, optimizing the dosing strategy to improve the pharmacokinetic properties, and conducting a systematic safety evaluation, so as to truly assess its potential for clinical application. At the same time, the marked heterogeneity of TNBC may result in subtype-specific variations in pyroptosis susceptibility, underscoring the need for predictive biomarker identification to enable precision therapeutics.
This study found that luteolin suppresses TNBC progression and remodels the immunosuppressive tumor microenvironment by triggering NLRP3/GSDMD-dependent pyroptosis via AKT pathway inhibition. These findings provide novel therapeutic targets and strategic insights for TNBC treatment.
Supplementary Information
Acknowledgements
We appreciate the language polishing services provided by the Home of Researchers.
Author contributions
Gu Junwei: Experimental design, manuscript writing; Lan tian: Data collection and analysis; Hu Zujian: Animal model establishment; Luo Hua: Molecular experiments; Luo Hua and Gu Junwei: Research supervision and funding acquisition.
Funding
This project was supported by the Zhejiang Traditional Chinese Medicine Science and Technology Plan Project (2023ZL115).
Data availability
The data for this study are available within the article, with additional data available in the Supporting Information, or are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
This study was approved by the Ethics Committee of Zhejiang Chinese Medical University (IACUC-20221120–11). All animal experiments were performed in accordance with ARRIVE guidelines and in compliance with the National Institutes of Health guidelines for the care and use of Laboratory animals. The maximum tumor size/burden allowed by the ethics committee was 20 mm in diameter. This limit was not exceeded during the study period.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Li X, Lou C, Ren H, et al. Fundamental knowledge and research regarding the role of immunity in triple-negative breast cancer from 2014–2024: a bibliometric analysis. Hum Vaccin Immunother. 2025;21(1):2483022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sohel M. Breaking barriers; phytoestrogens in the fight against triple-negative breast cancer: a comprehensive review. Med Res Rev. 2025;45(4):1211–50. [DOI] [PubMed] [Google Scholar]
- 3.Zhang Y, Yang H, Jiang Y, et al. Angiogenesis and immune microenvironment in triple-negative breast cancer: targeted therapy. Biochimica et Biophysica Acta (BBA). 2025;1871(6):167880. [DOI] [PubMed] [Google Scholar]
- 4.Wang R, Wang C, Lu L, et al. Baicalin and baicalein in modulating tumor microenvironment for cancer treatment: a comprehensive review with future perspectives. Pharmacol Res. 2024;199:107032. [DOI] [PubMed] [Google Scholar]
- 5.Xu W, Li Y, Liu L, et al. Icaritin-curcumol activates CD8(+) T cells through regulation of gut microbiota and the DNMT1/IGFBP2 axis to suppress the development of prostate cancer. J Exp Clin Cancer Res. 2024;43(1):149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Guo Y, Mao W, Jin L, et al. Flavonoid group of Smilax glabra Roxb. regulates the anti-tumor immune response through the STAT3/HIF-1 signaling pathway. Front Pharmacol. 2022;13:918975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Jomova K, Alomar SY, Valko R, et al. Flavonoids and their role in oxidative stress, inflammation, and human diseases. Chem Biol Interact. 2025;413:111489. [DOI] [PubMed] [Google Scholar]
- 8.Sun C, Xie F, Zhang H, et al. Paclitaxel/Luteolin coloaded dual-functional liposomes for esophageal cancer therapy. Adv Sci. 2025;12(20):e2411930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.SINGH D, SHUKLA G. The multifaceted anticancer potential of luteolin: involvement of NF-kappaB, AMPK/mTOR, PI3K/Akt, MAPK, and Wnt/beta-catenin pathways [J]. Inflammopharmacology. 2025;33(2):505–25. [DOI] [PubMed] [Google Scholar]
- 10.TARIN M, SALJOOGHI AS. Gasdermin E as a potential target and biomarker for CRISPR-Cas9-based cancer therapy [J]. Biochem Pharmacol. 2025;237:116961. [DOI] [PubMed] [Google Scholar]
- 11.HUANG L, CHEN X, LIU R, et al. Targeting inflammasomes as an immunotherapeutic strategy for cancer [J]. J Transl Med. 2025;23(1):634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.WANG Y, CUI Y, LIU Z, et al. Acevaltrate overcomes myeloma resistance to bortezomib via pyroptosis by promoting BAX translocalization to mitochondria [J]. Eur J Pharmacol. 2025;996:177572. [DOI] [PubMed] [Google Scholar]
- 13.LI H, LU J, TAN S, et al. In situ delivery of gasdermin E mRNA promotes antitumor immunity via Creatine-Elicited type I interferon signaling in monocytes [J]. Cancer Immunol Res. 2025;13(6):939–56. [DOI] [PubMed] [Google Scholar]
- 14.GAO L, SHAY C, TENG Y. Cell death shapes cancer immunity: spotlighting PANoptosis [J]. J Exp Clin Cancer Res. 2024;43(1):168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.ARROYO-CRESPO J J, ARMINAN A, CHARBONNIER D, et al. Characterization of triple-negative breast cancer preclinical models provides functional evidence of metastatic progression [J]. Int J Cancer. 2019;145(8):2267–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.ZHAN X Z, BO Y W, ZHANG Y, et al. Luteolin inhibits diffuse large B-cell lymphoma cell growth through the JAK2/STAT3 signaling pathway [J]. Front Pharmacol. 2025;16:1545779. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.WANG X, ZHANG L. Combining Luteolin and Curcumin synergistically suppresses triple-negative breast cancer by regulating IFN and TGF-beta signaling pathways [J]. Biomed Pharmacother. 2024;178:117221. [DOI] [PubMed] [Google Scholar]
- 18.GRACIANO N, RODRIGUEZ C LOPEZL. Effect of chemotherapy timing in triple-negative breast cancer: a real-world evidence study [J]. Breast Cancer Res Treat. 2025;212(2):225–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.WU X, JIN L, REN D, et al. alpha-Hederin causes ferroptosis in triple-negative breast cancer through modulating IRF1 to suppress GPX4 [J]. Phytomedicine. 2025;141:156611. [DOI] [PubMed] [Google Scholar]
- 20.FENG Z H, LI W Y, LI Q Z, et al. Tylophora yunnanensis extract inhibits cholesterol biosynthesis to suppress triple negative breast cancer [J]. J Ethnopharmacol. 2025;348:119877. [DOI] [PubMed] [Google Scholar]
- 21.Xu W, Wang L, Chen R, et al. Pyroptosis and its role in intestinal ischemia-reperfusion injury: a potential therapeutic target. Naunyn Schmiedebergs Arch Pharmacol. 2025. 10.1007/s00210-025-04261-1. [DOI] [PubMed] [Google Scholar]
- 22.Broz P. Pyroptosis: molecular mechanisms and roles in disease [J]. Cell Res. 2025;35(5):334–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sharma BR, Choudhury SM, Abdelaal HM, et al. Innate immune sensor NLRP3 drives PANoptosome formation and PANoptosis. J Immunol. 2025. 10.1093/jimmun/vkaf042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wu C, Gao M, Xiao W, et al. Light-activatable manganese carbonate nanocubes elicit robust immunotherapy by amplifying endoplasmic reticulum stress-meditated pyroptotic cell death [J]. J Exp Clin Cancer Res. 2025;44(1):147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gong L, Liu Y, Feng J, et al. An immune activator encapsulating PD-L1 siRNA for augmented immune checkpoint blockade immunotherapy through Zn(2+) overload triggered pyroptosis [J]. J Nanobiotechnology. 2025;23(1):447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.HU Y, LIU Y. The multifaceted roles of GSDME-mediated pyroptosis in cancer: therapeutic strategies and persisting Obstacles [J]. Cell Death Dis. 2023;14(12):836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sabit H, Adel A, Abdelfattah MM, et al. The role of tumor microenvironment and immune cell crosstalk in triple-negative breast cancer (TNBC): emerging therapeutic opportunities [J]. Cancer Lett. 2025;628:217865. [DOI] [PubMed] [Google Scholar]
- 28.Zhou L, Zhao S, Xu Y, et al. Spatial-constraint modulation of intra/extracellular reactive oxygen species by adaptive hybrid materials for boosting pyroptosis and combined immunotherapy of breast tumor. Adv Healthc Mater. 2025. 10.1002/adhm.202500371. [DOI] [PubMed] [Google Scholar]
- 29.Fu C, Ji W, Cui Q, et al. GSDME-mediated pyroptosis promotes anti-tumor immunity of neoadjuvant chemotherapy in breast cancer. Cancer Immunol Immunother. 2024;73(9):177. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data for this study are available within the article, with additional data available in the Supporting Information, or are available from the corresponding author on reasonable request.






