l-theanine-targeted prefrontal cortex improves CUMS-induced depression via the gut-short-chain fatty acids-brain axis

Abstract

Depression has emerged as a major global public health issue. l-theanine exerts notable anxiolytic and antidepressant effects mediated by its blood-brain barrier permeability as well as its anti-inflammatory and antioxidant properties. Nevertheless, the underlying mechanism of its key role remains elusive. In this study, chronic unpredictable mild stress (CUMS) reduced serum neurotransmitter levels in mice, impaired prefrontal cortex (PFC) and colonic barrier function, which induced depressive-like behaviors. l-theanine, especially at a dose of 800 mg/kg, down-regulated gut-brain inflammatory pathways (TLR9/NLRP3/Caspase-1) and restored barrier integrity (ZO-1 and Occludin), reversing CUMS-induced depressive-like behavior. This therapeutic effect was primarily attributed to l-theanine-mediated reshaping of gut microbiota (increased of Lactobacillus and Roseburia) and the restoration of short-chain fatty acids (SCFAs, especially acetic acid, butyric acid, and propionic acid) synthesis and their receptor functions. In summary, the Gut-SCFAs-Brain axis may serve as a potential pathway for l-theanine to improve depression.

Introduction

Depression is a mental disorder primarily characterized by persistent and profound low mood, which is often accompanied by anhedonia and behavioral despair¹. Prolonged depressive states can diminish systemic immunity and increase patients’ susceptibility to various physical conditions, including sleep disorders and gastrointestinal diseases^2–4. In severe cases, individuals may even engage in extreme behaviors such as self-harm or suicide, posing a significant challenge to public health^5,6. However, the etiology of depression remains complex, influenced by many factors such as genetic heterogeneity, neurodevelopmental trajectories, and environmental exposures, with its underlying pathological mechanisms of onset still not fully elucidated⁷.

In recent years, gut microbiota has emerged as a focal point of academic research, with the gut-brain axis (GBA) widely acknowledged as one of the core determinants in the pathogenesis of neurodegenerative diseases and mental disorders⁸. The bidirectional communication between the gut and brain was mediated through multiple interconnected pathways, including immune, endocrine, and neural regulatory mechanisms, thereby influencing cerebral function⁹. Patients with depression exhibited dysregulation of the gut microbiome, characterized by increased abundances of Bacteroidetes, Proteobacteria, and Actinobacteria, and decreased levels of Firmicutes¹⁰. Notably, animal studies have reported conflicting findings that depression induced downregulation of Bacteroidota and concomitant elevation of Firmicutes in murine models¹¹. Such microbial metabolic perturbations exacerbated inflammatory responses and compromised intestinal barrier integrity, enabling harmful compounds to translocate across the damaged mucosa. These substances subsequently infiltrated the central nervous system via either the vagus nerve or the blood-brain barrier (BBB), thereby amplifying neuroinflammatory cascades^12,13. Cumulative evidence from preclinical and clinical studies indicated that modulating gut microbiota composition in depressed individuals effectively alleviated symptomatology, positioning the microbiome as a promising therapeutic target for the prevention and intervention of depression^14,15. Short-chain fatty acids (SCFAs) are microbial metabolites generated through the fermentation of undigested dietary carbohydrates by gut microbiota, primarily including acetate, propionate, and butyrate. These molecules exert diverse physiological functions, such as anti-inflammatory activity, reinforcement of the intestinal mucosal barrier, modulation of immune responses, regulation of the BBB, and facilitation of brain-derived neurotrophic factor (BDNF) and serotonin (5-HT) biosynthesis^16,17. Consequently, SCFAs have been implicated as critical modulators in neurodegenerative diseases. In addition, preclinical studies demonstrated that long-term dietary supplementation with SCFAs in the early stages of aging mitigates amyloid-β (Aβ) deposition and alleviates cognitive decline and pathological severity in Alzheimer’s disease models. Notably, butyrate has been shown to protect specific brain regions against mitochondrial dysfunction and associated behavioral abnormalities¹⁸. Mechanistically, SCFAs enhanced interleukin (IL)-22 production via activation of G Protein-Coupled Receptors (GPCRs) (e.g., GRP43 and GRP41), thereby orchestrating epithelial barrier homeostasis and regulating both mucosal and systemic immune responses^19,20. However, the precise roles of SCFAs in the pathophysiology of depression and anxiety remain poorly understood.

Mainstream antidepressants on the market, such as fluoxetine and fluvoxamine, often exhibited limited efficacy in patients with depression, with some individuals even showing non-response or drug resistance. This not only reduced treatment effectiveness but also contributed to the high recurrence rate of major depression, thereby affecting the overall cure rate of depression^21–23. Therefore, it is extremely urgent to explore new treatment strategies and pharmacological mechanisms. Natural phytochemicals are increasingly regarded as promising alternatives due to their safety, low toxicity, and lack of significant side effects²⁴. As one of the three major non-alcoholic beverages globally, tea has gained wide recognition for its health benefits, including the ability to improve depression-like behaviors. Notably, in addition to its reported effects of ameliorating metabolic disorders by alleviating weight gain and fat accumulation, l-theanine has been demonstrated to exert a variety of neuroprotective effects, such as anti-anxiety and antidepressant actions, leveraging its advantage of BBB penetration^25–27. Studies have confirmed that l-theanine alleviated memory impairment in genetic aging models by upregulating JAK2/STAT3, M1 muscarinic acetylcholine receptor (M1 mAChR), and Extracellular Signal-Regulated Kinase (ERK) signaling pathways²⁸. Meanwhile, it reduced the release of glutamate and increased gamma-aminobutyric acid (GABA) levels, as well as promoted the release of glycine and dopamine (DA), thereby achieving clinical effects in alleviating anxiety²⁹. Unlike traditional antidepressants, l-theanine does not induce side effects such as dizziness, gastrointestinal discomfort, or emotional blunting, positioning it as one of the effective measures for preventing and improving depression-like behaviors. Additionally, l-theanine demonstrated remarkable effects in reshaping gut microbiota structure, reducing intestinal inflammation, and alleviating intestinal homeostasis imbalance. A study has found that oral administration of l-theanine to high-fat diet-induced obese mice promoted fat browning and improved obesity by reducing the Firmicutes/Bacteroidetes ratio and increasing fecal SCFA concentrations³⁰. l-theanine pretreatment also significantly prevented dextran sulfate sodium (DSS)-induced intestinal damage by protecting intestinal epithelial barrier integrity, downregulating NF-κB signaling, and regulating lipid metabolism disorders³¹. These findings collectively demonstrate that l-theanine may ameliorate depression via the “gut microbiota-microbial metabolites-brain” axis. Nevertheless, whether and how depression-mediated intestinal homeostasis imbalance influences neural cell responses and neurotransmitter release in the brain remains unclear. It also remains to be determined whether l-theanine can restore intestinal homeostasis and improve depression-like behaviors via the “gut microbiota-SCFA-brain” axis. Based on this, the present study established a chronic unpredictable mild stress (CUMS)-induced depressive mouse model to evaluate the potential ameliorative mechanisms of l-theanine through the GBA. By intervening with different doses of l-theanine in CUMS mice, we investigated its effects on alleviating depression-like behaviors. Combined with GBA research, microbiomics, and targeted metabolomics techniques, we further explored the underlying key factors. This study aims to reveal the potential mechanisms by which l-theanine ameliorates depression-like behaviors via the “gut microbiota-SCFAs-brain” axis, providing a promising pathway for natural plant-derived active ingredients in depression improvement.

Results

l-theanine alleviated depression-like behaviors and regulated neurotransmitter levels in CUMS-induced mice

The depression model was established in mice via a 6-week CUMS protocol. During this period, low (100 mg/kg), medium (400 mg/kg), and high (800 mg/kg) doses of l-theanine were administered orally daily to evaluate its potential antidepressant activity against CUMS-induced depression-like behaviors (Fig. 1A). Experimental data showed that in the group treated with oral administration of 800 mg/kg CKT, the body weight slightly decreased compared with the CK group, while there was no significant difference in food intake between the two groups (Fig. S1A, S1B). Notably, mice in this group exhibited increased activity in behavioral tests without abnormal behavioral or physiological manifestations, suggesting that 800 mg/kg of l-theanine was non-toxic to the mice. The OFT locomotion trajectory analysis (Fig. 1B) revealed that, compared with the CK group and CKT group, the percentage of distance traveled through the central area relative to the total distance in the open field was statistically significantly reduced in mice of the CUMS group, with a decrease of 71.28% (P < 0.001) and 78.6% (P < 0.001), respectively. Furthermore, total rest duration in the OFT was significantly prolonged, increasing by 77.33% (p < 0.001) and 50.48% (p < 0.001) compared to the CK and CKT groups, respectively. These findings confirmed the development of obvious depression-like behaviors in mice after 6 weeks of CUMS intervention. In the three l-theanine-treated CUMS groups, the medium-dose (CTM) and high-dose (CTH) groups showed a significant increase in the percentage of distance in the center zone, by 106.14% (p < 0.01) and 113.03% (p < 0.01), respectively. Concurrently, both total rest duration (24.23%, p < 0. 01; 27.58%, p < 0.01) and peripheral rest duration (24.74%, p < 0.01; 27.92%, p < 0.01) decreased by over 20%, indicating a more active phenotype in the OFT, particularly in the CTH group (Fig. 1C–E). Collectively, these results demonstrate that 400 mg/kg and 800 mg/kg l-theanine alleviated depression-like behaviors in mice to varying degrees. Additionally, tea consumption and CUMS had minimal impact on the movement paths of mice in the peripheral area of the OFT (Fig. S1C).

Fig. 1. l-theanine alleviated depression-like behaviors and regulated neurotransmitter levels in CUMS-induced mice.

A Designing the experimental protocol. B Movement trajectories of mice in OFT. C The percentage of moving distance in the center zone (n = 5). D The percentage of rest time in the total time (n = 5). E The percentage of rest time in the surrounding zone relative to the total rest time (n = 5). F Sucrose preference assay (n = 5). Time of immobility of the mice in the FST(G) and TST(H) (n = 5). I–K 5-HT, DA and GABA levels in serum (n = 6). Data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, compared to the CUMS group. CK (control), CKT (control + 800 mg/kg l-theanine), CUMS, CTL (CUMS + 100 mg/kg l-theanine), CTM (CUMS + 400 mg/kg l-theanine), and CTH (CUMS + 800 mg/kg l-theanine).

Further behavioral tests revealed that the sugar water preference of the CUMS group decreased significantly by 29.6% (p < 0.01) and 30.43% (p < 0.01) compared to the CK and CKT groups, respectively. During the last 4 minutes of FST and TST, the CUMS group showed fewer struggling episodes and a significantly prolonged immobility time (FST: 115.08%, p < 0.01; 136.54%, p < 0.01; TST: 193.94%, p < 0.01; 219.63%, p < 0.01), indicative of anhedonia and behavioral despair, hallmarks of depression-like behaviors. Conversely, the CTM and CTH groups, which received medium- and high-dose treatments, demonstrated a notable recovery in sucrose preference, with increases of over 25% (25.53%, p < 0.01; 29.11%, p < 0.01, respectively). Their immobility times in the FST decreased significantly by over 40% (42.21%, p < 0.01; 44.3%, p < 0.01, respectively), and in the TST by 47.93% (p < 0.01) and 69.25% (p < 0.001), respectively (Fig. 1F–H).

We also measured the serum levels of monoamine neurotransmitters (5-HT and DA), as well as the non-monoaminergic neurotransmitter (GABA). Compared to the CK and CKT groups, CUMS treatment significantly reduced 5-HT, DA, and GABA levels. However, l-theanine restored 5-HT and DA levels in the CTM and CTH groups, specifically CTH group showed a significant increase in serum GABA levels (p < 0.01) (Fig. 1I–K). These findings reaffirmed that l-theanine treatment at 400 mg/kg and 800 mg/kg alleviated CUMS-induced anxiety- and depression-like behaviors and restored neurotransmitter homeostasis.

l-theanine exhibited the potential to suppress CUMS-induced inflammation within the PFC brain region and modulated the barrier function

Previous research have demonstrated that brain inflammation and the activation of its associated signaling pathways were pivotal inducing factors contributing to impaired emotional and cognitive functions³². In this study, we investigated the ameliorative effect of l-theanine on brain inflammation. Hematoxylin and eosin (H&E) staining results of the PFC in mice from different treatment groups indicated that the brain cells in the PFC of mice subjected to CUMS for 6 weeks displayed a series of aberrant morphologies, compared with the CK and CKT groups. The demarcation between the cytoplasm and the nucleus was blurred and challenging to discern clearly. Moreover, the number of neurons underwent degeneration and exhibited a significant decline. Simultaneously, a substantial number of nerve cells presented vesicular degeneration, with their morphology and structure being disrupted. The CTM and CTH groups, which received l-theanine intervention, effectively reversed this trend (Fig. 2A). Additionally, l-theanine effectively down-regulated the expression of inflammatory factors. The mRNA expression levels of relevant cytokines revealed that, in comparison with the CK and CKT groups, the CUMS treatment markedly up-regulated the mRNA expression of pro-inflammatory factors, including IL-1β, tumor necrosis factor-α (TNF-α), and IL-18, while suppressing the expression levels of anti-inflammatory factors, such as IL-22 and IL-10. Conversely, the CTM group, particularly the CTH group, significantly mitigated the onset of inflammation. It effectively reduced the elevated mRNA expression levels of IL-1β, TNF-α, and IL-18 induced by CUMS and promoted the expression levels of IL-22 and IL-10 (Fig. 2B). Furthermore, we examined the expression levels of tight junction proteins, zonula occludens-1 (ZO-1) and occludin, which were implicated in the formation and maintenance of the BBB. Our findings revealed that CUMS treatment significantly decreased the protein expression levels of ZO-1 and occludin. In contrast, the CTH group treated with l-theanine significantly enhanced the protein expression of ZO-1 (p < 0.01) and occludin (p < 0.05). These results indicate that the restoration of BBB proteins can curtail the occurrence of brain inflammation by reducing the infiltration of harmful factors (Fig. 2C).

Fig. 2. l-theanine exhibited the potential to suppress CUMS-induced inflammation within the PFC brain region and modulated the barrier function.

A H&E staining of the PFC. B mRNA expression of IL-1β, TNF-α, IL-18, IL-22 and IL-10 in the PFC (n = 5). C Western blot was used to detect the expression of ZO-1and Occludin (n = 3). D Western blot was used to detect the expression of TLR9, NLRP3 and Cleaved Caspase-1 (n = 3). Data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, compared to the CUMS group.

The signal transduction of Toll-like receptor 9 (TLR9) in neurons was of paramount importance for memory formation and influenced neurotransmitter metabolism, thereby impacting cognitive functions such as learning and memory³³. Specifically, the activation of the TLR9-NLRP3-Caspase-1 signaling pathway was regarded as one of the key factors underlying the elevation of inflammatory factors in brain dysfunctional diseases³⁴. The aforementioned experimental results have confirmed that CUMS led to a significant upsurge in the mRNA levels of inflammatory cytokines, such as IL-1β, in the PFC brain region (Fig. 2B). To further validate whether l-theanine can attenuate the activation of the TLR9-mediated signaling pathway, we measured the expression of pathway proteins. The results showed that, compared with the CK and CKT groups, CUMS treatment significantly increased the expression levels of TLR9, NLRP3, and Cleaved Caspase-1 proteins in the PFC brain region of mice. The CTM and CTH groups with l-theanine intervention effectively reduced the expression levels of proteins in the TLR9-mediated signaling pathway (Fig. 2D). In conclusion, our results indicate that medium- and high-dose l-theanine diminished the expression of inflammatory markers and improved the integrity of the brain barrier by inhibiting the TLR9-NLRP3-Caspase-1 signaling pathway, thereby alleviating symptoms associated with depression.

l-theanine ameliorated CUMS-induced intestinal inflammation in mice

During the experimental procedure, we observed that an extended duration of CUMS treatment led to the development of loose stools in a subset of mice. This observation prompted the hypothesis that heightened depressive-like states may disrupt intestinal homeostasis in mice. H&E staining of mouse colonic tissues revealed that, compared with the CK and CKT groups, CUMS-treated mice exhibited pronounced histological alterations. These included significant tissue damage, infiltration of inflammatory cells, reduction in the size and number of microvilli, and morphological abnormalities of the intestinal barrier (Fig. 3A). Gene expression analysis demonstrated that CUMS treatment induced a significant upregulation of pro-inflammatory cytokines IL-1β, TNF-α, and IL-18 at the mRNA level in colonic tissues, accompanied by a concurrent downregulation of anti-inflammatory cytokines IL-10 and IL-22 (Fig. 3B). Additionally, the protein expression levels of tight junction proteins (ZO-1 and occludin) were significantly decreased following CUMS exposure (Fig. 3C). Collectively, these findings strongly indicate that CUMS-induced depressive-like states contributed to intestinal inflammation and compromised the integrity of the intestinal barrier. Notably, treatment with l-theanine effectively mitigated colonic inflammatory pathology and restored intestinal barrier function. To further explore the underlying mechanisms, we examined the expression of the TLR9-NLRP3-Caspase-1 signaling pathways in colon. Immunoblotting analysis showed that CUMS treatment significantly upregulated the protein levels of TLR9, NLRP3, and Cleaved Caspase-1, compared to the CK and CKT groups. Conversely, l-theanine (CTM and CTH groups) markedly reversed these changes (Fig. 3D). These results provided additional mechanistic evidence supporting the role of l-theanine in suppressing the expression of pro-inflammatory cytokines (IL-1β, TNF-α, and IL-18) in the intestinal tract.

Fig. 3. l-theanine ameliorated CUMS-induced intestinal inflammation in mice.

A H&E staining of the colon. B mRNA expression of IL-1β, TNF-α, IL-18, IL-22 and IL-10 in the colon (n = 5). C Western blot was used to detect the expression of ZO-1and Occludin (n = 3). D Western blot was used to detect the expression of TLR9, NLRP3 and Cleaved Caspase-1 (n = 3). Data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, compared to the CUMS group.

l-theanine improved CUMS-induced intestinal homeostasis imbalance

To elucidate the impact of CUMS on the gut microbiota, 16S rRNA gene sequencing was employed to comprehensively profile fecal microbiota samples from distinct treatment groups to discern the holistic structural alterations within the gut microbiome. Our findings revealed that, relative to the CK group, the Shannon diversity index at the phylum level exhibited a significant increase in the CUMS-treated group (p < 0.01). Conversely, following l-theanine administration, the Shannon indices of the CTL, CTM, and CTH l-theanine treatment groups were all markedly reduced (p < 0.001 for all), indicating the substantial modification of microbial diversity in CUMS mice subjected to l-theanine intervention (Fig. 4A). Principal coordinate analysis (PCoA) at the phylum level unveiled pronounced disparities in the microbial compositional architecture across treatment groups. Notably, the CUMS group distinctly segregated from all other experimental groups, whereas the CTL, CTM, and CTH groups demonstrated considerable convergence with the CKT group. The results of ANOSIM also showed that there were significant differences in the microbial community structure at the phylum level among different groups (R = 0.2560, p = 0.0100) (p < 0.05), as well as a certain degree of separation trend among groups (Fig. 4B). Furthermore, at the phylum level, relative to the CK and CKT groups, CUMS treatment elicited a significant elevation in the abundances of Actinobacteriota and Campilobacterota. Conversely, l-theanine intervention led to a notable reduction in the abundances of these two phyla, concurrently augmenting the abundance of Firmicutes (Fig. 4C). At the genus level, l-theanine significantly facilitated the enrichment of Lactobacillus, Roseburia, Lachnospiraceae_NK4A136_group, Alistipes, Lachnoclostridium, and Marvinbryantia. Conversely, it effectively mitigated the CUMS-induced overabundance of Alloprevotella, Prevotellaceae_NK3B31_group, Anaeroplasma, Helicobacter, norank_f__Eubacterium_coprostanoligenes_group, Coriobacteriaceae_UCG-002, and Clostridium_sensu_stricto_1 (Fig. 4D–F). Collectively, these findings indicate that depressive-like behaviors not only precipitated dysregulation of intestinal homeostasis, triggered inflammatory responses, and compromised barrier integrity, but also instigated profound alterations in the gut microbiota composition. Conversely, l-theanine intervention elicited a progressive restoration of intestinal homeostasis and exhibited remarkable potential in reshaping the gut microbiome, thereby highlighting its therapeutic implications.

Fig. 4. l-theanine improved CUMS-induced intestinal homeostasis imbalance.

A α-Diversity analysis of gut bacterial diversity (Shannon index) from different mice groups (n = 6). B Z-Score Principal Component Analysis (PCoA) analysis of gut microbiota based on the Genus level (n = 6). At the Phylum level, the results indicated that there were significant differences in the microbial community structure among the groups (PC1 explained 81.41% of the variance, PC2 explained 4.95% of the variance, R = 0.2560, P = 0.0010000). C Taxonomic distributions of gut microbiota compositions at the phylum level. D Taxonomic distributions of gut microbiota compositions at the Genus level. E, F The relative abundance of mouse fecal microbiota at the Genus level. Data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, compared to the CUMS group.

l-theanine increased the levels of SCFAs in CUMS mice

Microbial analysis revealed that l-theanine treatment induced significant alterations in the gut microbiota of CUMS mice. Notably, genera associated with SCFA production, namely Roseburia, Lachnoclostridium, and Marvinbryantia were significantly enriched in the CTH group. Accumulating evidence indicated that SCFAs served as pivotal metabolites for bidirectional communication between gut microbiota and the host. These metabolites can traverse the BBB via systemic circulation, thereby exerting neuroprotective effects and enhancing brain function²⁰. Motivated by these findings, we quantified SCFA concentrations in fecal and serum samples (Fig. 5A–L). CUMS elicited a pronounced reduction in SCFA levels. Fecal concentrations of acetic, propionic, isobutyric, butyric, isovaleric, and valeric acids were significantly decreased compared to the CK group (p < 0.01). Similarly, serum levels of these SCFAs, except butyric acid, exhibited significant declines (p < 0.01). Conversely, l-theanine intervention, particularly in the CTM and CTH groups, mitigated this decrease. The CTM and CTH groups restored fecal acetic acid levels, as well as serum acetic, propionic, isovaleric and valeric acid concentrations. Notably, the CTH group demonstrated more robust effects, significantly reversing reductions in fecal isobutyric, butyric, and valeric acids, as well as serum isobutyric acids. These findings underscored the detrimental impact of CUMS on SCFA metabolism. Moreover, l-theanine treatment at optimal dosages not only alleviated depressive symptoms but also promoted SCFAs’ production. Correlation analysis also showed a strong correlation between gut microbiota and changes in SCFAs. Specifically, most SCFAs were positively correlated with the abundances of Parabacteroides, Rikenellaceae_RC9_gut_group, Lachnospiraceae_UCG-006, and Streptococcus, while negatively correlated with the abundances of Anaerostipes and Ruminococcus (Fig. 5M). This reveals the close association between gut microbial composition and SCFA changes. In addition to their own regulatory effects on the intestinal barrier, SCFAs can also exert regulation by activating the expression of G protein-coupled receptors (GPR43 and GPR41)³⁵, we investigated the mRNA levels of GPR43 and GPR41 in the colon and PFC (Fig. 5N–Q). CUMS significantly downregulated GPR43 and GPR41 mRNA expression in both tissues compared to the CK and CKT groups, suggesting impaired SCFA receptor function. In contrast, l-theanine treatment, especially in the CTH group, substantially restored receptor expression. The CTH group exhibited near-complete reversal of GPR43 and GPR41 mRNA levels, approaching those of the CK group. These results indicate that l-theanine ameliorates depression by modulating SCFA concentrations and regulating receptor expression of their receptors in the colon and PFC.

Fig. 5. l-theanine increased the levels of SCFAs in CUMS mice.

The contents of SCFAs in feces from six mouse groups: acetic acid (A), propionic acid (B), butyric acid (C), isobutyric acid (D), valeric acid (E) and isovaleric acid (F) (n = 6 per group). (G-L) The content of SCFAs in serum (acetic acid (G), propionic acid (H), butyric acid (I), isobutyric acid (J), valeric acid (K) and isovaleric acid (L), n = 5). M Spearman’s correlation analysis of gut microbiome and SCFAs in colon. The heatmap indicates significant correlations using color gradients (orange = positive correlation, green = negative correlation) and asterisk annotations (*p < 0.05, **p < 0.01, ***p < 0.001), where the intensity of the color represents the strength of the correlation. mRNA expression of GPR43 (N) and GPR41(O) in the PFC (n = 5). mRNA expression of GPR43 (P) and GPR41(Q) in the colon (n = 5). Data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, compared to the CUMS group.

Discussion

Mounting evidences from contemporary research underscored the therapeutic potential of microbiota modulation in alleviating depressive symptoms³⁶. In our prior investigations, we elucidated that Pu-erh tea effectively restored colitis-induced cerebral dysfunction via the “gut microbiota-gut-brain” axis, primarily by augmenting the biosynthesis of SCFAs³⁷. Among the bioactive components of tea, l-theanine, a unique free amino acid, exerted profound neuroprotective effects. It readily traversed the BBB, instigating a cascade of neural responses that culminated in the enhanced release of key neurotransmitters, including GABA, DA, and 5-HT¹². Notwithstanding these established benefits, the precise role of l-theanine in ameliorating depression through SCFAs regulation remains an enigma. To address this knowledge gap, the present study employed a CUMS murine model. Mice were administered l-theanine at graded dosages to systematically evaluate its antidepressant efficacy. Our findings revealed that prolonged exposure to mild, unpredictable stress precipitated depressive-like behaviors, accompanied by a significant decline in serum neurotransmitter levels. Structural integrity of the barrier function, as evidenced by a reduction of ZO-1 and occludin, was compromised in both PFC and colonic tissues. These alterations instigated a vicious cycle of heightened systemic inflammation and subsequent neurological impairment. Conversely, l-theanine supplementation, particularly at the highest dosage (CTH group), emerged as a potent therapeutic strategy. By orchestrating a comprehensive reshaping of the gut microbiota, l-theanine promoted the production of SCFAs and upregulated the expression of their cognate receptors. This metabolic reprogramming culminated in the downregulation of the TLR9/NLRP3/Caspase-1 gut-brain inflammatory axis, effectively mitigating CUMS-induced depressive phenotypes.

In the present study, experiments were conducted using the scientifically recognized CUMS modeling method to induce depressive-like behaviors. Notably, on the basis of an initial total sample size of n = 6, the sample size for all experimental results in this study was maintained at n = 5–6. The CUMS model is widely recognized as an animal model that most closely mimics the pathological features of human depression; its modeling approach relies on artificial intervention rather than pharmacological intervention, which may lead to slight variations in the severity of depressive-like behaviors due to individual differences among mice. Moreover, no subjective selection of results was conducted throughout the entire experiment. The results showed that oral gavage of l-theanine at doses of 400 mg/kg and 800 mg/kg effectively mitigated depressive-like behaviors in CUMS-induced mice, in which the 800 mg/kg dosage demonstrating the most pronounced efficacy. H&E staining of the PFC and colon tissues in the CKT group (receiving 800 mg/kg l-theanine) revealed no significant inflammatory infiltration or histopathological abnormalities, indicating the safety of this dosage. Interestingly, compared with the CK group, the CKT group showed a decrease in body weight, while there was no significant difference in food intake between the two groups. The research team has demonstrated that administration of 900 mg/kg l-theanine to high-fat diet (HFD)-induced obese mice effectively rectified dysregulated glycolipid metabolism, resolved inflammatory dyshomeostasis, and mitigated the development of hepatic steatosis by regulating the TGF-β signaling pathway, thereby alleviating obesity-associated comorbidities. The team further indicated that the effects of high-dose l-theanine on the nervous system require additional investigation in future studies²⁵. This finding indicates that l-theanine exerts a favorable anti-obesity effect without compromising the health of mice. Previous studies have demonstrated that l-theanine is a safe food additive for rats, as no adverse effects were observed in terms of pathological manifestations, organ weights, or histopathological features when rats were administered a dose of 4000 mg/kg l-theanine in the diet over a 13-week period (equivalent to 5777.8 mg/kg for mice)³⁸. Furthermore, according to the formula-based conversion, the daily l-theanine dosage of 800 mg/kg supplemented to mice is equivalent to a daily supplementation of 87.9 mg/kg l-theanine for an adult human. The Japan Food Additives Association has not yet recommended dietary exposure limits for l-theanine. Similarly, the U.S. Food and Drug Administration (FDA) classified l -theanine as a Generally Recognized as Safe (GRAS) substance in 1985, with no restrictions on its maximum usage³⁹. Collectively, these results underscored the safety and tolerability of the 800 mg/kg l-theanine dose in murine models. Furthermore, in this experiment, while strictly adhering to paired feeding, the food intake of the CUMS/CTL/CTM/CTH groups exhibited significant differences from that of the control groups (CK/CKT) and showed an overall fluctuating pattern. This is mainly attributed to the specificity of CUMS modeling procedures. On the one hand, random and unpredictable modeling procedures such as 24-hour food deprivation, 24-hour water deprivation, and 1-hour restraint disrupted the mice’s regular feeding rhythm, preventing them from feeding as regularly as the control groups. On the other hand, we also observed that stress induced by CUMS modeling caused the mice to exhibit binge-eating behavior—and it was precisely this phenomenon that led to significant differences in food intake between the CUMS-modeled mice and the CK control group during the experimental period, depending on the scheduling of modeling procedures. Additionally, CKT-treated mice displayed heightened activity in behavioral assays. Behavioral analyses demonstrated that medium- and high-dose l-theanine treatment significantly enhanced locomotor activity in the central zone of the OFT and increased SPT scores, while reducing immobility time in the TST and FST. These outcomes strongly indicated the antidepressant-like efficacy of l-theanine in CUMS-exposed mice. Furthermore, plasma 5-HT levels are a recognized biomarker for depression, and imaging mass spectrometry or brain tissue-based analyses provide strong evidence to support this^40,41. Findings have demonstrated that l-theanine can restore 28 potential depression-related abnormal metabolites—including 5-HT, DA, and norepinephrine —in the serum and hippocampus of juvenile rat models with CUMS-induced depression to near-normal levels via reversed-phase ultra-high-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry (RP-UPLC-Q-TOF-MS/MS) and hydrophilic interaction liquid chromatography-triple quadrupole mass spectrometry (HILIC-QQQ-MS/MS)⁴². Consistent with these findings, our results showed that l-theanine effectively reversed the CUMS-induced decline in the levels of key neurotransmitters, namely 5-HT, DA, and GABA, thereby highlighting its potent antidepressant efficacy. Previous studies have reported that tea or l-theanine interventions enhanced the functional connectivity of the limbic-cortical-striatal-pallidal-thalamic (LCSPT) circuit and normalized the hyperactive hypothalamic-pituitary-adrenal (HPA) axis, thereby restoring neurotransmitter homeostasis^43,44. Reduction of HPA axis hyperactivation and inflammation, along with restoration of the monoaminergic system and enhancement of neurogenesis/neuroplasticity, were deemed pivotal mechanisms underlying the regulation of 5-HT, DA, and GABA synthesis by tea consumption or l-theanine supplementation^12,45. These findings further substantiate that neurotransmitter restoration likely represented a critical determinant in l-theanine-mediated amelioration of depressive-like behaviors.

During the onset of depression, there was a notable elevation in cerebral inflammatory factors across multiple brain regions (e.g., PFC, hippocampus), accompanied by the activation of associated signaling pathways. This was concomitant with abnormal fluctuations in the levels of neurotransmitters that were intricately linked to emotional regulation and cognitive processes. Moreover, neuroinflammation manifested in the PFC, a crucial brain region responsible for memory modulation and behavioral control, thereby compromising emotional and cognitive functions³². Research has demonstrated that a deficiency in astrocyte-derived pleiotrophin within the PFC precipitated downregulation of the PIN-PTPRZ1-AKT pathway in male mice, culminating in stress-induced depressive-like phenotypes⁴⁶. These findings underscore the critical association between the PFC and depression. In addition, functional magnetic resonance imaging -based whole-brain analysis and functional near-infrared spectroscopy revealed that after tea consumption, the PFC—a key brain region for working memory processing—was activated, and the activity of c-FOS-positive cells was increased, thereby ameliorating neurodegenerative diseases^47,48. Considering the above factors comprehensively, the PFC region was chosen as the primary focus of our cerebral investigation. Our study revealed that l-theanine intervention, particularly at medium and high doses, effectively rectified pathological anomalies in the PFC of CUMS-modeled mice, restoring the morphological integrity and structural organization of neuronal cells. Additionally, l-theanine significantly mitigated CUMS-induced elevations in pro-inflammatory cytokines (TNF-α, IL-1β, and IL-18) and decreases in anti-inflammatory cytokines (IL-10 and IL-22) within the PFC. The BBB is indispensable for maintaining cerebral homeostasis, regulating nutrient exchange, and safeguarding the brain from harmful agents. However, inflammatory insults and stressors compromised BBB function, facilitating the infiltration of neurotoxic substances⁴⁹. Our results demonstrated that l-theanine significantly upregulated the expression of tight junction proteins (Occludin and ZO-1) in the PFC, with medium and high doses eliciting the most pronounced effects. These findings indicate that l-theanine alleviated depressive symptoms, in part, by fortifying the BBB and attenuating cerebral inflammation. Further exploration of the NLRP3-mediated inflammatory cascade revealed that l-theanine potently suppressed the activation of the TLR9/NLRP3/Caspase-1 signaling axis in the PFC. As previously reported, activation of NLRP3 inflammasomes and Caspase-1 drives IL-1β release, exacerbating inflammation³⁴. Moreover, NLRP3-mediated Caspase-1 cleavage, induced by TLR ligands or TNF, was pivotal in immune dysregulation and aging-related pathologies⁵⁰. Excessive TLR9 activation has been implicated in cognitive decline and immune disorders, including Alzheimer’s disease and myocarditis. Collectively, these results indicated that l-theanine-mediated inhibition of the TLR9-NLRP3/Caspase-1 pathway mitigated the overproduction of cerebral inflammatory mediators, thereby ameliorating neuroinflammation.

In addition to the aforementioned neuroinflammation, intestinal inflammation was also a contributing factor to brain dysfunction. Altered gut microbiota profiles have been consistently reported in neurodegenerative disorders, including Parkinson’s disease and Alzheimer’s disease, which were characterized by cognitive impairment. These findings underscored the pivotal role of intestinal homeostasis and the gut microbiota in the pathophysiology of central nervous system disorders⁵¹. These findings were congruent with our observations. Following l-theanine administration, notable improvements were observed in colonic histopathological characteristics, accompanied by a decrease in inflammatory factor levels and an increase in ZO-1 and Occludin expression. Collectively, these results strongly indicate that l-theanine mitigated intestinal hyperpermeability by facilitating the repair of damaged tight junction proteins. Immunoblot analysis further revealed that l-theanine effectively suppressed the CUMS-induced upregulation of TLR9, NLRP3, and Caspase-1 proteins in the colon, thereby ameliorating colonic inflammation, enhancing immune resilience, and preserving intestinal barrier homeostasis. Complementary research has demonstrated that l-theanine can reinforce intestinal barrier function by upregulating claudin-1, occludin, and ZO-1 expression, and mitigate alcohol-induced gut injury via activation of the HIF-1 signaling pathway coupled with suppression of the TLR4/NF-κB/HIF-1α cascade⁵². Additionally, preclinical evidence indicated that TLR9 pathway modulation recalibrated gut microbiota composition and function, thereby resolving intestinal inflammation⁵³. Collectively, these data indicated that l-theanine rectified CUMS-induced dyshomeostasis of the intestinal ecosystem by dampening inflammatory signaling cascades and restoring barrier integrity. Notably, l-theanine exhibited a dual-targeting effect, concurrently blocking TLR9 ligand engagement and downstream signaling in both the PFC and colon. This coordinated action inhibited NLRP3 inflammasome assembly, suppressed Caspase-1 activation, reduced IL-1β secretion, and ultimately conferred neuroprotective and antidepressant benefits by alleviating systemic and cerebral inflammation.

The dysbiosis of the gut microbiota was increasingly recognized as a key driver in the pathogenesis of depression, underscoring its critical role in the GBA. Building upon the established efficacy of l-theanine in ameliorating pathological alterations in the PFC and colon induced by depression, our study delved into the effects of l-theanine on gut microbiota composition and microbial metabolites. Our findings revealed that, at the genus level, the CUMS group significantly elevated the relative abundances of Alloprevotella, Prevotellaceae_NK3B31_group, Anaeroplasma, Helicobacter, norank_f__Eubacterium_coprostanoligenes_group, Coriobacteriaceae_UCG-002, and Clostridium_sensu_stricto_1. Among these, Prevotellaceae_NK3B31_group, Anaeroplasma, norank_f__Eubacterium_coprostanoligenes_group, Coriobacteriaceae_UCG-002, and Clostridium_sensu_stricto_1 have been identified as opportunistic pathogens that proliferated under conditions of host immunocompromise, exacerbating gut microbiota dysregulation. These genera have been implicated in the pathological processes of various diseases, including liver disorders, gastrointestinal diseases, and neurological conditions associated with brain dysfunction. Notably, their significant upregulation in abundance has emerged as a potential biomarker indicative of disease onset. It was reported that the Prevotellaceae_NK3B31_group was positively correlated with cortisol levels, and excessive cortisol levels can lead to overactivity of the HPA axis, triggering depression^54,55. Coriobacteriaceae_UCG-002, closely linked to host metabolism and immune regulation, was frequently detected in murine models of fatty liver and enteritis, where it promoted disease progression by enhancing intestinal inflammation and epithelial permeability^56–58. Similarly, increases in Anaeroplasma, norank_f__Eubacterium_coprostanoligenes_group, and Clostridium_sensu_stricto_1 have been associated with liver metabolic dysfunctions. Gut microbiota imbalance orchestrated a cascade of events, including heightened intestinal inflammation (manifested by elevated TNF-α, IL-1β, IL-6, IL-17, and IFN-γ), oxidative stress (as indicated by increased MDA levels), abnormal blood lipid levels (elevated TC and TG), and ultimately, liver injury^59–61. In contrast to the CUMS group, l-theanine promoted the enrichment of beneficial genera, including Lactobacillus, Roseburia, Lachnospiraceae_NK4A136_group, Alistipes, Lachnoclostridium, and Marvinbryantia. Lactobacillus, a Gram-positive bacterium, exerted a protective role in maintaining intestinal homeostasis, modulating immune responses, and regulating metabolism. Supplementation studies have demonstrated that Lactobacillus can modulate the gut microbiota, restore BDNF and 5-HT levels in the murine brain via the GBA, thereby enhancing barrier function, reducing inflammation, and alleviating depressive symptoms⁶². Lachnospiraceae_NK4A136_group, a member of the Firmicutes phylum, was pivotal in maintaining gut microecological balance and physiological homeostasis. An increase in its abundance was often closely associated with good anti-inflammatory effects. Preclinical studies have demonstrated that Lachnospiraceae_NK4A136_group mitigated intestinal barrier damage induced by DSS-triggered colitis⁶³. Notably, in a murine model of glucocorticoid-induced glycolipid metabolism disorder, the abundance of Lachnospiraceae_NK4A136_group was significantly reduced, which has been implicated as a contributing factor to depressive phenotypes^64,65. This further proved that the alleviation of depression by l-theanine in this study may be related to the reshaping of gut microbiota.

Analysis of previous literature has revealed that l-theanine enhances intestinal mucosal immunity by increasing the contents of total SCFAs, acetic acid, propionic acid, and butyric acid⁶⁶. Furthermore, the increased abundance of microorganisms such as Lactobacillus, Roseburia, Lachnoclostridium, and Marvinbryantia following l-theanine intervention is closely associated with the production of SCFAs^67,68. For instance, Lactobacillus played a pivotal role in modulating the synthesis of acetic, propionic, and butyric acids, whereas Alistipes and Marvinbryantia contributed to the increased production of acetate, propionate, and butyrate. These SCFAs exerted multifaceted effects, including enhancing intestinal mucosal integrity, preventing synaptic dysfunction, upregulating neurotrophic factor expression, and suppressing neuroinflammation in memory-related brain regions⁶⁹. To elucidate the impact of l-theanine on SCFA production in CUMS mice, we quantified SCFAs levels in intestinal contents and serum. Our findings revealed that high-dose l-theanine administration significantly elevated SCFAs levels in both the intestinal lumen and serum of CUMS mice. Specifically, in the intestinal milieu, butyric acid increased most prominently (rised 106.2%), while in serum, acetic acid exhibited the most substantial upregulation (increased 469.3%). SCFAs were well-documented for their critical functions in maintaining intestinal homeostasis. They reinforced the intestinal mucosal barrier, modulated immune cell function, and served as an energy source for intestinal epithelial cells⁷⁰. Through the GBA, SCFAs reduced the levels of corticotropin-releasing hormone, adrenocorticotropic hormone, and corticosterone, thereby mitigating HPA axis hyperactivation, alleviating cognitive dysfunction, and ameliorating depressive symptoms while reducing memory impairment^71,72. Among these, previous studies have reported that butyric acid inhibited lipid synthesis by modulating the AMPK/SREBP signaling pathway, enhanced intestinal barrier function, suppressed the LPS/TLR4/NF-κB signaling cascade, reduced inflammation, and conferred comprehensive improvements in non-alcoholic fatty liver disease in murine models⁷³. Additionally, acetate has been shown to decrease IL-1β levels and mitigate lipopolysaccharide (LPS)-induced glial cell activation and neuroinflammation in rats⁷⁴. In the context of gut microbiota modulation, l-theanine not only decreased the abundance of potential pathogens but also promoted the proliferation of SCFAs-producing bacteria, leading to a significant increase in SCFAs, particularly acetic and butyric acids. These SCFAs alleviated depression by fortifying the intestinal barrier, dampening inflammation, and traversing the GBA and BBB to exert neuroprotective effects. Beyond their direct impact on the intestinal barrier, SCFAs modulated intestinal motility, orchestrated immune responses, reduced inflammation, and stimulated intestinal hormone release through activation of GPCRs (GPR43 and GPR41)^35,75. Prior research has shown that acetate supplementation suppressed neuroinflammation by upregulating GPR41 and inhibiting the ERK/JNK/NF-κB pathway, thereby ameliorating cognitive decline in aging model mice⁷⁶. Butyrate, on the other hand, promoted hormone secretion via GPR43 activation, facilitating glucose metabolism regulation and maintaining intestinal barrier integrity⁷⁷. Our study further revealed that the CUMS model induced functional impairment of SCFA receptors, whereas l-theanine significantly restored the mRNA levels of GPR43 and GPR41. Notably, SCFAs binding to GPR43 activated 5-HT-containing mucosal mast cells through signal transduction, indirectly increasing the relative abundance of 5-HT, a key neurotransmitter in depressive disorders⁷⁸. Collectively, these results strongly indicate that l-theanine exerted antidepressant effects by reshaping the gut microbiota, regulating SCFA production, and reactivating SCFA receptor functions.

In conclusion, this research has validated that l-theanine demonstrates a remarkable capacity to alleviate depression and its associated comorbidities. Through the restoration of neurotransmitter levels (upregulated levels of 5-HT, DA, and GABA), targeted suppression of the inflammatory response within the PFC and colon regions (downregulation of TLR9/NLRP3/Caspase-1), and upregulation of the expression of barrier proteins in the PFC and colon (upregulation of ZO-1 and Occludin expression), l-theanine mitigates depression-induced brain dysfunction and intestinal complications. Additionally, l-theanine reshaped the gut microbiota of CUMS mice (including Lactobacillus, Roseburia, Lachnoclostridium, and Marvinbryantia), stimulated the synthesis of SCFAs (such as acetic acid, butyric acid, and propionic acid), and reinstated the functionality of their receptors, thereby further rectifying the imbalance of intestinal homeostasis induced by CUMS. Consequently, L-theanine fostered the production of SCFAs by reshaping the gut microbiota, which targeted and diminished the inflammatory response in the PFC, thereby inhibiting the depression via the “gut-SCFAs-brain” axis.

Methods

Chemicals and reagents

l-theanine (purity of 98%) was obtained from Tianjin Heowns Biochemical Technology Co., Ltd. (Tianjin, China). The antibodies used for Western blot were: NLRP3 (Affinity, DF7438), Occludin (Proteintech,66378), ZO-1 (Servicebio, GB115686), TLR9 (Affinity, DF2970), Cleaved Caspase-1 (Cell Signaling Technology, 89332), GAPDH (Servicebio, GB15004). The tricolor pre-stained protein Marker (Sparkjade®, EC1020) and pre-stained protein Marker (Thermo Scientific™, 26619) were used to label the molecular weights of WB bands. SCFAs standards used in the experiment: acetic acid (A116165), propionic acid (P110445), butyric acid (B110439), isobutyric acid (I103524), valeric acid (V108272), and isovaleric acid (I108280) were purchased from Aladdin, Shanghai, China.

Animals

C57BL/6 J mice (20–22 g, 6 weeks, male) were purchased from Jiangsu Huachuang Xinnuo Pharmaceutical Technology Co., Ltd and kept under controlled temperature (25 ± 2 °C), humidity (50 ± 5 °C), and a 12-h light/dark cycle conditions in the SPF grade environment of the laboratory animal center at Anhui Agricultural University. In the current study, all experimental procedures were performed strictly according to Chinese legislation regarding the use and care of laboratory animals. The study was approved by the Institutional Animal Care and Use Committee of the Anhui Agricultural University (No. AHAU 2024-018). The mice were acclimated for one week and then randomly divided into six groups (six mice per group): CK (control group), CKT (control + 800 mg/kg l-theanine group), CUMS (CUMS group), CTL (CUMS + 100 mg/kg l-theanine group), CTM (CUMS + 400 mg/kg l-theanine group), and CTH (CUMS + 800 mg/kg l-theanine group). All animal experimental procedures were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Mice model of CUMS

The CUMS, CTL, CTM, and CTH groups were subjected to the CUMS model for 6 weeks, while the CK and CKT groups were not. The CUMS procedure was adapted from Zhao et al.⁴ with minor modifications. The unpredictable stressors for CUMS included wet cage conditions (24 h), swimming in cold water at 4 °C (5 min), tilting the cage at a 45° angle (24 h), tail pinching (3 min), restraint in a 50 ml tube (1 h), foot shock (1.75 mA,10 min), food or water deprivation (24 h), and reversal of the light-dark cycle (24 h). Feed and water were not restricted except as necessary for the experimental procedures. To maintain unpredictability, the stressors were randomized daily.

Experimental design

After a week of acclimatization, the mice were divided into six groups: CK, CKT, CUMS, CTL, CTM, and CTH, with six mice in each group. For 6 weeks, mice in the CKT, CTL, CTM, and CTH groups received daily oral treatments by gavage one hour before the CUMS sessions. Mice in the CK and CUMS groups were given 10 mL/kg of distilled water, and mice in the CTL, CTM, CTH, and CKT groups were given an equal volume of distilled water containing 100 mg/kg, 400 mg/kg, 800 mg/kg, and 800 mg/kg of l-theanine extract. Mice’s body weights were recorded every three days, both before and during the CUMS regimen. Following the treatment period, the mice underwent a series of behavioral tests. At the end of the experiment, the mice’s blood, colon, brain, and feces, etc., were collected for further analysis, and all mice were euthanized by exposure to CO₂ through gradual fill (Fig. 1A).

Open field test (OFT)

The OFT test was used to observe autonomous behavior, exploratory behavior, and stress in experimental animals in an unaccustomed environment. The behavior test procedures were all adapted from Zhao et al.⁴ with minor modifications. It was performed after the 6-week CUMS procedure in our study. In detail, mice were positioned at the central region of a rectangular plexiglass apparatus (40 cm × 40 cm × 30 cm) integrated with Omnitech Superflex Sensors (Omnitech Electronics, Inc.). All quantitative data required for the OFT were also provided by the corresponding software of this sensor system. The experimental chamber was outfitted with an array of infrared photodetectors, which were evenly distributed along each wall to monitor the animals’ movements. The exploratory behavior of the mice was continuously observed for a 10-minute period. Subsequently, the mice’s locomotor activity and the percentage of moving distance within the central zone (comprising the inner 25% of the surface area) and the immobility time (i.e., resting time) of the chamber were quantitatively analyzed to assess the behavioral phenotypes. Immediately after each experiment, the boxes were cleaned with 75% alcohol to avoid interference from residual odors from other mice. The following calculations were performed to quantify behavior: Distance moved in the center zone (%) = 100 ×(Moving distance in the central area / Total moving distance).

Sugar preference test (SPT)

The SPT was used to quantify the loss of interest in rewarding stimuli and was performed after the 6-week CUMS procedure in our study. After water deprivation for 24 h, the test period was entered, in which the mice were given one bottle of 1% sucrose water (100 mL) and one bottle of pure water (100 mL) for 12 h. During the test, the positions of the two bottles were interchanged to avoid the effect of positional preference. At the end of the test, the consumption of sucrose solution and pure water was calculated by weighing the bottles.

Preference for sugar water (%) = consumption of sucrose water/(consumption of sucrose water + consumption of pure water) × 100%.

Forced Swim Test (FST)

The FST is commonly utilized to evaluate the effects of inhibitors and antidepressants. The experiment was executed within a transparent glass cylindrical apparatus with a diameter of 25 cm and a height of 60 cm. This cylinder was filled with 30 cm of clean water maintained at a temperature of 22 ± 1 °C. The testing protocol initiated with a two-minute acclimation phase, followed by the quantification of each mouse’s cumulative immobility duration over the subsequent four-minute period. Immobility was operationally defined as the state in which the mouse ceased active struggling and remained passively afloat, with its head positioned just above the water surface. To ensure experimental consistency and minimize carry-over effects, the water within the cylinder was completely replaced, and the cylinder was thoroughly cleaned and dried prior to the commencement of each individual trial.

Tail Suspension Test (TST)

The TST was frequently employed as a reliable experimental paradigm to assess the therapeutic efficacy of inhibitors and antidepressant agents. In this assay, mice were suspended 20-25 cm above the floor from a custom-built shelf (32 cm in height and 20 cm in width). Medical adhesive tape was applied 2-3 cm from the distal end of each mouse’s tail to secure it to the shelf. The testing procedure spanned a total of 6 minutes, with the first 2 minutes designated as an acclimation phase. Subsequently, the immobility duration of each mouse during the remaining 4-minute period was recorded in a blinded fashion to ensure unbiased data collection.

Histological examination

Colon and the PFC of mice were fixed with paraformaldehyde. After fixation, it was dehydrated with gradient concentration ethanol (70–95%) and embedded in paraffin. Paraffin-embedded sections of the colon and PFC (H&E staining) were stained and observed under a confocal laser scanning microscope (LEICA, Germany).

Inflammatory cytokines and GPCRs mRNA expression assay

The total RNA from experimental samples (colon and PFC) was extracted following the protocol described in the SPARKeasy tissue rapid extraction kit (SPARKjade, Shandong, China). Subsequently, reverse transcription was performed using the SPARKScript II RT Plus kit (SPARKjade). The resulting cDNA was then used for quantitative real-time polymerase chain reaction (qRT-PCR) and analyzed using the Light Cycler 480 II Real-Time PCR System with SYBR Green qPCR Mix (2×) SPARKjade kit. The housekeeping gene 18S rRNA was utilized to normalize the expression of target genes using the 2^−ΔΔCt method⁷⁹. The primer sequences for the inflammatory cytokines and GPCRs investigated in this study were as follow:

18S RNA (Forward primer (5’-3’): AGAAACGGCCACATCCAA, Reverse primer (5’-3’): GGGTCGGGAGTGGGTAATTT); TNF-α (Forward primer (5’-3’): CTTGTTGCCTCCTCTTTTGCTTA, Reverse primer (5’-3’): CTTTATTTCTCAATGACCCGTAG); IL-1β (Forward primer (5’-3’): TGGGAAACAACAGTGGTCAGG, Reverse primer (5’-3’): AGGCATTTCTCCTCGTCGAA); IL-22 (Forward primer (5’-3’): GCCAGCCTTGCAGATAACAA, Reverse primer (5’-3’): GTTTGGTCAGGAAAGGCACC); IL-10 (Forward primer (5’-3’): CCCATTCCTCGTCACGATCTC, Reverse primer (5’-3’): TCAGACTGGTTTGGGATAGGTTT); IL-6 (Forward primer (5’-3’): GACTCTTGCGTCAACTTCAAGG, Reverse primer (5’-3’): CAGGCTGTCTTTTGTCAACGA); GPR43 (Forward primer (5’-3’): AATCAGAAGACAGAAAAGGAGCTG, Reverse primer (5’-3’): TCTGGGGTCATTCTCCTTGG); GPR41 (Forward primer (5’-3’): CGACTAGAGATGGCTGTGGT, Reverse primer (5’-3’): AGAAGATGAGCAGTGTGGCT).

Western blot

Western blot was applied to detect the expression of key inflammatory pathway proteins and barrier proteins in colon and PFC. The experimental procedure was similar to our previous experimental scheme³⁷. Briefly, homogenate, cytoplasmic, and nuclear proteins were extracted according to the instructions of the extraction kit (Jiancheng, Nanjing, China). Proteins were separated by 10% SDS/PAGE and transferred to the PVDF membrane. After being closed in 5% skim milk for 2 h, primary antibodies were added and incubated overnight at 4 °C. The secondary antibody was then added and incubated for 1 h at room temperature. Protein expression was measured using an enhanced chemiluminescence light detection kit (Affinity, Jiangsu, China).

Determination of gut microbiota

The specific protocols of the experiments were consistent with our previous experiments³⁷. The total DNA of fecal microorganisms was extracted according to a commercial kit (Omega Bio-Tek, Norcross, GA, USA) and amplification of the V3-V4 region of the 16 s rRNA gene was completed using PCR (forward primer (5’-ACTCCTACGGGAGGCAGAG-3’) and reverse primer (5’-GGACTACHVGGGTWTCTAAT-3’)) (95 °C reaction for 3 min; denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, 30 cycles; end at 10 °C). The PCR products were then purified and quantified using a DNA gel extraction kit (Axygen Biosciences, Union City, CA, USA) and a Quantus™ fluorometer (Promega, USA). Quality control and splicing were completed using Fastp (version 0.19.6, https://github.com/OpenGene/fastp) and FLASH (version 1.2.11, https://ccb.jhu.edu/software/FLASH/index.shtml) software, and sequences were denoised using the DADA2 plug-in in Qiime2 (version 2020.2, https://qiime2.org). The data were finally analyzed on the online platform Majorbio Cloud (www.majorbio.com). In the community structure analysis, Principal Coordinates Analysis (PCoA) was performed based on the microbial community data at the phylum level. Using R-3.3.1 (with the vegan package), the Bray-Curtis distance was employed to measure the differences among microbial communities. Additionally, Analysis of Similarities (ANOSIM) (with 999 permutations) was conducted to verify the inter-group differences, thereby presenting the clustering characteristics of the sample community structure.

Quantification of SCFAs

Mouse feces were mixed with distilled water (1:10 w/v) and vortexed for 5 min, and the supernatant (centrifuged at 3000 r/min, 4 °C for 10 min) was filtered through a 0.22 μm aqueous membrane to obtain the solution to be measured. The mouse serum was mixed with distilled water at a ratio of 1:9 (v/v), vortexed to mix evenly, and then also filtered through a 0.22-μm aqueous phase filter membrane to obtain the solution to be tested. Quantitative analysis was conducted using a GC-7890B gas chromatograph equipped with a flame ionization detector (Agilent 5977, Santa Clara, CA, USA) and a DB-WAXETR capillary column (30 m × 0.25 mm × 0.25 μm, Agilent). The injector temperature was set at 220 °C, while the detector temperature was maintained at 240 °C. Chromatographic separation was carried out according to a predefined temperature program: an initial isothermal period at 90 °C for 1 minute, followed by a linear ramp at a rate of 10 °C per minute to 150 °C; then, the temperature was increased at 20 °C per minute to 200 °C, with a final 1-minute isothermal hold. A 1-μL sample injection volume was employed. The flow rates of hydrogen (H₂), air, and nitrogen (N₂) were 30 mL/min, 260 mL/min, and 20 mL/min, respectively. Gas chromatographic-grade mixed standards consisting of acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, and isovaleric acid (Aladdin, Shanghai, China) were utilized. The concentrations of short-chain fatty acids (SCFAs, expressed in mmol/L) were determined by correlating the retention times of the analytes with those of the reference standards. For the Spearman’s correlation analysis of the colon gut microbiome and SCFAs, the data were finally analyzed on the online platform Majorbio Cloud (www.majorbio.com). In the correlation analysis, a Spearman correlation heatmap was used to explore the associations between gut microbiota at the genus level and SCFAs. Based on Spearman’s rank correlation, analyses were performed on the top 50 most abundant species from the ASV_Taxon_Depth table using R-3.3.1 and Python 2.7. For clustering settings, no clustering was applied at the species level, while Average linkage clustering was adopted at the clinical factor level. Unclassified units were retained in the analysis, and multiple groups were included with a minimum sample size of 3 per group. Color gradients (orange for positive correlations and green for negative correlations) and asterisk labels were used to indicate significant associations, thereby facilitating the interpretation of the interactive relationships between gut microbiota and SCFA metabolism.

Detection of 5-HT, DA, and GABA in serum

5-HT, DA, and GABA levels in the serum were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China, Product Code: H104-1-1, H170-1-1, H168-1-1).

Statistical analysis

In this experiment, data analysis was performed using SPSS software. Skewed distribution statistics were applied, and data points above the 90th percentile were screened and excluded as outliers, yielding the final data points used in this study. Statistical analyses were performed using Prism 9.0 (GraphPad Software, San Diego, CA). All data were presented as mean ± SEM. To compare data between 2 groups, T-test was used. One-way analysis of variance (ANOVA), followed by Dunnett’s multiple comparisons, was used to compare the data of more than 2 groups of samples. Additionally, the raw p-values obtained from multiple comparisons of correlation heatmaps and behavioral data with multiple endpoints were further subjected to multiple test correction using the False Discovery Rate (FDR) test, to control the risk of false positives. The significance level was set at *p < 0.05, **p < 0.01, ***p < 0.001. (After correction, when determining significance based on the q-values corresponding to FDR, the criteria were consistent with the aforementioned p-value thresholds).

Author contributions

Y. Peng wrote the main manuscript text and prepared all figures. T. Yu and C. Qin did the form analysis. F. Li, Z. Xu, Q. Fang, and A. Cheng did the investigation and data curation. X. Zhai and X. Fu provided guidance on the methodology. D. Li and S. Hu proposed the idea and supervision, and funding acquisition. All authors reviewed the manuscript.

Data availability

Data will be made available on request. Data on 16S rRNA sequencing in this study are publicly available at https://www.ncbi.nlm.nih.gov/ (BioProject ID: PRJNA1274416).

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s41538-025-00651-0.