TABLE 1.
Primers used for sequencing of the blaSIM-1 gene and for detection of MBL genes
| Target | Primer | Use | Sequence (5′ to 3′) | Positiona | Reference |
|---|---|---|---|---|---|
| 5′-CS | INT1-F | Detection and sequencing | GGCATCCAAGCAGCAAG | 1256-1272 | 13 |
| 3′-CS | INT2-R | Detection and sequencing | AAGCAGACTTGACCTGA | 4336-4620 | |
| intI1 | INT7-R | Sequencing | GTTCTTCTACGGCAAGGTGC | 956-937 | 12 |
| arr-3 | ARR3-F | Sequencing | GGTGACTTGCTAACCACAG | 91-109 | 25 |
| ARR3-R | Sequencing | ACAGTGACATAGCAAGTTCAG | 211-191 | ||
| aadA1 | AADA1-F | Sequencing | TGATTTGCTGGTTACGGTGAC | 144-164 | 12 |
| AADA1-R | Sequencing | CACTACATTTCGCTCATCG | 561-543 | ||
| blaIMP-1 | IMP1-F | Detection | CATGGTTTGGTGGTTCTTGT | 601-620 | 29 |
| IMP1-R | Detection | ATAATTTGGCGGACTTTGGC | 1048-1029 | ||
| blaVIM-2 | VIM2-F | Detection | ATGTTCAAACTTTTGAGTAAG | 1-21 | 19 |
| VIM2-R | Detection | CTACTCAACGACTGAGCG | 801-784 | ||
| blaSIM-1 | SIM1-F | Detection and sequencing | TACAAGGGATTCGGCATCG | 127-145 | This study |
| SIM1-R | Detection and sequencing | TAATGGCCTGTTCCCATGTG | 697-678 | ||
| blaSIM-1 | SIM1-Exp/f | Cloning and expression | GGTCTAGAAGGAGAGTTAAAAATGAGAACTTTATTGATTT | 1-19 | This study |
| SIM1-Exp/r | Cloning and expression | CCGGATCCTTAATTAATGAGCGGCGGTTTTG | 719-741 | ||
| 16S rRNA | 8F | Sequencing | AGAGTTTGATCCTGGCTCAG | 8-27 | 15 |
| 1541R | Sequencing | AAGGAGGTGATCCAGCCGCA | 1541-1522 |
a
Position numbers correspond to the nucleotides of the coding sequences, except for the integron, for which position number 1 is the first nucleotide of the 5′ conserved segment (AY046276). For the SIM1-Exp primers, the regions annealing to the blaSIM-1 coding sequence are underlined.