Descriptions of three hundred new species of Hesperiidae (Lepidoptera: Papilionoidea)

Abstract

Genomic sequencing and analysis offer a fast track to cataloguing biodiversity and facilitating species discovery. A comprehensive genomic study of Hesperiidae Latreille, 1809 (Lepidoptera), incorporating primary type specimens, uncovers a plethora of species previously unknown to science. Three hundred of them (one in a new genus, and one in a new subgenus) are described here (type localities are given in parentheses): Hasora vietnama Grishin, new species (Vietnam: Đắk Nông), Drephalys (Paradrephalys) oriana Grishin, new species (Panama: Colón), Drephalys (Paradrephalys) aurantior Grishin, new species (Panama: Colón), Drephalys (Paradrephalys) pulcher Grishin, new species (Panama: Panamá Oeste), Drephalys (Drephalys) phoelides Grishin, new species (Panama: Panamá), Drephalys (Drephalys) panamys Grishin, new species (Panama: Colón), Phanus centralis Grishin, new species (El Salvador: San Salvador), Phanus vitreides Grishin, new species (Ecuador: Orellana), Hyalothyrus inferna Grishin, new species (Brazil: Rondônia), Tarsoctenus stenopapias Grishin, new species (Peru: Madre de Dios), Phocides tema Grishin, new species (Guatemala), Bungalotis lotis Grishin, new species (Belize), Dyscophellus porsenica Grishin, new species (Peru: Madre de Dios), Dyscophellus santamarta Grishin, new species (Colombia: Magdalena), Euriphellus huellus Grishin, new species (Colombia: Vaupés), Cecropterus (Cecropterus) spinipes Grishin, new species (Brazil: Rio Grande do Sul), Cecropterus (Thorybes) septelucis Grishin, new species (Mexico: Chiapas), Cecropterus (Murgaria) lapus Grishin, new species (Mexico: Sinaloa), Cecropterus (Murgaria) margo Grishin, new species (Mexico: Nayarit), Cecropterus (Murgaria) amazonensis Grishin, new species (Brazil: Rondônia), Spicauda surprisa Grishin, new species (Brazil: Paraná), Spicauda pecne Grishin, new species (Peru: Cajamarca), Urbanus (Urbanoides) xenophon Grishin, new species (Costa Rica: San José), Urbanus (Urbanus) torcidus Grishin, new species (Colombia: east), Urbanus (Urbanus) viterbo Grishin, new species (Colombia: east), Urbanus (Urbanus) alvinus Grishin, new species (Peru: Cuzco), Telegonus (Telegonus) alco Grishin, new species (Panama: Panamá Oeste), Telegonus (Telegonus) loretus Grishin, new species (Peru: Loreto), Telegonus (Telegonus) tenebricus Grishin, new species (Mexico: Veracruz), Telegonus (Telegonus) colombus Grishin, new species (Colombia: Meta), Telegonus (Telegonus) argentinus Grishin, new species (Argentina: Misiones), Telegonus (Telegonus) chuchuvis Grishin, new species (Ecuador: Esmeraldas), Telegonus (Rhabdoides) lesus Grishin, new species (Colombia: Antioquia), Telegonus (Rhabdoides) fortis Grishin, new species (USA: Texas), Telegonus (Rhabdoides) occultus Grishin, new species (Mexico: Oaxaca), Telegonus (Rhabdoides) leptus Grishin, new species (Mexico: San Luis Potosí), Autochton (Autochton) xaca Grishin, new species (Mexico: Oaxaca), Autochton (Autochton) nama Grishin, new species (Panama: Panamá Oeste), Autochton (Autochton) pacovena Grishin, new species (Venezuela: Zulia), Autochton (Autochton) pera Grishin, new species (Peru: Madre de Dios), Autochton (Autochton) colombianus Grishin, new species (Colombia: Chocó), Autochton (Autochton) bipunctaticus Grishin, new species (Peru: Madre de Dios), Astraptes guyana Grishin, new species (Guyana), Epargyreus argentinicus Grishin, new species (Argentina: Jujuy), Epargyreus tmolucan Grishin, new species (Argentina: Tucumán), Chioides australis Grishin, new species (Bolivia: La Paz), Aguna peruander Grishin, new species (Peru: Amazonas), Aguna leucoriga Grishin, new species (Brazil: Minas Gerais), Aguna paraica Grishin, new species (Brazil: Pará), Aguna paracoelus Grishin, new species (Brazil: Pará), Aguna aguna Grishin, new species (Panama: Veraguas), Aguna manchancha Grishin, new species (Brazil: Rondônia), Aguna guyanae Grishin, new species (Guyana), Aguna curvicoelus Grishin, new species (Panama: Darién), Aguna lumba Grishin, new species (Ecuador: Sucumbíos), Aguna yasuna Grishin, new species (Ecuador: Orellana), Aguna stenozonius Grishin, new species (Guyana), Aguna latifasciata Grishin, new species (Peru: Loreto), Lobotractus bajasur Grishin, new species (Mexico: Baja California Sur), Lobotractus myseriana Grishin, new species (Mexico: Oaxaca), Ridens ankon Grishin, new species (Ecuador: Chimborazo), Ridens fulmina Grishin, new species (Peru: Huánuco), Ridens gracilis Grishin, new species (Panama: Darién), Venada chiapa Grishin, new species (Mexico: Chiapas), Venada maria Grishin, new species (Peru: Huánuco), Venada boliva Grishin, new species (Bolivia: La Paz), Cephise fulvus Grishin, new species (Brazil: Rondônia), Ectomis (Asina) sine Grishin, new species (Mexico: Tamaulipas), Ectomis (Ectomis) lipas Grishin, new species (Mexico: Tamaulipas), Ectomis (Ectomis) pernicioides Grishin, new species (Brazil: São Paulo), Ectomis (Ectomis) albovenissima Grishin, new species (Brazil: Santa Catarina), Telemiades nidas Grishin, new species (Panama: Colón), Telemiades canticus Grishin, new species (Mexico: Oaxaca), Telemiades squador Grishin, new species (Ecuador: Napo), Polygonus amazonus Grishin, new species (Peru: Loreto), Typhedanus ampyxacus Grishin, new species (Mexico: Oaxaca), Typhedanus umbrosus Grishin, new species (Colombia), Cogia huila Grishin, new species (Mexico: Coahuila), Coladenia javi Grishin, new species (Indonesia: Java), Abaratha (Abaratha) bhutana Grishin, new species (Bhutan), Abantis (Caprona) ana Grishin, new species (Kenya: Mombasa), Mysoria (Mysarbia) centralia Grishin, new species (Panama: Darién), Gindanes brebus Grishin, new species (Peru: Loreto), Quadrus (Trifa) cobus Grishin, new species (Ecuador: Sucumbíos), Quadrus (Quadrus) alis Grishin, new species (Mexico: Oaxaca), Quadrus (Quadrus) rialis Grishin, new species (Guatemala: Cayuga), Quadrus (Quadrus) tee Grishin, new species (Colombia: Antioquia), Quadrus (Quadrus) truncatoides Grishin, new species (Peru: Cuzco), Quadrus (Quadrus) lugubroides Grishin, new species (Mexico: Oaxaca), Quadrus (Tuberna) syntrophos Grishin, new species (Ecuador: Orellana), Quadrus (Cyrna) baris Grishin, new species (Mexico: San Luis Potosí), Quadrus (Cyrna) pacuvius Grishin, new species (Ecuador: Pastaza), Quadrus (Cyrna) rahus Grishin, new species (Ecuador: Tungurahua), Quadrus (Ebona) fuscus Grishin, new species (Panama: Panamá), Quadrus (Ebona) atrus Grishin, new species (Panama: Chiriquí), Quadrus (Ebona) evanitza Grishin, new species (Brazil: Rondônia), Quadrus (Zera) panamia Grishin, new species (Panama: Chiriquí), Quadrus (Zera) chinchia Grishin, new species (Ecuador: Pichincha), Quadrus (Zera) cinthinus Grishin, new species (Mexico: Veracruz), Milanion (Milanion) chelatus Grishin, new species (Peru: Huánuco), Milanion (Milanion) guianensis Grishin, new species (Guyana), Eantis (Minna) willa Grishin, new species (Brazil: Rondônia), Eantis (Thilla) maurus Grishin, new species (Brazil: Pará), Aethilla mexina Grishin, new species (Mexico: Veracruz), Achlyodes centralis Grishin, new species (Panama: Darién), Achlyodes cacaus Grishin, new species (Brazil: Rondônia), Spioniades abbreviatissima Grishin, new species (Colombia: Meta), Spioniades ana Grishin, new species (Ecuador: Tungurahua), Mimia engana Grishin, new species (Ecuador: Oriente, Río Engaño), Xispia superquadrata Grishin, new species (Brazil: Rondônia), Xispia equadra Grishin, new species (Ecuador: Napo), Myrinia distincta Grishin, new species (Peru: Amazonas), Morvina jana Grishin, new species (Brazil: Rio de Janeiro), Morvina caura Grishin, new species (Venezuela: Suapure), Morvina cola Grishin, new species (Colombia: Boyacá), Cyclosemia hebes Grishin, new species (“Amazons”), Cyclosemia alatha Grishin, new species (Bolivia), Cyclosemia trichroma Grishin, new species (Brazil: Rio de Janeiro), Cyclosemia andeania Grishin, new species (Peru: Amazonas), Cyclosemia mexicania Grishin, new species (Mexico: Veracruz), Cyclosemia decorata Grishin, new species (Ecuador: Zamora-Chinchipe), Cyclosemia supercaerulea Grishin, new species (Ecuador: Esmeraldas), Cyclosemia bolivia Grishin, new species (Bolivia: Santa Cruz), Cyclosemia rondonnius Grishin, new species (Brazil: Rondônia), Cyclosemia ecuadoria Grishin, new species (Ecuador: Napo), Cyclosemia peruvia Grishin, new species (Peru: Cuzco), Iliana (Nastrus) amazona Grishin, new subgenus and new species (Brazil: Amazonas) (type species of the subgenus), Tiana ater Grishin, new species (Panama: Coclé), Tiana nigerrima Grishin, new species (Ecuador: Pastaza), Nisoniades (Bezus) occibessus Grishin, new species (Peru: Madre de Dios), Nisoniades (Nisoniades) equaphora Grishin, new species (Ecuador: Loja), Bolla (Bovaria) damera Grishin, new species (Mexico: Oaxaca), Bolla (Bolla) aureiceps Grishin, new species (Ecuador: Pichincha), Bolla (Sebia) zuela Grishin, new species (Venezuela: Mérida), Bolla (Sebia) guatemalensis Grishin, new species (Guatemala), Bolla (Stolla) bolla Grishin, new species (Bolivia: Cochabamba), Bolla (Stolla) manu Grishin, new species (Peru: Madre de Dios), Staphylus (Vulga) maria Grishin, new species (Peru: Huánuco), Staphylus (Vulga) cuzos Grishin, new species (Peru: Cuzco), Staphylus (Vulga) metos Grishin, new species (Colombia: Meta), Staphylus (Staphylus) panamicus Grishin, new species (Panama: Guna Yala), Pholisora suroesta Grishin, new species (Mexico: Oaxaca), Noctuana mimica Grishin, new species (Mexico: Oaxaca), Noctuana statoreca Grishin, new species (Ecuador: Napo), Noctuana statorana Grishin, new species (Guyana), Noctuana haematospilata Grishin, new species (Peru: Cuzco), Noctuana ventrovenata Grishin, new species (Peru: Cuzco), Windia sonoria Grishin, new species (Mexico: Sonora), Ernsta (Delaga) aspes Grishin, new species (Namibia: 4 km east of Otavi), Heliopetes (Heliopyrgus) willioides Grishin, new species (Argentina: Tucumán), Heliopetes (Heliopetes) arsaltines Grishin, new species (Brazil: Rio de Janeiro), Trina trina Grishin, new species (Panama: Chiriquí), Trina isa Grishin, new species (French Guiana), Santa claus Grishin, new species (Guyana), Anisochoria huanuca Grishin, new species (Peru: Huánuco), Clito mexicens Grishin, new species (Mexico: Oaxaca), Clito sompoides Grishin, new species (Peru: Madre de Dios), Clito ada Grishin, new species (Panama: Colón), Clito rondo Grishin, new species (Brazil: Rondônia), Clito zeloticus Grishin, new species (Brazil: Rio de Janeiro), Clito hondo Grishin, new species (Honduras), Clito pallida Grishin, new species (Brazil: Mato Grosso), Echelatus jamaicus Grishin, new species (Jamaica: Kingston), Anaxas songus Grishin, new species (Bolivia: La Paz), Potamanaxas crandama Grishin, new species (Panama: Darién), Potamanaxas ecuada Grishin, new species (Ecuador: Pastaza), Potamanaxas enez Grishin, new species (Venezuela: Aragua), Potamanaxas huanca Grishin, new species (Peru: Pasco), Potamanaxas quigga Grishin, new species (Colombia: Caquetá), Festivia festi Grishin, new species (Panama: Darién), Festivia hannah Grishin, new species (Colombia), Festivia tolima Grishin, new species (Colombia: Tolima), Sostrata guyata Grishin, new species (Guyana), Sostrata rondata Grishin, new species (Brazil: Rondônia), Sostrata peruata Grishin, new species (Peru: Madre de Dios), Gorgythion centralina Grishin, new species (Guatemala: Santa Rosa), Gorgythion canalina Grishin, new species (Panama: Panamá Oeste), Gorgythion ayas Grishin, new species (Ecuador: Guayas), Gorgythion calima Grishin, new species (Colombia: Valle del Cauca), Gorgythion lorina Grishin, new species (Peru: Loreto), Gorgythion cerrada Grishin, new species (Brazil: Goiás), Camptopleura mexicanes Grishin, new species (Mexico: Veracruz), Felicena wau Grishin, new species (Papua New Guinea: Morobe), Mnaseas violaceus Grishin, new species (Guyana), Cyclosma paragua Grishin, new species (Paraguay: Sapucaí), Lindra pindra Grishin, new species (Panama: Panamá), Metron chrysoaca Grishin, new species (Mexico: Oaxaca), Metron cremicolor Grishin, new species (Brazil: São Paulo), Metron cerradon Grishin, new species (Brazil: Mato Grosso), Metron fascia Grishin, new species (Costa Rica: Heredia), Tisias ador Grishin, new species (Ecuador: Morona-Santiago), Tisias migera Grishin, new species (Brazil: Minas Gerais), Xeniades (Tixe) cuska Grishin, new species (Peru: Cuzco), Oligoria (Oligoria) colombia Grishin, new species (Colombia: Cauca), Oligoria (Oligoria) argentinia Grishin, new species (Argentina: Jujuy), Oligoria (Oligoria) ecuadoria Grishin, new species (Ecuador: Napo), Oligoria (Oligoria) peruvia Grishin, new species (Peru: Junín), Atrytonopsis dospuntos Grishin, new species (Mexico: Oaxaca), Thespieus genta Grishin, new species (Peru: Cuzco), Thespieus panareus Grishin, new species (Panama: Chiriquí), Thespieus maldan Grishin, new species (Mexico: Tamaulipas), Alychna bogotana Grishin, new species (Colombia: Bogotá), Alychna colonis Grishin, new species (Ecuador: Napo), Alychna semicolonis Grishin, new species (Ecuador: Cuzco), Wahydra vekana Grishin, new species (Colombia: Cundinamarca), Adlerodea asemodia Grishin, new species (Ecuador: Pichincha), Mucia castana Grishin, new species (Ecuador: Zamora-Chinchipe), Mucia strigemma Grishin, new species (Ecuador: Morona-Santiago), Vinius panamius Grishin, new species (Panama: Herrera), Cynea (Cynea) veneatra Grishin, new species (Venezuela: Aragua), Cynea (Cynea) equatra Grishin, new species (Ecuador: Pichincha), Cynea (Nycea) pindus Grishin, new species (Guyana), Onophas flossus Grishin, new species (Panama: Panamá Oeste), Onophas flos Grishin, new species (Honduras), Eutus costa Grishin, new species (Costa Rica: Cartago), Thoon dius Grishin, new species (Mexico: Tamaulipas), Thoon rondius Grishin, new species (Brazil: Rondônia), Alerema complex Grishin, new species (USA: Texas), Niconiades sor Grishin, new species (Mexico: Oaxaca), Moeris nana Grishin, new species (Brazil: Paraná), Gallio tholos Grishin, new species (Guyana), Gallio pallidus Grishin, new species (Peru: Madre de Dios), Mnasicles (Remella) wemex Grishin, new species (Mexico: Oaxaca), Mnasicles (Remella) vembia Grishin, new species (Venezuela: Barinas), Mnasicles (Remella) aca Grishin, new species (Mexico: Oaxaca), Mnasicles (Remella) ritama Grishin, new species (Panama: Chiriquí), Mnasicles (Mnasicles) nama Grishin, new species (Panama: Chiriquí), Mnasicles (Mnasicles) doraon Grishin, new species (Ecuador: Guayas), Amblyscirtes (Amblyscirtes) azteca Grishin, new species (Mexico: Nayarit), Amblyscirtes (Amblyscirtes) cupreus Grishin, new species (Mexico: Hidalgo), Amblyscirtes (Mastor) fimbriora Grishin, new species (Mexico: Nuevo León), Amblyscirtes (Mastor) aspilus Grishin, new species (Mexico: Oaxaca), Amblyscirtes (Mastor) sonofolia Grishin, new species (Mexico: Jalisco), Amblyscirtes (Mastor) verafolia Grishin, new species (Mexico: Chiapas), Amblyscirtes (Mastor) nayafolia Grishin, new species (Mexico: Nayarit), Vidius calacato Grishin, new species (Brazil: Rio de Janeiro), Cobalopsis tys Grishin, new species (Mexico: Oaxaca), Artonia darienia Grishin, new species (Panama: Darién), Artonia guiania Grishin, new species (Guyana), Corra panka Grishin, new species (Panama: Chiriquí), Cymaenes bahiensis Grishin, new species (Brazil: Bahia), Cymaenes guianensis Grishin, new species (French Guiana), Cymaenes paraibes Grishin, new species (Brazil: Paraíba), Cymaenes taboga Grishin, new species (Panama: Panamá), Lerema (Morys) valerianus Grishin, new species (French Guiana), Saturnus oaxacus Grishin, new species (Mexico: Oaxaca), Saturnus jaguarundi Grishin, new species (Peru: Madre de Dios), Streakus unisolus Grishin, new genus and new species (Peru: Cuzco) (type species of the genus), Vistigma (Penicula) cometa Grishin, new species (Colombia: Meta), Phlebodes trapinex Grishin, new species (Guyana), Phlebodes punto Grishin, new species (Peru: San Martín), Phlebodes maransis Grishin, new species (Ecuador: Pastaza), Metiscus gothic Grishin, new species (Colombia: Valle del Cauca), Lychnuchus (Enosis) philos Grishin, new species (Panama: Darién), Mit albitornus Grishin, new species (Ecuador: Napo), Callimormus turnus Grishin, new species (Mexico: Tamaulipas), Callimormus saturnicus Grishin, new species (Brazil: Mato Grosso), Lento tolus Grishin, new species (French Guiana), Lento amazo Grishin, new species (Brazil: Pará), Lento flecha Grishin, new species (Peru: Madre de Dios), Virga radiolius Grishin, new species (Ecuador: Pastaza), Virga marmolius Grishin, new species (Brazil: Rondônia), Mnestheus itta Grishin, new species (Panama: Panamá Oeste) Mnestheus ittonica Grishin, new species (Peru: Cuzco) Ludens lombens Grishin, new species (Colombia), Rigga spanglata Grishin, new species (Peru: Cuzco), Rigga bia Grishin, new species (Colombia: Valle del Cauca), Racta iria Grishin, new species (Ecuador: Napo), Mnasinous (Mnasinous) patagopsis Grishin, new species (Panama: Chiriquí), Thargella (Volus) amazella Grishin, new species (Peru: Madre de Dios), Synapte sala Grishin, new species (Mexico: San Luis Potosí), Synapte oaxala Grishin, new species (Mexico: Oaxaca), Mnasalcas tenapana Grishin, new species (Ecuador: Napo), Ancyloxypha aureata Grishin, new species (Peru: La Libertad), Oarisma (Copaeodes) jeor Grishin, new species (Brazil: Mato Grosso), Panoquina sinasona Grishin, new species (Mexico: Sinaloa), Zenis lipas Grishin, new species (Mexico: Tamaulipas), Calpodes rostris Grishin, new species (Mexico: Oaxaca), Calpodes rostridus Grishin, new species (Venezuela: Mérida), Calpodes perlatus Grishin, new species (Brazil: Pará), Calpodes contrastus Grishin, new species (Brazil: Rio Grande do Sul), Calpodes fissalius Grishin, new species (Colombia: Boyacá), Calpodes parasalius Grishin, new species (Suriname), Calpodes chimalapus Grishin, new species (Mexico: Oaxaca), Calpodes vividus Grishin, new species (Colombia: Boyacá), Calpodes obscurus Grishin, new species (Colombia: Valle del Cauca), Calpodes antonus Grishin, new species (Mexico: Oaxaca), Calpodes venamus Grishin, new species (Venezuela: Carabobo), Calpodes calimus Grishin, new species (Colombia: Valle del Cauca), Calvetta calva Grishin, new species (Panama: Colón); Carystus (Argon) gus Grishin, new species (Mexico: Oaxaca), Aroma oma Grishin, new species (Panama: Colón), Molo reticulatus Grishin, new species (Ecuador: Esmeraldas), Mielkeus tertius Grishin, new species (Costa Rica: Cartago), Damas surivenas Grishin, new species (Suriname), Pyrrhopygopsis bixis Grishin, new species (Ecuador: Orellana), Oenides ecuadorina Grishin, new species (Ecuador: Pastaza), Oenides erytorna Grishin, new species (Peru: Huánuco), Oenides andina Grishin, new species (Peru: Cuzco), and Oenides peruvina Grishin, new species (Peru: Pasco). We confirm that Papilio aulestis Cramer, 1780 is an incorrect original spelling of Papilio aulestes Cramer, 1780; propose that Thymele dirpha Boisduval, 1832 and Thymele phalos Boisduval, 1832 are nomina dubia in Hesperiidae, probably Trapezitinae Waterhouse and Lyell, 1914; and fix the type species of Felicena Waterhouse, 1932 as Sabera albicilla Joicey and Talbot, 1917. The following taxa were formerly treated as subspecies or synonyms and are here reinstated or given new status as species (listed here alongside the species they were originally subspecific to or synonymized with, in parentheses): Hasora danda Evans, 1949, Hasora china Evans, 1949, and Hasora taiwana Hsu, Tsukiyama and Chiba, 2005 (not Hasora anura Nicéville, 1889), Drephalys (Paradrephalys) formosus (C. Felder and R. Felder, 1867) (not Drephalys (Paradrephalys) dumeril (Latreille, [1824])), Phanus prestoni L. Miller, 1965 (not Phanus obscurior Kaye, 1925), Cecropterus (Murgaria) herophilus (Plötz, 1881) (not Cecropterus (Thorybes) virescens (Mabille, 1877), Autochton (Autochton) bocus (Plötz, 1882), Autochton (Autochton) dhega (Mabille, 1891), and Autochton (Autochton) agathokles (Ehrmann, 1918) (not Autochton (Autochton) neis (Geyer, 1832)), Autochton (Autochton) orontes (Plötz, 1882) (not Autochton (Autochton) bipunctatus (Gmelin, [1790]), Aguna scheba (Plötz, 1881) (not Aguna asander (Hewitson, 1867)), Aguna leucogramma (Mabille, 1888) (not Aguna albistria (Plötz, 1881)), Ridens philia Evans, 1952 (not Ridens philistus (Hopffer, 1874)), Ectomis flammula (Herrich-Schäffer, 1869) (not Ectomis auginus (Hewitson, 1867)), Coladenia sundae de Jong and Treadaway, 1992 (not Coladenia agni (Nicéville, 1884)), Abaratha (Abaratha) saraya Doherty, 1886 (not Abaratha (Abaratha) agama (Moore, 1858)), Gindanes phagesia (Hewitson, 1868), Gindanes panaetius Godman and Salvin, 1895, and Gindanes brebna Evans, 1953 (not Gindanes brebisson (Latreille, [1824])), Quadrus (Ebona) dampa (Evans, 1953) (not Quadrus (Ebona) juxta (E. Bell, 1934)), Quadrus (Zera) latreilliana (Mabille, 1876) (not Quadrus (Zera) zera (A. Butler, 1870)), Aethilla coracina Butler, 1870 (not Aethilla echina Hewitson, 1870), Morvina pelarge (Godman and Salvin, 1894) (not Morvina fissimacula (Mabille, 1878)), Bolla tornea Evans, 1953 (not Bolla giselus (Mabille, 1883)), Trina phalaena (Mabille, 1898) (not Trina geometrina (C. Felder and R. Felder, 1867)), Santa aquila (Hayward, 1951) (not Santa santes (E. Bell, 1940)), Echelatus dilloni E. Bell and W. Comstock, 1948 (not Echelatus sempiternus (A. Butler and H. Druce, 1872)), Felicena albicilla (Joicey and Talbot, 1917) (not Thymele dirpha Boisduval, 1832, nomen dubium), Metron hypodesma (Plötz, 1882) and Metron gades Evans, 1955 (not Metron chrysogastra (A. Butler, 1870)), Tisias canna Evans, 1955 (not Tisias lesueur (Latreille, [1824]), Onophas flossites (M. Butler, 1874) (not Onophas columbaria (Herrich-Schäffer, 1870)), Mnasicles (Remella) centralis (Herrich-Schäffer, 1869) (not Mnasicles (Remella) remus (Fabricius, 1798)), Mnasicles (Mnasicles) stollmeyeri (E. Bell, 1932) (not Mnasicles (Mnasicles) hicetaon Godman, 1901), Amblyscirtes (Amblyscirtes) prenda Evans, 1955 (not Amblyscirtes (Amblyscirtes) tolteca Scudder, 1872), Amblyscirtes (Mastor) immaculatus Freeman, 1970 (not Amblyscirtes (Mastor) patriciae (Bell, 1959)), Cymaenes theogenis (Capronnier, 1874) (not Cymaenes tripunctus (Herrich-Schäffer, 1865)), Cymaenes sulla (Möschler, 1879) (not Cymaenes theogenis (Capronnier, 1874)), Cymaenes sacchariphila (Dyar, 1917) (not Cymaenes alumna (Butler, 1877)), Virga cometho (Godman, 1901) (not Virga virginius (Möschler, 1883)), Calpodes culta (Evans, 1955) and Calpodes catha (Evans, 1955) (not Calpodes saladin (Evans, 1955)), Calpodes trimacula (Mabille, 1878) (not Calpodes salius (Cramer, 1775)), and Pyrrhopygopsis orasus (H. Druce, 1876) (not Pyrrhopygopsis socrates (Ménétriés, 1855)). The following are new genus-species and species-subspecies combinations (previous parent in parentheses): Viola fatinitza (Plötz, 1884) (not Quadrus Lindsey, 1925), Metron nigroalbum (Shuey, 2024) (not Metrocles Godman, 1900), Aguna scheba haitensis Mabille and Boullet, 1912 (not Aguna asander (Hewitson, 1867)), Morvina pelarge lenia Evans, 1953 (not Morvina fissimacula (Mabille, 1878)), and Felicena albicilla nota Evans, 1949 (not Thymele dirpha Boisduval, 1832, nomen dubium). Pamphila corisana Möschler, 1883 is a junior objective synonym (and a junior secondary homonym) of Cynea corisana (Plötz, 1882). The following are new junior subjective synonyms: Urbanus albimargo rica Evans, 1952 of Cecropterus (Murgaria) herophilus (Plötz, 1881), reinstated status, Ridens fulima Evans, 1952 of Ridens fulminans (Herrich-Schäffer, 1869), Viola egra Evans, 1953 of Viola fatinitza (Plötz, 1884), new combination, Zera teresa Steinhauser, 1989 of Quadrus (Zera) latreilliana (Mabille, 1876), Aethilla melas Plötz, 1882 of Aethilla coracina A. Butler, 1870, reinstated status, Staphylus incanus Bell, 1932 of Bolla (Stolla) chlorocephala Latreille, [1824], Onophas distigma Bell, 1930 of Onophas columbaria (Herrich-Schäffer, 1870), Lento listo Evans, 1955 of Lento imerius (Plötz, 1884), and Pyrrhopygopsis socrates crates Mabille and Boullet, 1912 of Pyrrhopygopsis orasus (H. Druce, 1876). We propose new taxonomic placement for the following synonyms (previous placement given in parentheses): Cecropterus zonilis Mabille, 1883 of Autochton (Autochton) orontes (Plötz, 1882), reinstated status, (not of Autochton (Autochton) bipunctatus (Gmelin, [1790])), Aguna asander jasper Evans, 1952 of Aguna scheba (Plötz, 1881), reinstated status, (not Aguna asander (Hewitson, 1867)), Thymele guatemalaina Ehrmann, 1907 (type locality likely in South America, not in Guatemala) of Aguna albistria (Plötz, 1881) (not of Aguna leucogramma (Mabille, 1888), Gindanes truncata var. obscurascens Mabille and Boullet, 1917 of Quadrus (Quadrus) ophia (Butler, 1870) (not of Quadrus (Quadrus) lugubris (R. Felder, 1869)), Pythonides praxis Plötz, 1884 of Quadrus (Tuberna) deyrollei deyrollei (Mabille, 1877) (not of Quadrus (Tuberna) contubernalis (Mabille, 1883)), and Chapra marcus Strand, 1909 (type locality likely in Mexico) of Amblyscirtes (Mastor) folia Godman, 1900 (not of Amblyscirtes (Amblyteria) exoteria (Herrich-Schäffer, 1869)). Lectotypes are designated for 27 taxa (names in original combinations, type localities in parentheses): Goniurus herophilus Plötz, 1881 (Brazil: Rio de Janeiro), Eudamus philistus Hopffer, 1874 (Peru: Junín), Eudamus fulminans Herrich-Schäffer, 1869 (Brazil, likely southern), Eudamus caunus Herrich-Schäffer, 1869 (likely in Southeast or South Brazil), Gindanes truncata var. obscurascens Mabille and Boullet, 1917 (Venezuela: Mérida), Pythonides praxis Plötz, 1884 (“Cayenne”, likely in French Guiana), Achlyodes bubaris Godman and Salvin, 1895 (Guatemala), Achlyodes calavius Godman and Salvin, 1895 (Panama: Chiriquí), Achlyodes colotes Godman and Salvin, 1895 (Panama: Chiriquí), Achlyodes fatinitza Plötz, 1884 (Colombia), Pterygospidea latreilliana Mabille, 1876 (Brazil), Aethilla melas Plötz, 1882 (Brazil: Rio de Janeiro), Aethilla primus Plötz, 1882 (Brazil: São Paulo), Theagenes stator Godman, 1899 (Mexico: Veracruz), Paches phalaena Mabille, 1898 (Bolivia: La Paz, Tanampaya), Sostrata pusilla Godman and Salvin, 1895 (Panama: Chiriquí), Hesperia hypodesma Plötz, 1882 (Brazil: Pará), Cobalus percosius Godman, 1900 (Mexico: Veracruz), Hesperia corisana Plötz, 1882 (Suriname), Cobalus columbaria Herrich-Schäffer, 1870 (Brazil), Mnasicles geta Godman, 1901 (Mexico: Tabasco), Amblyscirtes folia Godman, 1900 (Mexico: Guerrero), Pamphila ancus Möschler, 1879 (Colombia), Mnasinous patage Godman, 1900 (Mexico: Veracruz), Pamphila panoquinoides Skinner, 1891 (USA: Florida, Monroe Co.), Pamphila errans Skinner, 1892 (USA: California), and Pyrrhopygopsis crates Mabille and Boullet, 1912 (Ecuador: Río Napo). Neotypes are designated for six taxa: Goniurus tarchon Hübner, [1819] (Suriname), Carcharodus mazans Reakirt, [1867] (Mexico: Veracruz), Nisoniades mejicanus Reakirt, [1867] (Mexico: Veracruz), Cobalus centralis Herrich-Schäffer, 1869 (Panama: Chiriquí), Apaustus imerius Plötz, 1884 (South America, likely Brazil: Rio de Janeiro), and Papilio salius Cramer, 1775 (Suriname). Finally, unless stated otherwise, all subgenera, species, subspecies, and synonyms of mentioned genera, subgenera, and species are transferred together with their parent taxa, and taxa not mentioned in this work remain as previously classified.

Introduction

More than 150 years have gone by since Hewitson published his papers describing dozens of new Hesperiidae species in a single work (Hewitson 1867, 1868). During Hewitson’s era, differences in wing patterns were essentially the sole basis for species identification in Lepidoptera. Authors described the external appearance of spread specimens, judged visually, in a brief paragraph that followed a newly proposed species name. This surge in species descriptions was driven by intensified collecting activity in tropical regions of the world that were both species-rich and previously unstudied. Most of the frequently encountered species that differed in wing patterns were described within a few decades, leading some to conclude that nearly all butterfly species had already been discovered.

This perspective shifted with the growing recognition that consistent differences in genitalia often indicate species-level distinctions, even when wing patterns appear similar. This realization led to the strategy of screening genitalia by dissecting large series of specimens to identify potential new species. In the family Hesperiidae Latreille, 1809, this method, originally proposed by Godman and Salvin (1893–1899), was implemented extensively by Evans (Evans 1937, 1949, 1951, 1952, 1953, 1955), who identified more than 1500 new species and subspecies. The genitalia screening methodology was advanced by Austin and colleagues (Austin and Mielke 1998; Austin 2000, 2008) and has continued to be used by others (Dolibaina et al. 2014, 2017; Siewert et al. 2020). For instance, revisions of Phanus Hübner, [1819], Entheus Hübner, [1819], and Aguna R. Williams, 1927 by Austin and collaborators nearly doubled the species count in each genus due to extensive genitalia examination.

The introduction of DNA-based techniques, particularly those suitable for automation in laboratory and computational workflows, marks a new era of species discovery. COI barcoding, made popular by Hebert and colleagues (Hebert et al. 2003), is the most widely used method, though it often falls short when not complemented by morphological analysis (Rubinoff et al. 2006). Nevertheless, when applied carefully, it can be highly effective (Lukhtanov et al. 2016). In species-rich insect groups that have been poorly studied, barcoding surveys produce remarkable results (Fernandez-Triana et al. 2014, 2023; Sharkey et al. 2021).

Although costly, whole-genome screening surpasses barcode screening in reliability because the genome embodies the organism itself (i.e., genotype determines phenotype) and is ideally suited for species delimitation, identification, and discovery. We are applying this genomic screening approach to butterflies, particularly focusing on Hesperiidae, both to refine their higher-level classification (Cong et al. 2019b; Li et al. 2019; Zhang et al. 2019b, 2019d, 2022b, 2023c, 2023f) and to identify new species (Zhang et al. 2022a, 2023b, 2022c, 2024a, 2024b, 2025a). Our core methodology involves obtaining whole genome shotgun data through Illumina short-read sequencing from leg samples of as many butterfly specimens as possible, covering a range of locations, and constructing phylogenetic trees using protein-coding genes from nuclear and mitochondrial genomes. These trees help identify species as compact clades of specimens, as explained in the “Species, subspecies, and genomics” section of Zhang et al. (2022a). Whenever possible, species are identified from first principles by sequencing primary type specimens and incorporating them into the phylogenetic trees. These types then define the clades they cluster within. If types have not been sequenced or are missing, traditional identification methods are employed, starting with the original description and comparing genitalia from specimens collected near the type locality.

Through this process, we find many clades without existing names, representing undescribed taxa. To evaluate whether these clades represent true species, we calculate genetic differentiation (F_st) and gene flow (G_min) between taxa based on predicted proteins located on the Z chromosome: typically, F_st > 0.20 and G_min < 0.05 are indicative of separate species (Cong et al. 2019a). We also assess percent divergence in the COI barcode region, where differences greater than 2% (~13 base pairs) usually point to distinct species (Hebert et al. 2003), though some species recognized by genitalia and biology may show smaller barcode differences (Burns et al. 2008; Zhang et al. 2023b).

Within-species genetic differences are minimal, while inter-species differences are usually substantial. Therefore, unlike phenotype-based taxonomy, which requires many specimens to assess variation, even a single specimen (a holotype) can suffice for genomic species delimitation if its genetic distance from related species is significant. Furthermore, this genomic strategy allows for the designation of female holotypes, which was previously challenging since male genitalia were often necessary for identification. A single female that is genetically distinct from all other species can now serve as the name-bearing type under this method.

Once candidate new species are identified in the genomic trees, we return to examine their morphology, including wing patterns and genitalia, to correlate phenotypic traits with genetic divergence and to define diagnostic characters. In most cases, phenotypic traits can be found, although caution is needed when only a few specimens have been sequenced. Until more specimens are analyzed to study their variation, DNA-based diagnostics, especially using nuclear genome sequences, are more reliable for identifying such cryptic species.

Materials and Methods

Traditionally, new species are discovered through visual assessments of appearance and genitalia, sometimes enhanced by field observations of life history and habitat. In this study, we employ a genomic screening method to uncover new taxa or to verify suspected new species identified from morphology. First, we generate whole genome shotgun sequences from numerous representative Hesperiidae specimens covering nearly all known species across their geographic ranges, including morphologically unusual individuals, using protocols we previously developed (Li et al. 2019; Zhang et al. 2019a). Typically, a leg from a dried, pinned specimen in a collection is used for DNA extraction (see list of collections below). Our protocol works with specimens of any age (Cong et al. 2021). Second, we analyze the genomic data, made up of short DNA segments (150 bp or less), to identify and reconstruct protein-coding regions using DIAMOND (Buchfink et al. 2015) using the previously assembled genome of Cecropterus lyciades (Geyer, 1832) as a reference (Shen et al. 2017). This produces a master-slave alignment in which each specimen’s coding regions are aligned to the reference. Because these alignments are extremely large (~18 million positions), they are randomly subsampled (300,000 positions by codon, or all suitable positions taken for the Z chromosome) for use in phylogenetic tree construction as previously described (Zhang et al. 2022b). Third, we generate phylogenetic trees with IQ-TREE v1.6.12 using the GTR+GAMMA model (Nguyen et al. 2015) from the nuclear genome (autosomes and Z chromosome separately) and the mitochondrial genome, and evaluate node support using Ultrafast bootstrapping (Hoang et al. 2018). These trees are visualized with FigTree (Rambaut 2018) and compared visually.

In these genome-based trees, we look for well-supported clades near the tips that resemble combs or star-like subtrees. Such structures often represent distinct species with strong genetic divergence (Zhang et al. 2022a, 2022c). We prioritize the Z chromosome trees, which are presented in this work, because key speciation genes (e.g., those controlling pheromones, wing patterns, and sexual dimorphism) are usually located on this chromosome, which also shows reduced introgression (Pazhenkova and Lukhtanov 2021). We also provide mitochondrial trees, which, although prone to introgression, offer useful contrast due to their single-locus inheritance and often clear species-level differentiation. The COI barcode region, widely used in taxonomy (Hebert et al. 2003), is part of the mitochondrial genome. When only one specimen exists for a species, we compare its genetic distance to others using both nuclear and mitochondrial data.

Subsequently, we assign names to the species-level clades identified in the trees. When available, this is done using primary type specimens that have been sequenced and incorporated into the trees, assigning the oldest valid name found in the clade. If no valid names apply, existing names in the clade are reconsidered, possibly revived from synonymy. If no types are sequenced, identification relies on morphology, through comparison with existing types or original descriptions, taking into account the type locality. Clades or branches that lack an available name are treated as potential new species and become the focus of further investigation. We study their morphology, including genitalia, to determine how they differ from all known species.

In addition to phenotypic traits, we present DNA-based diagnostic characters from both the nuclear genome and the COI barcode, when present. These markers are identified from protein-coding nuclear regions using previously described methods (see SI Appendix to Li et al. 2019). The rationale for selecting these markers is detailed in Cong et al. (2019b). The character states are listed in abbreviated form. For example, aly728.44.1:G672C indicates that position 672 in exon 1 of gene 44 from scaffold 728 in the reference genome of Cecropterus lyciades (Geyer, 1832) (formerly in Achalarus Scudder, 1872, thus “aly”) (Shen et al. 2017) is C instead of the ancestral G. If a character is diagnostic for a sister clade, the format is aly5294.20.2:A548A (not C), meaning that the ancestral state A remains in the target taxon and has changed to C in the sister clade (so it is not C in the diagnosed taxon). The same notation applies to COI barcode sites, omitting the prefix ending with ‘:’. The sequences of exons from the reference genome with the character positions highlighted in green are given in the supplemental file (Zhang et al. 2025b). Providing a link to these DNA sequences from this publication ensures that the numbers given in the diagnoses can be readily associated with actual sequences. The whole genome shotgun datasets we obtained and used in this work are available from the NCBI database (https://www.ncbi.nlm.nih.gov/) as BioProject PRJNA1294480, and BioSample entries of the project contain the locality and other collection data of the sequenced specimens shown in the trees. Additionally, specimen data are summarized in Table S1 of the supplemental file (Zhang et al. 2025b). COI barcode sequences have been deposited in GenBank under accessions ON480090, ON480169, PV972360–PV972684, PV983801, PV983802. All newly proposed names are registered with ZooBank.

Spread specimens were photographed using a Nikon 800 camera with a 105 mm Nikkor macro lens in NEF (raw) format, converted to TIF format using DxO with color calibration against a 24-patch ColorChecker. Images were edited in Adobe Photoshop CS4 to adjust contrast and brightness, assemble into plates, sharpen, and reduce for publication; while Photoroom API was used for background removal. Imperfections like scale loss, pinholes, and wing tears were not digitally corrected. After DNA extraction, genitalia were treated in 10% KOH either overnight at room temperature (if work paused) or at 65°C for 15–60 minutes depending on size and softness. Dissections were carried out under a stereomicroscope. Genitalia submerged in glycerin were photographed using an AmScope H800–96S-18M3 system (monocular microscope, LED ring light, 18MP USB camera) in 3–15 focus slices, which were merged and further processed in Adobe Photoshop CS4 to brighten the background, rotate, rescale, and assemble into plates. Some genitalia or their parts were stained for photography with Double Stain containing lignin pink, acid fuchsin, GAA, lactic acid, and phenol (e.g., Fig. 919–921, Fig. 1160–1162). Genitalia were subsequently stored in glycerin-filled vials pinned next to each specimen.

The specimens were examined and sampled for sequencing in the following collections (abbreviations, which are not necessarily acronyms of the current names of these institutions, are given in parentheses and used in Table S1 of the supplemental file (Zhang et al. 2025b)): American Museum of Natural History, New York, NY, USA (AMNH), Academy of Natural Sciences of Drexel University, Philadelphia, PA, USA (ANSP), Natural History Museum, London, UK (BMNH), California Academy of Sciences, San Francisco, CA, USA (CAS), Nature Education Center of the Jagiellonian University, Kraków, Poland (CEPUJ) Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), Colorado State University Collection, Fort Collins, CO, USA (CSUC), Cornell University Insect Collection, Ithaca, New York, USA (CUIC), Universidade Federal do Paraná, Curitiba, Paraná, Brazil (DZUP) together with Olaf H. H. Mielke Collection (OM-DZUP), Essig Museum of Entomology, University of California, Berkeley, CA, USA (EMEC), Field Museum of Natural History, Chicago, IL, USA (FMNH), Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM), Mississippi Entomological Museum, Starkville, MS, USA (MEM), Museum für Naturkunde, Berlin, Germany (MFNB), McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA (MGCL), Museo del Instituto de Zoología Agrícola “Francisco Fernandez Yépez”, Universidad Central de Venezuela, Maracay, Venezuela (MIZA), Muséum National d’Histoire Naturelle, Paris, France (MNHP), Museum für Tierkunde, Dresden, Germany (MTD), Museo de Historia Natural, Lima, Peru (MUSM), Naturalis Biodiversity Center, Leiden, Netherlands (RMNH), Senckenberg Deutsches Entomologisches Institut, Müncheberg, Germany (SDEI), Senckenberg Naturmuseum, Frankfurt, Germany (SMF), Staatliches Museum für Naturkunde, Karlsruhe, Germany (SMNK), Staatliches Museum für Naturkunde, Stuttgart, Germany (SMNS), Texas A&M University Insect Collection, College Station, TX, USA (TAMU), Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), Bohart Museum of Entomology, University of California, Davis, CA, USA (UCDC), National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), Burke Museum of Natural History and Culture, Seattle, WA, USA (UWBM), Zentrum fur Biodokumentation des Saarlandes, Schiffweiler, Germany (ZfBS), Zoologische Staatssammlung München, Germany (ZSMC), and research collections of Pierre Boyer, France (PBC), Jim P. Brock, USA (JPB), Ernst Brockmann, Germany (EBC), Matthew J. W. Cock, UK (MJWC), William R. Dempwolf, USA (WRD), Bernard Hermier, French Guiana (BHC), the late Edward C. Knudson, USA (TLS, i.e., Texas Lepidoptera Survey, specimens now in MGCL), Kiyoshi Maruyama, Japan (KMC), the late James A. Scott, USA (JASC, Neotropical Hesperiidae now in JASh), John A. Shuey, USA (JASh), Jeff R. Slotten, USA (JRSC), Jiro Uehara, Japan (JUC) and Mark Walker, USA (MWC). Type status abbreviations are HT holotype, ?HT possible holotype, LT lectotype, NT neotype, ST syntype, ?ST possible syntype, AT allotype, PT paratype, and PLT paralectotype.

Results and Discussion

Genomic investigations of Hesperiidae species throughout their geographic distributions have revealed 300 genetically distinct and previously unnamed phylogenetic lineages, which are described here as new species. Each of these represents a genotypically unique lineage, clearly separated from other similar lineages. Many appear to be allopatric in relation to their closest relatives; however, the transition from one species to another in genotype is abrupt, with no intermediates observed. A detailed justification for recognizing each species is provided in the “Definition and diagnosis” sections below.

Each species is placed within existing identification keys that provide more extensive phenotypic characterization (Evans 1937, 1949, 1951, 1952, 1953, 1955), and phenotypic characters are presented to distinguish it from its closest relatives. Phylogenetic trees that include the holotype illustrate its placement among other taxa. Photographs showing both dorsal and ventral views of the holotype (and neotypes designated in this work) are provided, and in most cases, images of genitalia from either the holotype or a paratype are included. Diagnostic DNA characters from the nuclear genome and the COI barcode (when present) are given using standard abbreviations. The COI barcode sequence itself is included for each new species. Descriptions are supplemented with additional nomenclatural acts, such as the designation of neotypes and lectotypes, as well as taxonomic revisions that support the recognition of these new species. Phylogenetic trees are presented in Fig. 1–19, specimen photographs in Fig. 20–719 (dorsal and ventral sides are denoted by even and odd figure numbers, respectively, except 667, which is dorsal), and genitalia images in Fig. 720–1471.

Figure 1.

Phylogenetic trees of selected Entheini and Phocidini inferred from protein-coding regions in a) the Z chromosome, based on 357,957 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Figure 19.

Phylogenetic trees of selected Calpodes inferred from protein-coding regions in a) the Z chromosome, based on 283,944 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

In this study, we have avoided using patronyms, partly due to their potential difficulty in being remembered or linked to the species they denote. The new names introduced here are instead based on names of closely related species (often extended in form to indicate southern counterparts), distinguishing phenotypic features, or the locality. Our aim is that these names will align naturally with the current taxonomic framework and be easier to learn and apply.

Subfamily Coeliadinae Evans, 1937

Hasora danda Evans, 1949, Hasora china Evans, 1949, and Hasora taiwana Hsu, Tsukiyama and Chiba, 2005 are species distinct from Hasora anura Nicéville, 1889

Genomic comparison reveals that taxa currently treated as subspecies of Hasora anura Nicéville, 1889 (type locality in India: Sikkim) (Chiba 2009), such as Hasora anura danda Evans, 1949 (type locality Myanmar: Kalaw) and Hasora anura china Evans, 1949 (type locality China: Sichuan Province, Kangding), are genetically differentiated from each other at the species level (Fig. 1); e.g., COI barcodes of H. anura anura differ by 3.8% (25 bp) from H. anura danda and by 1.7% (11 bp) from H. anura china, with the latter two differing from each other by 4.2% (28 bp). These genetic differences are accompanied by phenotypic differences (Evans 1949), including those in male genitalia (Hsu et al. 2005). Although we have not sequenced Hasora anura taiwana Hsu, Tsukiyama and Chiba, 2005 (type locality in Taiwan), the differences in its male genitalia from other subspecies of H. anura as reported and illustrated in its original description (Hsu et al. 2005) are similar in magnitude to those among these subspecies. Therefore, we propose that the following are species-level taxa: Hasora danda Evans, 1949, reinstated status, Hasora china Evans, 1949, new status, and Hasora taiwana Hsu, Tsukiyama and Chiba, 2005, new status.

Hasora vietnama Grishin, new species

https://zoobank.org/D9C9E711-F80B-4897-B3CD-0CB1E667064E

(Fig. 1 part, 20–21, 720–722)

Definition and diagnosis.

Genomic analysis reveals that a specimen from southern Vietnam identified as Hasora anura Nicéville, 1889 (type locality in India: Sikkim) is genetically differentiated from it and other relatives at the species level (Fig. 1); e.g., their COI barcodes differ by 4.4% (29 bp) (from H. anura) and by 4.9% (32 bp) (from H. china Evans, 1949, new status (type locality China: Sichuan Province, Kangding), and is closer in mitochondrial DNA to Hasora danda Evans, 1949, reinstated status, (type locality Myanmar: Kalaw), differing from it by 3.5% (23 bp) in the COI barcode. Therefore, it represents a new species, which keys to Hasora anura anura (A.3.5(b)) in Evans (1949), but is not within the range of this taxon and differs from it and other relatives by the following combination of characters in females: the ventral side of wings is with a purple sheen, the discal band on the ventral hindwing is with an outer whitish patch near the tornus but without such a patch near the apex, the band is prominently indented basad at the discal cell, which has a larger white spot with a slight yellow tint, forewing semihyaline spots are larger, three subapical spots are in line, equal in length and increasing in width from the costal margin, the spot in the cell CuA₁-CuA₂ is better aligned with the discal cell spot, and the ventral forewing is broadly yellow at the tornus and the inner margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6370.13.4:A414G, aly451.6.15:C90A, aly709.4.19:G357T, aly490.12.15:G114A, aly490.12.15:C135T, aly770.6.4:T78T (not C), aly274.26.3:C136C (not A), aly461.5.5:A264A (not T); and COI barcode: A28G, T193C, C271T, A322G, 557C, T613T.

Barcode sequence of the holotype.

Sample NVG-23033F04, GenBank PV972360, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGGGCAGGTATAGTTGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGCTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTACCTTTAATGTTAGGTGCTCCAGATATAGCTTTCCCACGATTAAATAATATAAGTTTTTGATTATTACCTCCCTCTTTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGGGCAGGGACAGGATGAACAGTATACCCCCCTCTTTCAGCTAATATTGCCCACCAAGGATCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCCTTATTACTTCTTCTTTCTTTACCAGTACTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATCTTAACACTTCTTTTTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATCTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 20–21 (genitalia Fig. 720–722), bears the following six printed rectangular labels, five white: [ VIETNAM: Dac Nong Province | Highland area, ca. 1700m | iii. - v. 2008 | Ex M. Wakabayashi ], [ MGCL Accession | #2023–23 | I. Nakamura coll. ], [ DNA sample ID: | NVG-23033F04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24129D01 | c/o Nick V. Grishin ], [ genitalia | NVG250720–32 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Hasora vietnama | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Vietnam: Đắk Nông Province, Highland area, elevation ca. 1700 m.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southern Vietnam.

Subfamily Eudaminae Mabille, 1877 Tribe Entheini Grishin, 2019

Drephalys (Paradrephalys) oriana Grishin, new species

https://zoobank.org/DA6D9952-E8BE-4C0E-BEAE-BC3318AA3F21

(Fig. 1 part, 22–23, 723–724)

Definition and diagnosis.

Several specimens from Central America form a clade sister to Drephalys oria Evans, 1952 (type locality in Honduras) and are genetically differentiated from it at the species level (Fig. 1); e.g., their COI barcodes differ by 0.9% (6 bp). Because no available name applies to this species, it is new. This new species keys (incompletely, see below) to Drephalys oriander (Hewitson, 1867) (type locality in Brazil: Amazonas) (B.6.5) in Evans (1952). It differs from its relatives by a larger basal yellow area on the ventral hindwing (this area is more restricted in some other species), the lack of strong pale-violaceous sheen on the ventral hindwing, which also lacks the tornal spot contrasting with the ground color (both mentioned as present in D. oriander by Evans in B.6.5), smaller forewing spots (spots in the discal cell and cell CuA₁-CuA₂ are separated from each other, and do not overlap as in D. oria), and more contrasting with the brown ground color yellow markings on the ventral hindwing. This species is not cryptic and is recognizable by its phenotype. In DNA, the following base pairs are diagnostic in the nuclear genome: aly216.6.1:A25G, aly3446.8.25:C91T, aly3446.8.25:A92T, aly529.13.1:T156A, aly318.9.2:A486T; and COI barcode: T25T, T172C, A271C, T304C, T385C.

Barcode sequence of the holotype.

Sample NVG-17096C06, GenBank PV972361, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTCTTTTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCATTAACTTTATTAATTTCTAGAAGAATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCACATCAAGGTTCTTCTGTAGACTTAGCTATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGTATTACAGCTTTACTTTTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAACTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 22–23 (genitalia Fig. 723–724), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Colon(Sta. Rita) | Panama 1500’ | 5 Jan. ‘69 | S.S.Nicolay ], [ Drephalys | oriander | Hew. | DET. BY S.S. NICOLAY ], [ genitalia NO. | X-34 37 | J.M.Burns 1992 ], [ DNA sample ID: | NVG-17096C06 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894942 ], and one red [ HOLOTYPE ♂ | Drephalys (Paradrephalys) | oriana Grishin ]. Paratypes: 1♂ and 1♀: 1♀ NVG-15041A10 Mexico, Chiapas, Chajul, Río Lacantún, 20-Jul-1980 [MGCL] and 1♂ NVG-17096B07, USNMENT 00894916 Panama, Colón, Piña, May-1971, G. B. Small leg. [USNM].

Type locality.

Panama: Colón Province, Santa Rita Arriba, elevation 1500’.

Etymology.

The name is formed similarly to the names of its relatives, short to long according to their localities from north to south: oria, oriana, oriander. The name is treated as a noun in apposition.

Distribution.

Southern Mexico to Panama.

Drephalys (Paradrephalys) aurantior Grishin, new species

https://zoobank.org/FBB7811F-54E3-4F42-AF97-22E7940D3616

(Fig. 1 part, 24–25, 725–726)

Definition and diagnosis.

Genomic analysis reveals that a specimen from Panama of unusually bright appearance (NVG-17096C09) is sister to Drephalys oriander (Hewitson, 1867) (type locality in Brazil: Amazonas), but is genetically differentiated from it at the species level (Fig. 1); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore represents a new species. This new species keys (incompletely, see below) to Drephalys talboti (Le Cerf, 1922) (type locality in French Guiana) (B.6.6) in Evans (1952), but is not closely related to this species (see Fig. 1). The new species differs from the phenotypically similar D. talboti and other relatives by the lack of an orange area at the base of the ventral hindwing (more than a third of the ventral hindwing from the base is yellow-orange in D. talboti); a band of postdiscal brown spots inside the orange overscaling covering most of the dorsal hindwing (in D. talboti, this band is only apparent in cells M₁-M₂ and M₂-M₃, but is heavily overscaled with orange in posterior cells); more extensive orange overscaling on the dorsal forewing; and orange overscaling on the dorsal hindwing, although more extensive than in many species, more restricted than in D. talboti, but with a more prominent and complete row (including cells M₁-M₂ and M₂-M₃) of submarginal orange spots. Furthermore, in the holotype (and the only known specimen) the two yellow semihyaline spots in the forewing discal cell are nearly connected with each other along the radial vein. This species is not cryptic and is recognizable by its phenotype. In DNA, the following base pairs are diagnostic in the nuclear genome: aly527.6.7:G120A, aly203.7.3:T43C, aly203.7.3:A63T, aly3269.5.6:C58T, aly536.147.7:T930C, aly294.12.3:C9C (not T); and COI barcode: T25C, T124C, T367T, T379C, A493C, T653C.

Barcode sequence of the holotype.

Sample NVG-17096C09, GenBank PV972362, 658 base pairs:

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTTGGTACATCTTTAAGTCTTTTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGATTATTACCACCTTCATTAACTTTATTAATTTCTAGAAGAATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCACATCAAGGTTCTTCCGTAGACTTAGCTATTTTTTCCCTTCATCTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAGATACCTTTATTTGTATGAGCTGTAGGTATTACAGCTTTACTTTTATTACTTTCCTTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATCTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 24–25 (genitalia Fig. 725–726), bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [ GatunCZ | Pan ], [ Oct. | 18:08 ], [ THHallinan | coll ], [ T. Hallinan | | No. 16334 ], [ genitalia NO. | X-34 39 | J.M.Burns 1992 ], [ DNA sample ID: | NVG-17096C09 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894890 ], and one red [ HOLOTYPE ♂ | Drephalys (Paradrephalys) | aurantior Grishin ].

Type locality.

Panama: Colón Province, Gatún.

Etymology.

In Latin, aurantior means more orange, given for more orange coloration of this species compared to closest relatives. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Drephalys (Paradrephalys) formosus (C. Felder and R. Felder, 1867) is a species distinct from Drephalys (Paradrephalys) dumeril (Latreille, [1824])

Sequencing the only known syntype of Drephalys dumeril (Latreille, [1824]) (type locality not specified, sequenced as NVG-18078E09) (Viette 1956), reveals that it is in a different clade from Eudamus formosus C. Felder and R. Felder, 1867 (type locality not specified), currently treated as its junior subjective synonym (Fig. 1). Instead, the D. dumeril syntype is placed in the same clade with the specimens of Drephalys tortus Austin, 1995 (type locality in Brazil: Rondônia). This realignment agrees with the phenotypic assessment: the syntype of D. dumeril shares a larger comma-shaped white spot on the ventral hindwing and larger forewing spots with D. tortus and Drephalys croceus Austin, 1995 (type locality in Brazil: Rondônia), in contrast to typically smaller spots in E. formosus and the new species described next. Therefore, we propose that Drephalys formosus (C. Felder and R. Felder, 1867), reinstated status, is a species-level taxon. The three taxa (D. dumeril, D. tortus, and D. croceus) are very closely related and further research will address the question about their possible conspecificity. We note that there are two specimens in BMNH with the type labels identified as E. formosus, which was described from the holotype (by monotypy) (Felder and Felder 1867). One of these specimens is from the Hewitson collection (BMNH(E) #808442), the other one is from the Felders’ collection (BMNH(E) #808440, with a characteristic rectangular label, on which the text “formosus. n.” is framed with black and golden stripes). This Felders’ specimen (and not Hewitson’s) is the holotype. Indeed, the holotype’s wing pattern is more similar to its published illustration (pl. 71, Fig. 6 in Felder and Felder 1867), e.g., both have two subapical hyaline spots on the forewing (not three as Hewitson’s specimen) and smaller forewing hyaline spot in the cell CuA₁-CuA₂. Images of both specimens (the holotype, and Hewitson’s specimen incorrectly labeled as “Type”) photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024).

Figure 6.

Phylogenetic trees of selected Eudaminae: Eudamini: Telemiadina, Oileidini, Tagiadinae, and Pyrrhopyginae inferred from protein-coding regions in a) the Z chromosome, based on 295,716 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Drephalys (Paradrephalys) pulcher Grishin, new species

https://zoobank.org/6A24ADEB-2C43-4CDE-ABDF-D4726D6C42FB

(Fig. 1 part, 26–27, 727–728)

Definition and diagnosis.

Genomic analysis reveals that several specimens from Central America form a clade sister to Drephalys formosus (C. Felder and R. Felder, 1867), reinstated status, (type locality not specified, might be in “Bahia ?” [Brazil] as on the label of the holotype) that is genetically differentiated from it at the species level (Fig. 1); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore represent a new species. This new species is similar to D. formosus and keys to Drephalys dumeril (Latreille, [1824]) (B.6.4) in Evans (1952), who regarded the former as a synonym of the latter. Most specimens of the new species differ from D. formosus by a smaller submarginal yellow spot in the dorsal hindwing cell M₃-CuA₁. Males of the new species (and D. formosus) differ from D. dumeril by less extensive orange overscaling at wing bases above; females by typically smaller dorsal hindwing orange spots, even smaller than in D. formosus; and both sexes (as also D. formosus) usually have a smaller comma-shaped central white spot than D. dumeril. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.209.4:T39C, aly2379.24.1:A141G, aly2379.24.1:T147C, aly2532.10.3:T294C, aly14145.2.1:T39C; and COI barcode: T82C, T274C, A307T, A508G, T514A, T646T.

Barcode sequence of the holotype.

Sample NVG-17096C02, GenBank PV972363, 658 base pairs:

AACATTATACTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTCTTTTAATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCATTCCCACGTATAAATAATATAAGTTTTTGATTACTACCTCCCTCATTAACTCTACTAATTTCTAGAAGAATTGTTGAAAACGGAGCTGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCACATCAAGGTTCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTCGATCAAATACCTTTATTTGTGTGAGCAGTAGGTATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTTCGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 26–27 (genitalia Fig. 727–728), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMÁ: CANAL ZONE; | Barro Colorado Isl. | 19 JUNE 1978. | Silberglied/Aiello. | at light. ], [ DNA sample ID: | NVG-17096C02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22037A12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–02 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894931 ], and one red [ HOLOTYPE ♂ | Drephalys (Paradrephalys) | pulcher Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Panama: 1♀ NVG-17096C03, USNMENT00894943 Canal Zone, Gatún, 25-Apr-1971, G. B. Small leg. [USNM] and 1♂ NVG-15025B09 Colón, Piña, 200 m, 14-Feb-1973, H. L. King leg. [MGCL].

Type locality.

Panama: Panamá Oeste Province, Barro Colorado Island.

Etymology.

Like formosus, http://zoobank.org which is the name of its sister species, pulcher is Latin for beautiful. The name is an adjective.

Distribution.

Currently known from Panama.

Drephalys (Drephalys) phoelides Grishin, new species

https://zoobank.org/6F7CAF9F-BEEE-4220-860E-C7170EFE271F

(Fig. 1 part, 28–29, 729–730)

Definition and diagnosis.

Genomic analysis reveals that two specimens from Central America form a clade sister to Drephalys phoenice (Hewitson, 1867) (type locality in Brazil: Amazonas) that is genetically differentiated at the species level (Fig. 1); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore they represent a new species. This new species is generally similar to D. phoenice and keys to it (B.6.3) in Evans (1952), albeit incompletely. It has a costal fold in males, but the discal hindwing white band is more like that in Drephalys phoenicoides (Mabille and Boullet, 1919) (type locality given as Brazil, but a possible holotype is labeled from French Guiana), and is narrower, especially towards the costal margin, ends at vein Sc+R₁, and is separated from the costal margin by a yellow costal cell. The new species differs from its sister, D. phoenice, by larger forewing spots, a narrower hindwing white band, and a less developed violaceous sheen on the ventral side of wings, in particular, distad of the hindwing white band; and differs from D. phoenicoides by more pronounced violaceous sheen on the ventral side of wings, a straighter outer margin of the discal white band on the ventral hindwing, and overlapping pale spots in the forewing discal cell and the cell CuA₁-CuA₂ (these spots are typically fully separated in both D. phoenice and D. phoenicoides). It differs from other similar species by the absence of the central pale spot and the pale area by the inner margin of the ventral forewing, which is only slightly paler than the ground color in cell 1A+2A. This species is not cryptic and is recognizable by its phenotype. The following base pairs are diagnostic in the nuclear genome: aly1146.18.3:A51C, aly1146.18.3:A74C, aly1146.18.3:A115T, aly3507.2.11:A173C, aly204.1.13:A72T; and COI barcode: T58C, T82G, T169C, T376A, A625G.

Barcode sequence of the holotype.

Sample NVG-17096B10, GenBank PV972364, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTCTCTTAATTCGAACTGAATTAGGAACGCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATGCTAGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTACTTCCCCCTTCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGTACCGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATCAAGGTTCATCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTCGTGTGAGCTGTAGGTATTACAGCACTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACCATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGACCCGGCAGGGGGAGGTGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 28–29 (genitalia Fig. 729–730), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMÁ: Panamá Prov. | Distrito de El Llano | Cordillera de San Blas | North of El Llano ca.330 m. | 13. V. 78 | Gordon B. Small: Coll. ], [ DNA sample ID: | NVG-17096B10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22037B01 | c/o Nick V. Grishin ], [ genitalia | NVG241118–03 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894998 ], and one red [ HOLOTYPE ♂ | Drephalys (Drephalys) | phoelides Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-17096B11 Costa Rica, Heredia, Puerto Viejo in Sarapiquí, Finca la Selva, 85 m, 10-Feb-1986, A. M. Chacón and N. M. Chavarría leg. [USNM].

Type locality.

Panama: Panamá Province, San Blas Mountains, north of El Llano, elevation ~330 m.

Etymology.

The name is a fusion of names of this species’ close relatives: phoe[nice + herac]lides, and is a noun in apposition.

Distribution.

Costa Rica and Panama.

Drephalys (Drephalys) panamys Grishin, new species

https://zoobank.org/01CF1A36-37E7-4573-A351-7AA30C6AFD3B

(Fig. 1 part, 30–31, 731–732)

Definition and diagnosis.

Genomic analysis reveals that a specimen from Panama (NVG-20054D06) is sister to Drephalys diovalis Grishin, 2023 (type locality in Ecuador), but has a distinct pattern on the ventral hindwing and is genetically differentiated at the species level (Fig. 1); e.g., their COI barcodes differ by 3.3% (22 bp), and therefore it represents a new species. This new species keys (incompletely) to Drephalys phoenicoides (Mabille and Boullet, 1919) (B.6.2) in Evans (1952), but differs from it and other relatives by a darker appearance: the central orange-yellow band of the dorsal hindwing is reduced to a spot at the end of the discal cell and a small diffuse spot just below it, smaller orange-yellow subtornal spots on the dorsal hindwing disappearing towards the apex, darker wing bases beneath with more restricted yellow overscaling, a narrower ventral hindwing discal white band, and a less developed paler area and central spot near the inner margin of the ventral forewing. This species is not cryptic and is recognizable by its phenotype. The following base pairs are diagnostic in the nuclear genome: aly876.30.2:T84C, aly876.30.2:T126C, aly4506.10.23:G807A, aly890.57.5:T771C, aly1651.36.1:A1023G, aly1139.83.1:T279T (not C), aly1139.83.1:T291T (not C), aly103.52.3:G333G (not A), aly331.3.3:G21G (not A), aly2548.21.9:A1761A (not G); and COI barcode: T19C, T142C, T206C, A229G, T274A, T286C, A526T.

Barcode sequence of the holotype.

Sample NVG-20054D06, GenBank PV972365, 658 base pairs:

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTCTTCTAATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTAATATTAGGAGCTCCTGATATGGCTTTTCCACGAATAAATAATATAAGTTTTTGATTACTCCCCCCATCATTAACTCTCTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCACCAAGGTTCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAACTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACTGCTTTATTACTTTTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATCTATTT

Type material.

Holotype: ♂ deposited in the Mississippi Entomological Museum, Starkville, MS, USA (MEM), illustrated in Fig. 30–31 (genitalia Fig. 731–732), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Panama: Colon | Santa Rita Arriba | ca. 245m | N 09° 19’ 35.7” | W 079° 46’ 53.9” | Feb. 22, 2014 | J. R. MacDonald ], [ Drephalys sp. | nr. phoeniciodes ], [ DNA sample ID: | NVG-20054D06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24016B08 | c/o Nick V. Grishin ], [ genitalia | NVG241220–01 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Drephalys (Drephalys) | panamys Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Colón Province, Santa Rita Arriba, elevation ~245 m, GPS 9.32658, −79.78164.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Phanus centralis Grishin, new species

https://zoobank.org/B3A56818-D1BB-485F-8BFA-6CB067D45BA0

(Fig. 1 part, 32–33, 733–734)

Definition and diagnosis.

A specimen from El Salvador is sister to but strongly differentiated genetically from Phanus australis L. Miller, 1965 (type locality in Brazil: Santa Catarina, holotype sequenced as NVG-15096D05) (Fig. 1); e.g., their COI barcodes differ by 1.4% (9 bp), and therefore it represents a new species. This new species keys to Phanus vitreus (Stoll, 1781) (type locality in Suriname) (B.4.1) in Evans (1952), together with P. australis. This species identifies with the vitreus group as circumscribed by Austin (1993), but it does not fully match the characters of any of the species in Austin’s Table 1, with the closest being Phanus confusis Austin, 1993 (type locality in Mexico: Veracruz). The new species differs from these and other species of Phanus Hübner, [1819] (type species Papilio vitreus) by the following combination of characters: the hyaline area in the hindwing discal cell is conjoined with the hyaline area between the veins M₁ and M₃ (only separated by a partly dark vein); two spots in the forewing cell CuA₂-1A+2A are touching each other, similar to P. australis, not well separated as in P. vitreus; forewing subapical spots are longer than in P. vitreus compared to submarginal spots in cells M₁-M₂ and M₂-M₃, but shorter than in P. australis; and a hyaline arrowhead area in the forewing cell CuA₁-CuA₂ is notched (not divided by more than its half), its upper arm is less than half as long as the lower arm, more like in P. vitreus than in P. australis. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1341.12.30:T33C, aly21.14.11:G238A, aly21.14.11:G324A, aly113.7.1:G135A, aly23605.15.11:C333T; and COI barcode: T50C, C133A, T157C, C406C, T539T, T571C.

Barcode sequence of the holotype.

Sample NVG-17067D10, GenBank PV972366, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACATCTCTAAGTTTATTAATTCGAACAGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACTGCACATGCATTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCCGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCCGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATCAAGGTTCATCTGTCGATTTAGCAATTTTTTCTTTACACTTAGCTGGAATTTCATCTATTTTAGGTGCAATTAATTTTATTACCACAATTATTAATATACGTATTAGAAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACTGCTTTATTATTATTACTTTCTCTTCCTGTTTTAGCAGGAGCTATCACAATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCCATTCTTTATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Colorado State University Collection, Fort Collins, CO, USA (CSUC), illustrated in Fig. 32–33 (genitalia Fig. 733–734), bears the following seven rectangular labels (2^nd handwritten, others printed), six white: [ San Salvador | El Salvador, C A | 19 Jan 1971 | leg M Serrano | Phanus vitreus ], [ Phanus | vitreus ], [ DNA sample ID: | NVG-17067D10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24016C03 | c/o Nick V. Grishin ], [ genitalia | NVG241220–02 | c/o Nick V. Grishin ], [ CSU_ENT | 1039507 ], and one red [ HOLOTYPE ♀ | Phanus centralis | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

El Salvador: San Salvador.

Etymology.

The name indicates a Central American origin of this species that is sister to the southernmost Phanus species, P. australis. The name is an adjective.

Distribution.

Currently known only from the holotype collected in El Salvador.

Phanus vitreides Grishin, new species

https://zoobank.org/D35E2FE0-38FF-4491-B879-BBD74B7507DD

(Fig. 1 part, 34–35, 735–737)

Definition and diagnosis.

Specimens from Ecuador and Peru form a clade sister to but strongly differentiated genetically from Phanus vitreus (Stoll, 1781) (type locality in Suriname, neotype sequenced as NVG-15096D06) (Fig. 1); e.g., their COI barcodes differ by 2.3% (15 bp), and therefore they represent a new species. This new species keys to Phanus vitreus (Stoll, 1781) (type locality in Suriname) (B.4.1) in Evans (1952), but differs from it and other species of Phanus by the following combination of characters: the hyaline area in the hindwing discal cell is conjoined with the hyaline area between veins M₁ and M₃ (only separated by a hairlike dark vein); two spots in the forewing cell CuA₂-1A+2A are separated from each other; the hyaline ray by the costal side of the forewing discal cell is fully separated from the hyaline area in the rest of the cell, which is not separated into two segments as in a typical P. vitreus; and the arrowhead hyaline area in the forewing cell CuA₁-CuA₂ is notched deeper than in P. vitreus, but less than its half. This species is sympatric and synchronic with P. vitreus: we sequenced two P. vitreus specimens collected two days before and ten days after the paratype of the new species (NVG-17101A02 and A03, respectively) at the same locality. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly145.17.3:A1047T, aly806.31.1:T39C, aly595.14.3:C44T, aly318.14.6:T660A, aly3616.15.4:T360A; and COI barcode: C85T, C130T, T212C, T364T, T412C, T526C.

Barcode sequence of the holotype.

Sample NVG-24074D05, GenBank PV972367, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACTGCTCATGCATTCATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGTGCTCCCGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTCCTTCCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCATCTAATATTGCTCATCAAGGTTCATCTGTCGATTTAGCAATTTTTTCTTTACACTTAGCCGGAATTTCATCTATTTTAGGTGCAATCAATTTTATTACTACAATTATTAATATACGTATTAGAAATTTATCTTTTGATCAAATACCTTTATTCATTTGAGCTGTTGGAATTACCGCTTTATTATTATTACTTTCTCTTCCTGTTTTAGCGGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCCATTCTTTATCAACATCTATTT

Type material.

Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 34–35, bears the following five printed rectangular labels, four white: [ Yasuni Research Station | Rios Tivacuno & Tiputini | Napo Province, Ecuador | 76°36’W 0°38’S; 250m | October 20, 1998 ], [ Phanus Hübner | vitreus (Stoll) ], [ D.L. Lindsley colln. | MGCL Accession | # 2008–20 ], [ DNA sample ID: | NVG-24074D05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Phanus vitreides | Grishin ]. Paratype: 1♂ NVG-17101A01 (leg, DNA sequenced), NVG-23119F11 (abdomen, DNA stored), USNMENT 00913554 Peru, Loreto Region, Sucusari River, ExplorNapo Lodge, elevation 140 m, approx. GPS −3.233, −72.917, 10-Sep-1995, R. Robbins leg., genitalia vial NVG241118–04 (Fig. 735–737) [USNM].

Type locality.

Ecuador: Orellana Province, Yasuní Research Station, Ríos Tivacuno and Tiputini, elevation 250 m.

Etymology.

The name is formed from the name of its sister species, P. vitreus, and is an adjective.

Distribution.

Currently known only from eastern Ecuador and northeastern Peru.

Phanus prestoni L. Miller, 1965 is a species distinct from Phanus obscurior Kaye, 1925

Genomic analysis of Phanus obscurior obscurior Kaye, 1925 (type locality in Trinidad) and Phanus obscurior prestoni L. Miller, 1965 (type locality in Brazil: Amazonas), including their primary type specimens (NVG-15038C09 and NVG-15095D11, respectively) reveals that they are genetically differentiated at the species level (Fig. 1); e.g., COI barcodes of their primary type specimens differ by 4.9% (32 bp). Therefore, we propose that Phanus prestoni L. Miller, 1965, new status, is a species distinct from Phanus obscurior Kaye, 1925, which becomes monotypic.

Hyalothyrus inferna Grishin, new species

https://zoobank.org/21F40EC8-AC52-4F07-B090-860075BB3969

(Fig. 1 part, 36–39, 738–740)

Definition and diagnosis.

Z chromosome phylogeny places three specimens from Rondônia, Brazil as a sister clade to both Hyalothyrus infernalis (Möschler, 1876) (type locality in French Guiana and Surinam, two syntypes sequenced as NVG-15032C08 and NVG-15032C09) and Hyalothyrus infa Evans, 1952 (type locality in Colombia). This clade is genetically differentiated from others at the species level (Fig. 1); e.g., COI barcodes of these specimens differ by 5.1% (34 bp) from both H. infernalis and H. infa, and therefore they represent a new species. This species is very similar to H. infernalis and (incompletely) keys to it (B.8.1a) in Evans (1952), but differs from it by the lack of (or vestigial) tornal dark area on the ventral hindwing and sometimes a vestigial lower white spot in the cell CuA₂-1A+2A on the ventral forewing. This spot is well-developed on the dorsal side, distinguishing this species from H. infa, as well as the three dark spots on the ventral hindwing more separated from the apical dark area (those spots nearly merged into the dark apex in H. infa). If the three spots are merged into the apical dark area, the tornal area is darker as well. Due to partly cryptic nature of this species and underexplored phenotypic variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1294.11.5:C169T, aly1294.11.5:G172C, aly1294.4.12:T92C, aly824.10.3:A227G, aly451.28.6:C92T; and COI barcode: T10C, T202C, A319C, T352C, T613C, A637C.

Barcode sequence of the holotype.

Sample NVG-17101C07, GenBank PV972368, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTCACTGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGTTTTTGATTGCTACCCCCCTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCCGGAACTGGATGAACAGTTTACCCCCCTTTATCCTCTAATATTGCCCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCATTTGATCAATTACCATTATTTGTTTGAGCAGTAGGAATTACTGCTTTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACCATACTTTTAACAGATCGAAATTTAAATACTTCATTCTTCGATCCTGCAGGGGGAGGTGATCCCATTCTTTACCAACATTTATTC

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 36–37, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ BRAZIL: Rondônia | 8 km N Cacaulândia | 10° 30’S, 62° 52’W | 10 Nov 1989 190m | leg DH Ahrenholz | SS Nicolay curator ], [ DNA sample ID: | NVG-17101C07 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913586 ], and one red [ HOLOTYPE ♂ | Hyalothyrus | inferna Grishin ]. Paratypes: 3♂♂ and 1♀ from Brazil: Rondônia: 1♂ NVG-19064C08 65 km south of Ariquemes, linea C-20, 10 km E B-65, 3 km E Fazenda Rancho Grande, lot 18, 15-Jun-1993, G. T. Austin leg. [UCDC] (Fig. 38–39) and 1♂ NVG-23067E02 (leg, sequenced), NVG-23067E11 (abdomen, DNA stored) Fazenda Rancho Grande, 20-Mar-1989, C. J. Durden leg., genitalia NVG241118–05 (Fig. 738–740) [TMMC] and Amazonas [no other data], coll. Fassl [ZSMC]: 1♂ NVG-23089E08 and 1♀ NVG-23089E07.

Type locality.

Brazil: Rondônia, 8 km north of Cacaulândia, elevation 190 m, approx. GPS −10.500, −62.867.

Etymology.

The name is formed from the names of its relatives H. infa and H. infernalis, and is treated as a noun in apposition.

Distribution.

Currently known from Rondônia and Amazonas, Brazil.

Comment.

GPS coordinates given on the label of the holotype point to a locality approximately 17.5 km south of Cacaulândia, thus being inconsistent with the locality stated in words.

Tarsoctenus stenopapias Grishin, new species

https://zoobank.org/660F073F-7B76-4ABF-AAD1-9749C741D93B

(Fig. 1 part, 40–41, 741–743)

Definition and diagnosis.

Genomic analysis of Tarsoctenus papias (Hewitson, 1857) (type locality in Brazil: Amazonas) specimens reveals that one of them is genetically differentiated from the rest at the species level (Fig. 1); e.g., their COI barcodes differ by 3.6% (24 bp), and therefore represents a new species. This new species keys to T. papias (B.3.1) in Evans (1952), but differs from it by males with a narrower and more extended discal blue spot in the cell CuA₂-1A+2A on the dorsal forewing below the hyaline spot; narrower than in most specimens blue hindwing bands on both sides; and a full row of blue submarginal forewing spots from the costal to inner margin, framing all hyaline subapical spots. Due to unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1603.31.4:A267G, aly1603.31.4:A279G, aly525.18.1:A1327C, aly736.5.1:A222G, aly2204.22.5:T298C, aly770.36.1:A732A (not G), aly770.36.1:T741T (not C), aly5612.3.1:A1133A (not G), aly1350.9.1:A584A (not T), aly1350.9.1:A588A (not G); and COI barcode: A43A, T49C, T139T, T223C, T424C, A559G.

Barcode sequence of the holotype.

Sample NVG-24073A12, GenBank PV972369, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCCTTAAGATTACTAATTCGAACTGAATTAGGTACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATCTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCCGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCCTCATTAACACTATTAATTTCAAGAAGAATTGTTGAAAATGGGGCAGGAACAGGATGAACAGTCTACCCCCCCCTTTCATCCAATATCGCCCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGTATTTCATCCATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAACTTATCATTTGATCAAATACCTTTATTTATTTGAGCAGTGGGAATTACAGCACTATTATTATTACTTTCCTTACCTGTGTTGGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTTCGACCCTGCTGGGGGAGGGGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 40–41 (genitalia Fig. 741–743), bears the following seven printed (text in italics handwritten) labels (3^rd triangular others rectangular), six white: [ PERU:MADRE de DIOS | Cerro Pantiacolla, | E slope nr summit, | ca. 4 km. ENE Shin- | tuya; 980 m. | 5-VIII.1980 | J. F. Douglass ], [ Allyn Museum | Acc. 19 89–19 ], [ > left antenna and a leg are glued to this label, no text, [ DNA sample ID: | NVG-24073A12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24112H11 | c/o Nick V. Grishin ], [ genitalia | NVG250720–20 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Tarsoctenus | stenopapias Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Madre de Dios, ca. 4 km east-northeast of Shintuya, eastern slope of Cerro Pantiacolla near summit, elevation 980 m.

Etymology.

The prefix steno- comes from the Greek word στενός (stenós), meaning narrow or tight and is added to the name of the relative, T. papias, to indicate the narrow spot as the diagnostic character of a new species and to make the name longer for this more southern species. The name is treated as a masculine noun in apposition.

Distribution.

Currently known only from the holotype collected on the eastern slopes of the Andes in southern Peru.

Comment.

This new species is sympatric with T. papias at least around Pantiacolla Lodge.

Tribe Phocidini Tutt, 1906

Phocides tema Grishin, new species

https://zoobank.org/C49BBFBB-CC5F-47CB-9BB3-2360C1951A38

(Fig. 1 part, 42–43)

Definition and diagnosis.

A single specimen from Guatemala identified as Phocides urania (Westwood, 1852) (type locality in Mexico: Oaxaca) is differentiated genetically from it at the species level (Fig. 1); e.g., their COI barcodes differ by 2.9% (19 bp), and therefore represents a new species. This new species keys to P. urania urania (B.1.13(a)) in Evans (1952), but is sister to Phocides vida (Butler, 1872) (type locality Costa Rica: Cartago) and differs from these species by the presence of (absent in P. vida) hyaline spots on the forewing, but these spots are narrower than in P urania. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly310.3.5:C168T, aly310.3.5:G171A, aly17732.4.1:T65A, aly1405.20.13:C1044T, aly536.122.3:T84C, aly37338.32.3:A192A (not T), aly84.7.3:A238A (not T), aly2631.3.2:T57T (not G), aly50.32.3:C210C (not T), aly216.12.1:A90A (not C); and COI barcode: T34C, T361C, 553C, T616C, A628A, A631G.

Barcode sequence of the holotype.

Sample NVG-17099B07, GenBank PV972370, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCCGGCATAATTGGAACTTCTCTTAGATTACTAATTCGAACAGAATTAGGAACCCCAAGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTTATACTAGGAGCCCCTGATATAGCATTCCCTCGAATAAATAACATAAGATTTTGATTATTACCCCCATCCTTGACTTTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGTACTGGTTGAACAGTATACCCCCCTTTATCAGCAAATATCGCTCATCAAGGAGCATCTGTTGATTTAGCTATTTTTTCTCTTCATCTAGCTGGTATTTCATCAATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCCATTTTAGCAGGTGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGGGGAGGGGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 42–43, bears the following six printed rectangular labels, five white: [ Volcan | StaMaria | Guat ], [ April ], [ Schaus and | Barnes | coll ], [ DNA sample ID: | NVG-17099B07 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913486 ], and one red [ HOLOTYPE ♀ | Phocides | tema Grishin ].

Type locality.

Guatemala: Volcán Santa María.

Etymology.

The name is derived from the country of the type locality [Gua]tema[la] and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Guatemala.

Bungalotis lotis Grishin, new species

https://zoobank.org/C5A38F1A-EA39-44EB-860A-A27BED7EADA0

(Fig. 1 part, 44–45, 744–745)

Definition and diagnosis.

Genomic analysis of specimens from Central America places them in a clade sister to Bungalotis aureus Austin, 2008 (type locality in Ecuador), but genetically differentiated from it at the species level in the nuclear genome (Fig. 1a) (but their COI barcodes do not differ), and therefore they represent a new species. Together with B. aureus, this new species forms a clade sister to Bungalotis midas (Cramer, 1775) (type locality in Suriname). The new species keys to B. midas (D.1.3) in Evans (1952) and was included by him in that taxon, but differs from it and other relatives by the following combination of characters: more orange rather than brown ventral side of wings, typically smaller spots on the hindwing; relatively longer uncus, more bulbous in dorsal view, and an obtuse angle on the dorsal margin of the harpe (typically acute in B. midas). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly994.8.40:G33A, aly349.33.2:T249G, aly1191.2.2:G787A, aly1409.12.1:A183G, aly9673.2.8:A472G; and COI barcode does not differentiate this species from B. aureus.

Barcode sequence of the holotype.

Sample NVG-23109C01, GenBank PV972371, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGTACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAACTTTATTAATTTCGAGAAGAATTGTTGAAAATGGTACTGGTACTGGTTGAACAGTTTATCCACCCTTATCTACTAATATTGCTCATCAAGGATCTTCTGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTCTATTTATTTGAGCTGTGGGAATTACAGCAATTTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTCTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 44–45 (genitalia Fig. 744–745), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BELIZE:Cayo | San Ignacio | Cristo Ray Rd | 17 June 1990 | Morton S. Adams ], [ “?” | n. species | Det. H.A. Freeman ], [ DNA sample ID: | NVG-23109C01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D03 | c/o Nick V. Grishin ], [ genitalia | NVG250720–47 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Bungalotis | lotis Grishin ]. The first DNA sample ID refers to the extraction from the abdomen (sequenced) prior to genitalia dissection, and the second from a leg (stored). Paratypes: 1♂ and 1♀: the same data as the holotype, except as indicated: 1♂ NVG-23109B12 genitalia vial H-1915 H. A. Freeman (vial not located) and 1♀ NVG-23109C02 “Cristo Ray Rd” not specified on the label, 17–18-May-1990.

Type locality.

Belize: Cayo District, San Ignacio, Cristo Ray Road.

Etymology.

Both Midas and Lotis are figures from Greek mythology. Sister to B. midas, Bungalotis lotis new species takes its name, a noun in apposition, from the ending of its genus name.

Distribution.

Central America.

Dyscophellus porsenica Grishin, new species

https://zoobank.org/DCC51EDB-028D-4859-9622-657193E45768

(Fig. 1 part, 46–47, 746–747)

Definition and diagnosis.

Genomic sequencing of a specimen from southeastern Peru (NVG-17104C04) reveals that it is sister to Dyscophellus basialbus Grishin, 2022 (type locality in Brazil: Rondônia) and is in the same clade with Dyscophellus porsena E. Bell, 1934 (type locality Peru: Loreto, Iquitos, holotype sequenced as NVG-15104B04), being genetically differentiated from both at the species level (Fig. 1); e.g., their COI barcodes differ by 4.1% (27 bp) from D. basialbus and by 4.7% (31 bp) from D. porsena. Therefore, this specimen represents a new species, which keys to “Dyscophellus diaphorus” (misidentification) (D.4.8) in Evans (1952), but differs from it and other relatives by males with a strongly developed brown spot near the middle of the dorsal forewing discal cell (vestigial in D. porsena and some D. basialbus), a weaker developed upper dark spot in the basal doublet in dorsal forewing cell CuA₂-1A+2A, and a weakly patterned ventral side of wings, with more faint spots on the ventral hindwing. In male genitalia, it differs by a longer uncus compared to tegumen, a narrower valva with a straighter costal margin, and rounder, more serrated dorsal expansion of harpe at its discal end, larger compared to the ventral knob. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly490.4.5:G91A, aly490.4.5:G92A, aly1603.15.2:C69T, aly1603.15.2:C72T, aly770.37.4:T744A, aly525.10.1:C86C (not G), aly2284.26.17:A144A (not T), aly2582.32.1:A340A (not G), aly2627.19.1:T133T (not A), aly2627.19.1:G136G (not A); and COI barcode: T19C, A40A, T70A, T142C, A244G, C343T, C487T.

Barcode sequence of the holotype.

Sample NVG-17104C04, GenBank PV972372, 658 base pairs:

AACTCTTTATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGATTATTAATTCGAACAGAATTAGGAATCTCAGGTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATGAATAACATAAGATTTTGATTATTACCCCCATCTTTAACTTTACTAATCTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCTTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTTGGAATTACAGCTTTATTATTATTACTTTCTTTACCTGTATTAGCAGGAGCTATTACAATACTTCTCACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 46–47 (genitalia Fig. 746–747), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ PERU 330m | 30 Km S.W. | Pto. Maldonado | 24 Oct. ‘83 | S. S. Nicolay ], [ Dyscophellus erythras | Det. Mab. ♂ | S.S. Nicolay ], [ DNA sample ID: | NVG-17104C04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032D02 | c/o Nick V. Grishin ], [ genitalia | NVG241118–06 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913853 ], and one red [ HOLOTYPE ♂ | Dyscophellus | porsenica Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Madre de Dios Region, 30 km southwest of Puerto Maldonado, elevation 330 m.

Etymology.

The name is formed from the name of its relative, D. porsena, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southeastern Peru.

Dyscophellus santamarta Grishin, new species

https://zoobank.org/444D92E2-FB8F-42D4-8A36-C859FAEA263B

(Fig. 1 part, 48–51, 748–749)

Definition and diagnosis.

Genomic phylogeny reveals that two specimens, from Colombia and Ecuador, form a clade sister to both Dyscophellus ramusis (Stoll, 1781) (type locality in Suriname) and Dyscophellus australis Grishin, 2022 (type locality in Paraguay), and therefore represent a new species, which is strongly differentiated genetically from others (Fig. 1); e.g., its COI barcodes differ by 6.5% (43 bp) from D. ramusis and by 7.8% (51 bp) from D. australis. This new species keys to D. ramusis ramusis (D.4.9c) in Evans (1952), who likely considered it to be part of this taxon. The new species differs from its relatives by males with contrasting dark spots on the dorsal side of the wings (mostly faint in D. ramusis), similar to D. australis but more sharply defined, ventrally most of these spots have pale centers and on the hindwing are more uniform in size, except a much larger central spot. In male genitalia, it differs by slightly upturned harpe only slightly narrower distally, with a deeper terminal notch dividing the end of the harpe into two nearly equal parts serrated at the margin, a mildly concave costa of the valva and a convex ventral margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly535.10.1:C197G, aly1603.14.1:G457A, aly1229.9.14:C24A, aly1229.9.14:A36G, aly770.31.1:T1191C; and COI barcode: A31T, A214G, T283C, T580G, T580C, T658C.

Barcode sequence of the holotype.

Sample NVG-21107C03, GenBank PV972373, 658 base pairs:

AACTCTTTATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACCTCATTAAGATTATTAATTCGAACTGAATTAGGAACCTCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATTATAATCGGAGGATTTGGAAATTGACTCGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTTCCACGAATAAACAATATAAGATTTTGATTATTACCCCCATCTCTAACCCTTTTAATCTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGATGAACTGTTTATCCCCCCCTATCATCTAATATTGCCCATCAAGGTTCATCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCGGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAGAAATTTATCGTTTGATCAAATACCATTATTTGTGTGATCTGTAGGAATTACAGCCCTATTATTATTACTTTCTTTACCTGTTTTAGCAGGGGCTATTACCATACTCCTCACTGATCGAAATTTAAATACATCATTTTTTGACCCGGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTC

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 48–49 (genitalia Fig. 748–749), bears the following six printed rectangular labels, five white: [ Onaca (2500 ft.)| Dept. Magdalena, | Colombia,S.A. ], [ Oct. ], [ DNA sample ID: | NVG-21107C03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23108A12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Dyscophellus | santamarta Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-17103G08 (leg, DNA sequenced), NVG-22032D05 (abdomen, DNA stored) USNMENT 00913807 Ecuador, Pichincha, Tinalandia, 16 km E Santo Domingo de Los Colorados, 600 m, 5–11-May-1990, R. H. Leuschner leg. [USNM] (Fig. 50–51).

Type locality.

Colombia: Magdalena Department, Onaca, elevation 2500’.

Etymology.

The name is derived from the type locality near Santa Marta and is a noun in apposition.

Distribution.

Colombia and Ecuador.

Euriphellus huellus Grishin, new species

https://zoobank.org/90A4AF11-CEB7-4CC3-B0FD-6F59160F9D46

(Fig. 1 part, 52–53)

Definition and diagnosis.

Genomic analysis of a specimen from eastern Colombia places it as sister to Euriphellus phraxanor (Hewitson, 1876) (type locality in Colombia and Panama), which is genetically differentiated from it at the species level (Fig. 1); e.g., their COI barcodes differ by 2.0% (13 bp), and therefore this specimen represents a new species. This new species keys to “Dyscophellus phraxanor phraxanor” (D.4.2(b)) in Evans (1952), but differs from it and other relatives by males having a complete set of four subapical semihyaline yellow spots in an arc, not two or three spots as in other species) and larger forewing spots. Due to unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1139.53.3:A190T, aly21535.1.1:A153G, aly443.21.2:G618T, aly536.174.1:T1758C, aly4339.6.2:C78A; and COI barcode: T38C, 85C (not T), T212C, T232C, T268T (not C).

Barcode sequence of the holotype.

Sample NVG-24019C08, GenBank PV972374, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCCGGCTCCTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGGTTTGGAAACTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCCTTTCCACGAATAAACAATATAAGATTTTGATTACTTCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGCTCACCAAGGATCTTCAGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTCGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCTCTATTATTACTTCTTTCTTTACCTGTATTAGCAGGTGCAATTACTATACTATTAACAGACCGAAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Senckenberg Natural History Museum, Frankfurt, Germany (SMF), illustrated in Fig. 52–53, bears the following four printed rectangular labels, three white: [ Javarete | Rio Negro Quellgeb. | Okt.-Novb. | Nord-Amazonas ], [ 99. ], [ DNA sample ID: | NVG-24019C08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Euriphellus | huellus Grishin ].

Type locality.

Colombia: Vaupés Department, Yavaraté.

Etymology.

In Spanish, huella means footprint, track, trace, or mark. The name refers to the stepping-stone pattern of spots on the forewing that is complete, and the spots are connected with each other. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in eastern Colombia.

Tribe Eudamini Mabille, 1877 Subtribe Eudamina Mabille, 1877

Cecropterus (Cecropterus) spinipes Grishin, new species

https://zoobank.org/659D92EB-FD4E-40AA-8FDC-D1B68C9C9A1F

(Fig. 2 part, 54–55, 750–752)

Figure 2.

Phylogenetic trees of Cecropterus and Spicauda inferred from protein-coding regions in a) the Z chromosome, based on 472,065 positions (inset shows a segment of a tree from autosome genes based on 5,324,751 positions) and b) the mitochondrial genome. The same notations are used throughout this work in other figures showing phylogenetic trees and are detailed here. Gaps in branches indicate places where vertical slices of the tree were removed to reduce its horizontal dimension (to allow an increase of the font size), i.e., branches with gaps are longer than shown. Ultrafast bootstrap values are shown at nodes. For each specimen, the name adopted in this work is given first, and a previously used name (or misidentification for the new species) is listed in square brackets (if different), supplemented with the DNA sample number, type status (see Materials and Methods for abbreviations), general locality, and year of collection. See Table S1 in the Supplemental file NCBI database entries for additional data about these specimens. Synonyms are given in parentheses preceded by “=” and additionally by “‡” for unavailable names and junior homonyms. The type status refers to this synonym if the synonym name is provided. Clades of new species proposed here are shown in red color, and their species epithets are highlighted in red. Yellow highlighted text indicates taxonomic changes, e.g., transfer to a different genus (genus name highlighted) or change in species, subspecies, or synonym status (species epithet highlighted) and clades with taxonomic changes are shown in various colors.

Definition and diagnosis.

Genomic analysis of a single female from Pelotas, Rio Grande do Sul, Brazil, that we initially identified as Cecropterus (Cecropterus) acanthopoda (O. Mielke, 1977) (type locality in Brazil: Paraná) reveals its genetic differentiation at the species level (Fig. 2); i.e., their COI barcodes differ by 2.9% (19 bp), and therefore represents a new species. This new species is similar to Cecropterus (Cecropterus) acanthopoda and agrees with its description by (Mielke 1977), differing by females with a more prominent subapical pale forewing spot in cell R₂-R₃, the inner edge of the spot in cell R₁-R₂ not aligned with those of the other apical spots (both spots are more visible on the ventral side), straighter posterior margin of the lamella postvaginalis without a central notch, and slightly longer side lobes of the lamella antevaginalis. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3561.8.19:G48C, aly86.9.10:C21T, aly86.9.10:C45T, aly1146.35.6:G21A, aly347.15.3:T69C, aly3001.3.6:G330G (not A), aly923.18.9:C99C (not T), aly1149.5.1:G12G (not A), aly1149.5.1:G15G (not C), aly133.4.10:G36G (not A); and COI barcode: T115T, C205T, T397C, A400C, T556C.

Barcode sequence of the holotype.

Sample NVG-15101A07, GenBank PV972375, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTATACTTGGAGCCCCCGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTACCCCCATCATTAACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGTACAGGATGAACTGTTTATCCCCCTTTATCTTCTAATATTGCTCATCAAGGAGCATCAGTAGATTTAGCAATTTTCTCCTTACATCTTGCAGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGTATTACAGCATTATTATTATTACTATCATTACCTGTCTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 54–55 (genitalia Fig. 750–752), bears the following eight rectangular labels (3^rd, 4^th, and 6^th handwritten, others printed with handwriting in italics), seven white: [ Pelotas I’49 | R.G.S., BRAZIL | C.M.deBiezanko | No. CB 4529 ], [ Pelotas, I. 49 | C. BIEZANKO – leg. ], [ Seh | 273 ], [ Cogia ? | ♀ ], [ genitalia NO. | X-856 | J.M.Burns 1978 ], [ “pickets” on | abdominal tergites ], [ DNA sample ID: | NVG-15101A07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Cecropterus (Cecropterus) | spinipes Grishin ].

Type locality.

Brazil: Rio Grande do Sul, Pelotas.

Etymology.

In Greek, acanthopoda means spiny feet and is the name of the sister species. A similar construct in Latin is taken as this species’ name combining spina (thorn) and pes (foot). The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected in South Brazil.

Cecropterus (Thorybes) septelucis Grishin, new species

https://zoobank.org/8C71B726-AD63-4668-8101-78F37E827AEF

(Fig. 2 part, 56–59, 753–754)

Definition and diagnosis.

Genomic sequencing of specimens we identified as Cecropterus (Thorybes) vectilucis (A. Butler, 1872) (type locality in Costa Rica) from across its range reveals that they partition into two prominent clades genetically differentiated at the species level (Fig. 2); e.g., their COI barcodes differ by 3.0% (20 bp). One clade includes a specimen from Costa Rica that phenotypically agrees with a syntype and thus corresponds to C. vectilucis. The other clade with specimens from Mexico to El Salvador, corresponds to a new species, differing from the syntype of C. vectilucis. This new species keys to “Autochton vectilucis” (C.16.4) in Evans (1952) and was included by him in this species. The new species differs from C. vectilucis by typically 2 (not 3 or 4) well-developed subapical hyaline spots (a third spot in cell R₂-R₃ is minute), a broader forewing yellow semihyaline band, a rounder distal end of the harpe with more concave dorsoposterior margin next to it, and a shorter ampulla, which is less than half of the valva length. Due to the cryptic nature of this species and insufficiently studied individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly725.4.1:G30A, aly577.47.7:T150C, aly577.47.7:T153G, aly361.29.3:C162T, aly361.29.3:C174T; and COI barcode: T49C, T91C, T115C, T304C, T445C, A565G.

Barcode sequence of the holotype.

Sample NVG-19119B07, GenBank PV972376, 658 base pairs:

AACTTTATATTTTATATTTGGAATTTGAGCAGGATTAGTTGGAACTTCCTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCCTTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCACTTATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTACCCCCATCATTAACTCTTTTAATTTCAAGAAGTATCGTTGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGCTCACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCTCTATTACTATTACTTTCATTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAATTTAAACACTTCATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 56–57 (genitalia Fig. 753–754), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ MEXICO: CHIAPAS | Ochuc | 15-VI-1975 | P. Hubbell ], [ DNA sample ID: | NVG-19119B07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032C03 | c/o Nick V. Grishin ], [ genitalia | NVG241118–08 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602617 ], and one red [ HOLOTYPE ♂ | Cecropterus (Thorybes) | septelucis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 2♀♀: 1♂ NVG-19124G05 Mexico, Chiapas, La Trinitaria, Arch E of Lagunas de Montebello, 18-May-1987, C. J. Durden leg. [TMMC]; 1♀ NVG-19119B08, USNMENT 01602618 Honduras, El Zamorano, Mount Uyuca cloud forest, 26-Jul-1979, R. D. Lehman leg. [USNM] (Fig. 58–59); and El Salvador: 1♂ NVG-15021A08 Ahuachapan, Apaneca Volcano, 5000’, 15-Oct-2004 [JRS] and 1♀ NVG-19119B06, USNMENT 01602616 2 mi down from Cerro Verde summit, 20-Aug-1972, F. F. and S. Hevel leg. [USNM].

Type locality.

Mexico: Chiapas, Ochuc.

Etymology.

The name of its sister species, C. vectilucis, is likely derived from Latin: vecti is from veho, vectus (to carry, transport, or convey) and lucis is a genitive form of lux, meaning light. Therefore, vectilucis means carrier of light or bearer of light, probably referring to the yellow beam-like band on forewings of this species. The name of the new species means northern light and is a fusion: septe[ntrionalis (Latin for Northern)] + [vecti]lucis, indicating a more northern distribution of this species. The name is treated as a noun in apposition.

Distribution.

Currently known from Mexico (Chiapas), Honduras, and El Salvador.

Cecropterus (Murgaria) lapus Grishin, new species

https://zoobank.org/770B9460-7719-4454-BC32-153C66B45F73

(Fig. 2 part, 60–61, 755–760)

Definition and diagnosis.

Genomic analysis of specimens from southwestern Mexico initially identified as Cecropterus (Murgaria) jalapus (Plötz, 1881) (type locality Mexico: Veracruz, Xalapa, lectotype sequenced as NVG-5032A11) reveals that they are genetically differentiated from it, including its junior subjective synonym Telegonus xerxes Bell, 1934 (type locality in Belize, holotype sequenced as NVG-15104A07), at the species level (Fig. 2); e.g., their COI barcodes differ by 3.3% (22 bp), and therefore represent a new species. This new species keys to “Achalarus jalapus” (C.17.5) in Evans (1952), but differs from it and other relatives by a darker appearance with more faint paler-brown spots on the forewing, darker hindwing fringes (typically with a higher fraction of brown scales) and slightly rounder, less lobed hindwings in males, a narrower valva at the base of the harpe, and a more extended harpe with a straighter ventral margin and a shorter basal process (directed anteriad). In its facies, this new species is also similar to Cecropterus (Murgaria) nigrociliata (Mabille and Boullet, 1912) (type locality in Mexico), but differs from it by the terminally rounded and upturned harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly276759.5.1:C306T, aly276759.5.1:G351T, aly4305.13.3:C108T, aly4305.13.3:A126G, aly420.39.3:C153T; and COI barcode: T4C, T13C, A200G, T286C, T472C, T646C.

Barcode sequence of the holotype.

Sample NVG-24064G07, GenBank PV972377, 658 base pairs:

AACCTTATATTTCATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCACTTATATTAGGAGCCCCCGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACCCTCCTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATCGCTCATCAAGGAGCATCTGTAGATTTAGCAATTTTTTCATTACACTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTCATTACAACTATTATTAATATACGAATCAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTACTACTTCTATCATTACCCGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCAGGTGGGGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 60–61 (genitalia Fig. 755–757), bears the following nine printed (text in italics handwritten) rectangular labels, eight white: [ MEXICO: SINALOA | 1 mi. E Rosario | 17 m.; dense scrub | 18.viii.1973; L. D. | & J. Y. Miller | Sta. No. 1973–31 ], [ SRS Database | No. 6 ], [ A. C. Allyn | Acc. 1973–38 ], [ MGCL/FLMNH | Specimen no. | 17243 ], [ {QR Code} UF | FLMNH | MGCL 1043343 ], [ DNA sample ID: | NVG-24064G07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24077A01 | c/o Nick V. Grishin ], [ genitalia | NVG241220–19 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cecropterus (Murgaria) | lapus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 4♀♀ from Mexico: 1♀ NVG-17115E06, CSU_ENT1045688 Sinaloa, Concordia, Mesa del Carrizal, Hilltop “La Vieja”, 26-Nov-2005, P. A. Opler and E. M. Buckner leg. [CSUC]; 1♂ NVG-24064G02 (leg, DNA sequenced), NVG-24077A02 (abdomen, DNA stored) Michoacan, Coahuayana, Aug-1950. T. Escalante leg., genitalia NVG241220–20 (Fig. 758–760) [MGCL]; Oaxaca [MGCL]: 1♀ NVG-24064G04 Candelaria Loxicha, 500 m, 4-Nov-1969, E. C. Welling leg., genitalia SRS-2151 and 1♀ NVG-24064G05 2 mi N of Candelaria Loxicha, 23-Oct-1988, J. Kemner leg.; and Chiapas [MGCL]: 1♂ NVG15041F09 Bombaná, 1500’, 10-Sep-1974, R. Wind leg. genitalia GTA-13841 and 1♀ NVG-24064G06 El Aguacero, 3-Aug-1988, J. Kemner leg.

Type locality.

Mexico: Sinaloa, 1 mi east of El Rosario, elevation 15 m.

Etymology.

The name is formed from the name of its sister, C. jalapus, to make it shorter for this more western new species. The name is treated as a noun in apposition.

Distribution.

Western and Southern Mexico.

Comment.

While this new species has not been recorded from the USA, we confirm the USA record of C. jalapus by genomic sequencing (NVG-19013H02, USA: TX, Starr Co., 15 mi west of Sullivan city, 19-Oct-1973, W. W. McGuire leg. [TAMU], Fig. 2).

Cecropterus (Murgaria) herophilus (Plötz, 1881) is a valid species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877) and Urbanus albimargo rica Evans, 1952 is its junior subjective synonym

Goniurus herophilus Plötz, 1881 (type locality Rio[ de Janeiro, Brazil]) was described from an unstated number of specimens and synonymized with Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality in French Guiana) by Godman (1907), who inspected Plötz’s original drawing t[afel]. 43, now likely lost, and was swayed by the green color of the wing bases, also mentioned in the original description (Plötz 1881). We located a Plötz-like illustration of the dorsal side (without left wings) of G. herophilus (Pl.t.43) pinned in one of the drawers of the ZSMC below the “virescens Mab.” header label. While it indeed shows a significant fraction of both wings colored dark-greenish (with ochre and brownish tints) from the base, along with a green thorax and abdomen, other details of the wing pattern do not match C. virescens and are in agreement with the original description of G. herophilus. The description states (closely translated from the German original): “Band of the forewing linear, in cell 1 very fine” (a typical C. virescens specimen would have wider bands more strongly separated into spots) and “The end of the short, somewhat broad tail and from there a narrow outer margin of the hindwing to costal margin are white” (in C. virescens, the entire tail is white and the hindwing apex is brown including the fringe in most specimens) (Plötz 1881).

Next, in the MFNB, as stated in the original description, we found and sequenced a specimen labeled as a type of G. herophilus. Genomic analysis places this specimen away from C. virescens and with Cecropterus (Murgaria) rica (Evans, 1952) (type locality Paraguay: Sapucaí), initially proposed as Urbanus albimargo rica Evans, 1952 and currently treated as a species-level taxon (Li et al. 2019) (Fig. 2). Phenotypic inspection agrees with this assessment. Furthermore, both taxa are from southeastern South America. While the putative syntype of G. herophilus does not have prominently green wing bases, it has a narrow semihyaline band on the forewing and terminally white hindwing tail (dark brown in the middle along the vein), matching both the original description of G. herophilus and its illustration in ZSMC. In descriptions and illustrations of other species, Plötz depicted them greener than currently known, e.g., see a discussion in Zhang et al. (2022a). Therefore, we have not discarded this possible syntype due to the difference in color but proceeded with its further analysis.

The original description gives “5177” as a collection number for specimen(s) of G. herophilus (Plötz 1881). See Zhang et al. (2023f) for discussion about these numbers. The putative syntype bears a label with the number “5117”. Collection catalog written by Carl Heinrich Hopffer (1810–1876), who was the curator of entomological collections in the MFNB until his death, lists “2” specimens identified as “Hesperia sp.” as the entry for “5117” from “Rio” collected by “v. Olfers | von Langsdorff”. We have not located the second specimen, which likely does not bear any labels at all, because, typically, only the header specimen was originally labeled in the Berlin old collection with a single label giving only the collection number, in this case 5117. It is not clear whether Ignaz Maria von Olfers (1793–1872) and Georg Heinrich von Langsdorff (1774–1852) collected one specimen each (seems more likely), or they collected both specimens together. It is also not clear whether the two specimens were conspecific. The identification given as “Hesperia sp.” simply means unidentified Hesperiidae, rather than a species currently placed in the genus Hesperia Fabricius, 1793 (type species Papilio comma Linnaeus, 1758): the preceding catalog entries 5114–5116 are identified as “Hesperia Doryssus”, referring to Cecropterus (Murgaria) doryssus (Swainson, 1831) and the next identified entry, 5119, is listed as “Hesperia Chalco Hb.”, referring to Telegonus (Telegonus) chalco (Hübner, 1823). Sandwiched between these two tailed Eudaminae species formerly placed in the genus Urbanus Hübner, [1807] (type species Papilio proteus Linnaeus, 1758) (Evans 1952; Mielke 2005) and before that, in its junior objective synonym Goniurus Hübner, [1819] (Mielke 2005), it is most likely that two specimens of 5117 were of similar appearance consistent with G. herophilus. In contrast, the catalog entry 5177 gives “Ismene sp.” (in Hesperiinae) from “Java” collected by “Sieber” [Friedrich Wilhelm Sieber (1775–1831)]. Therefore, also considering visual similarities between numbers “1” and “7”, it is most likely that “5177” in Plötz (1881) is a lapsus, and the specimens meant were 5117.

Taken all the evidence, we conclude that specimen 5117 in the MFNB is a syntype of G. herophilus and hypothesize that Plötz misinterpreted the color of the wing bases of this specimen, which are simply paler brown, grayer, and overscaled with ochre, and not shiny-green as in C. virescens; and thus the number 5177 was published instead of 5117. To stabilize nomenclature and define the name G. herophilus objectively, N.V.G. hereby designates the syntype in the MFNB collection, the male that bears the following eight labels (1^st red, 3^rd green, 6^th pale yellow, others white; 1^st, 3^rd, and 4^th, handwritten, others printed with handwritten text shown in italics below): [ Type ], [ 5117 ], [ v. Olf | Rio. v. Lgsdf ], [ herophilus | Pl. | type ], [ Allyn Museum Photo No. 830113 – 3,4 ], [ Zool. Mus. | Berlin ], [ {QR Code} http://coll.mfn-berlin.de/u/ | e1f9e0 ], [ DNA sample ID: | NVG-15029F12 | c/o Nick V. Grishin ], as the lectotype of Goniurus herophilus Plötz, 1881. Judging from the 3^rd (green) label, in the handwriting of Hopffer, the lectotype was likely collected in Brazil: Rio de Janeiro by von Olfers or (and?) von Langsdorff, in agreement with the entry in the unpublished old collections catalog housed at the MFNB. The lectotype is missing its head and the tornal portion (with the tail) of the right hindwing. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15029F12, GenBank PV972378, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGTATAAACAATATAAGATTTTGATTACTACCCCCATCCTTAACCCTTTTAATCTCAAGAAGAATTGTAGAAAACGGTGCAGGTACTGGATGAACAGTTTACCCTCCTTTATCATCTAATATTGCACACCAAGGAGCATCTGTAGATTTGGCAATTTTTTCATTACATTTAGCCGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCATTTGATCAATTACCCCTATTTATTTGAGCAGTTGGAATCACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACCGATCGAAATTTAAATACCTCTTTTTTCGATCCAGCAGGTGGAGGAGACCCCATTTTATATCAACATTTATTT

Because the lectotype of G. herophilus is genetically and phenotypically close to specimens currently identifiable as C. rica, we hypothesize that these taxa are conspecific, and therefore propose that Urbanus albimargo rica Evans, 1952 is a junior subjective synonym of Cecropterus (Murgaria) herophilus (Plötz, 1881), reinstated status.

Cecropterus (Murgaria) margo Grishin, new species

https://zoobank.org/95DF60A6-899D-4351-B3EB-44C25725D572

(Fig. 2 part, 62–63, 761–762)

Definition and diagnosis.

Genomic sequencing of specimens we initially identified as Cecropterus (Murgaria) albimargo (Mabille, 1875) (type locality given as “Panama, Colombia ?”, general appearance of a syntype in BMNH agrees better with specimens from southern Brazil because of narrow white bands) reveals that they partition into two distinct clades (Fig. 2). The clade consisting of Mexican specimens is prominently separated from all other relatives and is genetically differentiated from them at the species level (Fig. 2); e.g., their COI barcodes differ by 2.5% (17 bp) from both C. albimargo and Cecropterus carmelita (Herrich-Schäffer, 1869) (type locality in Brazil, per label of a syntype sequenced as NVG-15029G01), by 2.4% (16 bp) from Cecropterus herophilus (Plötz, 1881), reinstated status, and by 3.2% (21 bp) from Cecropterus trebia (Möschler, 1879) (type locality in Venezuela), and therefore represents a new species. Most specimens of this new species key to “Urbanus albimargo albimargo” (C.13.26(a)) in Evans (1952) and were included by him in that taxon, although some possess even less developed white hindwing areas and may key to “Urbanus carmelita trebia” (C.13.22(a)), but differ in genitalia. The new species differs from C. albimargo by more reduced white along the hindwing margins (a specimen nearly lacking the white was selected as the holotype) and differs from all of its relatives by a longer and more upturned harpe only slightly wider towards the dorsal margin (typically rather broad in other species), the harpe is most similar in shape to Cecropterus (Murgaria) trebia (Möschler, 1879) (type locality in Venezuela), but differs by a more bulging ampulla and a longer and more curved caudally-directed section of the harpe, thus setting the dorsally-directed section farther apart from the ampulla. Due to the cryptic nature of this species and significant individual variation in the extent of white coloration along the outer margin of the hindwing, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2694.9.5:C33G, aly6370.13.21:C87T, aly26.4.13:G120A, aly499.8.5:C81T, aly151.22.17:C93T; and COI barcode: T103C, T178C, C367T, T500C, A631G, T646C.

Barcode sequence of the holotype.

Sample NVG-15105B06, GenBank PV972379, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAATCCCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGTATAAACAATATAAGATTTTGATTATTACCCCCATCCTTAACCCTTTTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTACCCCCCTTTATCATCTAATATTGCACATCAAGGAGCATCTGTAGATTTAGCAATTTTTTCATTACATTTAGCCGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCATTTGATCAATTACCCCTATTTATTTGAGCAGTTGGAATTACAGCTCTATTATTATTACTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTCGATCCAGCAGGTGGGGGGGACCCCATCTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 62–63 (genitalia Fig. 761–762), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ MEX.: Nayarit, | 5 mi.S. Matanchen | (v.S.Blas)XII-28-71 | C. D. MacNeill ], [ Collection of | C. D. MacNeill ], [ Urbanus carmelita ? | (H.-S.) | (nr.U. albimargo) | Det. C.D. MacNeill ‘88 ], [ DNA sample ID: | NVG-15105B06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D07 | c/o Nick V. Grishin ], [ genitalia | NVG241114–02 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cecropterus (Murgaria) | margo Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 2♀♀ from Mexico: 1♂ NVG-15021D04 Nayarit, Singayta, 30-Sep-1988, D. L. Lindsley leg. [MGCL]; 1♂ NVG-15116H02, CSU_ENT1045548 Veracruz, Dos Amates, 15-Sep-1972, R. E. Stanford leg. [CSUC]; 1♀ NVG-14108F03 Veracruz, Tierra Blanca, Aug-1941, J. C. Hopfinger collection leg. [USNM]; and 1♀ NVG-14113G11 Tabasco, 27 mi N of Teapa, 29-Jun-1969, Coll. John E. S. Dockweiler [LACM].

Type locality.

Mexico: Nayarit, vicinity of San Blas, 5 mi south of Matanchén.

Etymology.

The name is formed from the name of its relative, C. albimargo, made shorter for this more northern species. The name is treated as a noun in apposition.

Distribution.

Currently known from Mexico.

Cecropterus (Murgaria) amazonensis Grishin, new species

https://zoobank.org/94F9B3B9-1BE9-470B-98A4-4A3EDAD598A0

(Fig. 2 part, 64–65, 763–768)

Definition and diagnosis.

Sister to recently described Cecropterus (Murgaria) dariensis Grishin, 2023 (type locality in Panama: Darién), this new species is most similar to it, being genetically differentiated at the species level (Fig. 2); e.g., their COI barcodes differ by 2.1% (14 bp). Both species key (imperfectly) to “Urbanus carmelita carmelita” (C.13. 22(b)) in Evans (1952) and are misidentified in collections as the latter species, currently Cecropterus (Murgaria) carmelita (Herrich-Schäffer, 1869) (type locality in Brazil, per label of a syntype sequenced as NVG-15029G01) but differ from it by vestigial, line-like and not scalloped white outer marginal band on the hindwing underside and other characters as stated for C. dariensis in Zhang et al. (2023a). The new species differs from its sister C. dariensis by larger and more separated forewing semihyaline spots, a broader hindwing in males with a shorter and broader tail, longer uncus arms compared to tegumen, and a longer anterior tooth on the harpe, compared to a posterior serrated bulge. Due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly517.20.2:C48T, aly517.20.2:C87T, aly536.157.4:C50T, aly536.157.4:G69A, aly536.157.4:C91T; and COI barcode: T223C, T407T, A409A, T412C, A421C, A550A, T581C.

Barcode sequence of the holotype.

Sample NVG-14103A03, GenBank PV972380, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCCCTTATACTAGGAGCCCCCGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAACGGTGCAGGTACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATTGCTCATCAAGGAGCATCCGTAGATTTAGCAATTTTCTCACTACATTTAGCCGGAATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAACATACGAATTAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTACTATTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATACTACTAACTGATCGAAATTTAAATACTTCTTTTTTTGACCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 64–65 (genitalia Fig. 763–765), bears the following six rectangular labels (2^nd handwritten, others printed), five white: [ BRASIL: Rondônia | 62km S Ariquemes | Fazenda Rancho | Grande. 165m el. | 10°32’S, 62°48’W | 14–25 Nov. 1993 | Brian Harris ], [ Urbanus | carmelita | carmelita ? ], [ DNA sample ID: | NVG-14103A03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-5091 | c/o Nick V. Grishin ], [ genitalia | NVG151101–100 | Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Cecropterus (Murgaria) | amazonensis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-15021D05 Brazil, Rondônia, Rd. C-20, 1–2 km E of Fazenda Rancho Grande, 8-Nov-1990, Jim P. Brock leg., genitalia GTA-975 (Fig. 766–768) [MGCL].

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, Fazenda Rancho Grande, elevation 165 m, GPS −10.533, −62.800.

Etymology.

The name is derived from the expected Amazonian distribution of this species, in contrast to its sister, C. dariensis, and is an adjective.

Distribution.

Currently known only from Rondônia, Brazil.

Spicauda surprisa Grishin, new species

https://zoobank.org/42DA06AF-EA51-43F9-8FF7-E25D1CC00C0D

(Fig. 2 part, 66–67, 769–771)

Definition and diagnosis.

Unexpectedly, a specimen from Paraná, Brazil, we initially identified as Spicauda zalanthus (Plötz, 1881) (type locality in Brazil: Rio Grande do Sul), treated as a species-level taxon in (Zhang et al. 2023b), is genetically differentiated from it (including a specimen from Paraná, NVG-19121B08) at the species level in the nuclear genome (Fig. 2) (but their COI barcodes do not differ), and therefore represents a new species. This new species keys to “Urbanus teleus” (C.13.13) in Evans (1952), but differs from it and other relatives by a less straight (especially the spot in cell CuA₁-CuA₂) discal band of hyaline spots on the forewing, uncus arms being slightly closer together, a longer tegumen, a less concave ventral margin of the valva, and also the anterior part of its dorsal margin, a slightly narrower harpe wider separated from the ampulla, with less serrated and more strongly humped dorsoposterior part (posteriad of the spike), and concave distal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3499.14.7:G39A, aly272.4.3:A123G, aly272.4.3:A762G, aly272.4.3:T765C, aly272.4.3:T1278C, aly2363.8.5:A57A (not T), aly2363.8.5:C60C (not T), aly1651.12.5:G144G (not A), aly479.10.4:C141C (not T), aly479.10.4:C171C (not T). The holotype and the only known specimen of the new species does not differ in its COI barcode from S. zalanthus.

Barcode sequence of the holotype.

Sample NVG-19121C05, GenBank PV972381, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAGTTGGAACCTCATTAAGATTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCACATGCCTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGAACTGGATGAACTGTATACCCCCCTTTATCTGCTAATATTGCCCATCAAGGGGCATCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCCTTATTATTATTACTTTCACTACCTGTTTTAGCAGGTGCTATTACTATATTACTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTGCTGGGGGAGGAGATCCTATTTTATACCAACACTTATTT

Type material.

Holotype:♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 66–67 (genitalia Fig. 769–771), bears the following six printed rectangular labels, five white: [ BRAZIL, PR, Guaratuba, | Castelhanos 750–800 m | 25°50’S, 49°01’W | 18 Mar 1995 | leg. Mielke, Robbins, | & Caldas ], [ DNA sample ID: | NVG-19121C05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032B07 | c/o Nick V. Grishin ], [ genitalia | NVG241118–09 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602716 ], and one red [ HOLOTYPE ♂ | Spicauda | surprisa Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Paraná, Guaratuba, Castelhanos, elevation 750–800 m, GPS −25.8333, −49.0167.

Etymology.

The name is given in reference to the surprise of discovering yet another species closely related to S. teleus. The name is treated as a feminine noun in apposition.

Distribution.

Currently known only from the holotype collected in South Brazil.

Comment.

Male genitalia of S. zalanthus NVG-19121B08 (leg, DNA sequenced), NVG-22032B06 (abdomen, DNA stored), USNMENT 01602707 from Brazil: Paraná, Curitiba, 900 m, 26-Oct-1969, O. Mielke leg., genitalia NVG241118–10 [USNM], are shown for comparison in Fig. 772–774.

Spicauda pecne Grishin, new species

https://zoobank.org/D74C1F5D-D38F-425B-BF44-C4E20DD15AAE

(Fig. 2 part, 68–71, 775–776)

Definition and diagnosis.

Genomic analysis of specimens we identified as Spicauda procne (Plötz, 1881) (type locality in Brazil) reveals that the two specimens from the western parts of the range in South America were genetically differentiated from the rest (including two possible syntypes of S. procne in the MFNB) at the species level in the nuclear genome (Fig. 2) (but their COI barcodes do not always differ), and therefore represent a new species. This new species keys to “Urbanus procne” (C.13.18) in Evans (1952), but differs from it and other relatives by more robust and less upturned harpe with a dorsally directed spike reaching the level of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4456.9.1:C144T, aly17.11.1:A85C, aly17.11.1:A92G, aly890.44.4:A183G, aly221.13.13:G60A. The COI barcode does not differentiate this species from some specimens of S. procne.

Barcode sequence of the holotype.

Sample NVG-19121F05, GenBank PV972382, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGTACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACACCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCACATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTACCCCCATCCCTAACTCTTCTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTACTGGATGAACAGTATATCCTCCTTTATCTTCTAATATTGCTCATCAAGGAGCATCAGTAGACTTAGCAATTTTTTCTTTACATCTTGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCCTTATTATTATTACTTTCCTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCAGCTGGTGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 68–69 (genitalia Fig. 775–776), bears the following six printed rectangular labels, five white: [ PERU: Cajamarca | 10 km W Chilete | La Capilla, 700m | 07° 11.6’S, 78° 57.4’W | 17 September 1999 | Ahrenholz, Robbins, Lamas ], [ DNA sample ID: | NVG-19121F05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119F12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–11 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602751 ], and one red [ HOLOTYPE ♂ | Spicauda | pecne Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-19121F04, USNMENT 01602750 Ecuador, Loja, Loja-Catamayo Rd, Km 28, 1800 m, 16-May-1988, S. S. Nicolay leg. [USNM] (Fig. 70–71).

Type locality.

Peru: Cajamarca Region, 10 km west of Chilete La Capilla, elevation 700 m, GPS −7.1933, −78.9567.

Etymology.

The name is a fusion: p[eru] + ec[uador + proc]ne. It is treated as a noun in apposition.

Distribution.

Ecuador and Peru.

Urbanus (Urbanoides) xenophon Grishin, new species

https://zoobank.org/CCE8432D-7520-4E59-B5B9-96E122C75D9B

(Fig. 3 part, 72–75, 777–778)

Figure 3.

Phylogenetic trees of selected Urbanus and Telegonus inferred from protein-coding regions in a) the Z chromosome, based on 262,329 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Two specimens from Central America form a clade sister to but genetically differentiated from Urbanus prodicus Bell, 1956 (type locality Mexico: Veracruz, Xalapa) at the species level (Fig. 3); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore represent a new species. This new species keys to Urbanus elmina Evans, 1952 (type locality Ecuador: Rio Pastaza) (C.13.9) in Evans (1952) and to U. prodicus in Steinhauser (1987), but differs from them and other relatives by the lack of the costal fold in males; brilliant-blue scales on the hindwing, the blue area occupies less than half of the wing and is separated from the brown ground color by a sharp transition; forewing bases more conspicuously bluish-green, transitioning to ochre; large semihyaline rectangular spots on the forewing with a width more than half of their length, three subapical spots and the lower spot is strongly offset distad, not overlapping with the two others; in male genitalia is most similar to its sister species U. prodicus in having a short and stout (basically, a broad triangular tooth) dorsal process of the harpe, but valvae are narrower, nearly symmetrical with an almost straight costa-ampulla. Due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1350.22.8:T645G, aly1350.22.8:A663G, aly407.1.2:C36T, aly164.48.1:C82T, aly925.2.3:C96T; and COI barcode: T5C, A43T, T163C, T287T, T346C, T619G.

Barcode sequence of the holotype.

Sample NVG-15093A11, GenBank PV972383, 658 base pairs:

AACCCTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCATTAAGATTACTTATTCGGACTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCTCTAATAATAGGAGCCCCTGATATAGCTTTCCCACGTATAAATAACATAAGATTTTGATTACTACCCCCCTCTTTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGTGCTGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCCCTACATCTTGCTGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGTAATTTATCTTTTGATCAAATACCCCTATTTGTATGGGCTGTGGGAATTACAGCATTATTATTATTATTGTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGACCGAAATTTAAATACTTCCTTTTTTGATCCGGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 72–73 (genitalia Fig. 777–778), bears the following six rectangular labels (1^st handwritten and others printed, text in italics handwritten), five white: [ Costa Rica | San José | Ruta 2 | Km 117 | 26 Dec 1984 | leg GT Austin ], [ Genit. Vial | SRS-3075 ], [ Urbanus | prodicus ♂ | Det: S. R. Steinhauser ], [ G T Austin colln | MGCL Acc. | 2004–5 ], [ DNA sample ID: | NVG-15093A11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Urbanus (Urbanoides) | xenophon Grishin ]. Paratype: 1♀ NVG-15092D08 Panama, Chirqui, Vulcan, 3-Jun-1971, H. L. King leg. [MGCL] (Fig. 74–75).

Type locality.

Costa Rica: San José Province, Ruta 2, Km 117.

Etymology.

In ancient Greek philosophy, Prodicus of Ceos was associated with the Sophists, a group of intellectuals who were known for their skills in rhetoric and teaching. Prodicus had several notable students, and one of them was the philosopher and historian Xenophon. Xenophon studied under Prodicus and later wrote about him in his works, including “Memorabilia” and “Symposium.” Xenophon was a significant disciple and follower of Prodicus, and this new species is sister to U. prodicus. The name is a noun in apposition.

Distribution.

Costa Rica and Panama.

Urbanus (Urbanus) torcidus Grishin, new species

https://zoobank.org/283EBCDF-8ED3-42B5-864F-E952C42CAA1F

(Fig. 3 part, 76–77)

Definition and diagnosis.

A single female from eastern Colombia is sister to Urbanus rickardi Grishin, 2023 (type locality in USA: Texas, Hidalgo Co.) but is genetically differentiated from it at the species level (Fig. 3); e.g., their COI barcodes differ by 2.6% (17 bp). Furthermore, this female has a different pattern of the ventral hindwings (see below), and therefore represents a new species. This new species keys to Urbanus pronus Evans, 1952 (type locality Ecuador: Ambato) (C.13.5) in Evans (1952) and in Steinhauser (1987), but differs from it and other relatives by females (male unknown or unrecognized) with a strongly curved ventral hindwing postdiscal dark band, nearly going into the tail, both bands wide, the two dark spots near the costa merged with each other; the forewing spot in cell M₃-CuA₁ being very large, longer than wide; greenish (not bluish) overscaling on the hindwings above covering 2/3 of the wing, and ocherous overscaling on the dorsal forewing, greener at the very base. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1052.5.13:C60A, aly4523.3.1:T43C, aly1937.29.5:G180A, aly1222.19.35:C99T, aly83.15.19:T28C; and COI barcode: T206C, A373G, T386A, T490C, T601C.

Barcode sequence of the holotype.

Sample NVG-18056E05, GenBank PV972384, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTACCTCTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTATTGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCATCAAGGGGCTTCTGTTGATATAGCAATTTTTTCTCTTCATCTTGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCTTTTGACCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAACACTTCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 76–77, bears the following three printed rectangular labels, two white: [ Ober Rio Negro | Ost Colomb. | 800 m | Coll. Fassl ], [ DNA sample ID: | NVG-18056E05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Urbanus (Urbanus) | torcidus Grishin ].

Type locality.

Colombia: east, upper Río Negro, elevation 800 m.

Etymology.

The name is formed from the Spanish word torcido, which means distorted, twisted, or bent, and refers to a more irregular and bent shape of ventral hindwing bands compared to relatives of this species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in eastern Colombia.

Urbanus (Urbanus) viterbo Grishin, new species

https://zoobank.org/82EA9B83-5F58-479B-9711-E955B0359805

(Fig. 3 part, 78–81, 779–780)

Definition and diagnosis.

Genomic sequencing of the holotype of Urbanus (Urbanus) viterboana (Ehrmann, 1907) (type locality in Colombia: Sacorro, sequenced as NVG-15095A01) reveals that it is a species closely related to Urbanus (Urbanus) dubius Steinhauser, 1981 (type locality in Colombia: Valle del Cauca) (Fig. 3) and specimens of the species currently referred to as U. viterboana form a clade sister to several other species, including Urbanus (Urbanus) alva Evans, 1952 (type locality in Mexico: Veracruz) and Urbanus (Urbanus) villus Austin, 1998 (type locality in Brazil: Rondônia), and therefore represent a new species. This new species keys to Urbanus viterboana viterboana (C.13.2(b)) in Evans (1952) and in Steinhauser (1987) and was included in this taxon as a result of misidentification, but differs from it and other relatives by the following combination of characters: larger and more square forewing semihyaline spots, in particular, the spot in cell CuA₁-CuA₂ is diamond-shaped (comma-shaped in U. viterboana and distally excavated in U. villus) and a spot in cell M₂-M₃ is typically present; basal overscaling on the dorsal side of wings with a bluish tint; an unbroken basal dark band on the ventral hindwing that usually widens towards the costal margin, a nearly straight postdiscal band; relatively shorter hindwing tail; a narrower valva with a more concave in the middle ventral margin and terminally more rounded harpe, narrower and closer to each other uncus arms, which are nearly parallel throughout their length and only slightly more diverging distally. Due to the cryptic nature of this species, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly173.21.15:T12C, aly168.12.4:C87T, aly1937.10.1:C141T, aly4305.17.3:G36A, aly4305.17.3:T48C; and COI barcode: T319C, T361C, T385C, T484C, T574A.

Barcode sequence of the holotype.

Sample NVG-18088B08, GenBank PV972385, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTACCTTTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTGCCCCCTTCTTTAACTTTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCCGGTACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATCGCCCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCCCTTCATCTAGCAGGTATTTCATCAATTCTTGGGGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCCTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGGGATCCAATTCTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 78–79, bears the following three printed rectangular labels, two white: [ Ober Rio Negro | Ost Colomb. | 800 m | Coll. Fassl ], [ DNA sample ID: | NVG-18088B08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Urbanus (Urbanus) | viterbo Grishin ]. Paratypes: 1♂ and 3♀♀: Mexico, Tamaulipas, 1–4 km N Gomez Farias, C. J. Durden leg. [TMMC]: 1♂ NVG-19125B10 23-Dec-1970, genitalia NVG241118–12 (Fig. 779–780); 1♀ NVG-19124E06 26-Dec-1970; and 1♀ NVG-19124E10 9-Jan-1972 and 1♀ NVG-15029C10 Panama, Chiriqui, Vulcan, old [ca. 1900], Troetsch, Coll. Staudinger [MFNB] (Fig. 80–81).

Type locality.

Colombia: east, upper Río Negro, elevation 800 m.

Etymology.

This species has been misidentified as U. viterboana, and its name reflects it, made shorter for this typically more northern species. The name is treated as a noun in apposition.

Distribution.

Mexico to Colombia.

Urbanus (Urbanus) alvinus Grishin, new species

https://zoobank.org/DE4E1DF6-122A-4CD6-B14E-AAB5D23B4EEE

(Fig. 3 part, 82–83, 781–782)

Definition and diagnosis.

Genomic sequencing of south Peruvian specimens initially identified as Urbanus (Urbanus) viterboana (Ehrmann, 1907) (type locality in Colombia: Sacorro) due to their bluish coloration of the dorsal overscaling at the base of the hindwing, places them as a clade sister to Urbanus (Urbanus) alva Evans, 1952 (type locality in Mexico: Veracruz) instead, and away from the holotype of U. viterboana (NVG-15095A01) (Fig. 3). The clade of these Peruvian specimens is genetically differentiated from its sister U. alva at the species level in the nuclear genome (but their COI barcodes do not differ), and therefore represents a new species. This species keys (incompletely) to Urbanus viterboana viterboana (C.13.2(b)) in Evans (1952) and in Steinhauser (1987), but differs from it and other relatives by the following combination of characters: bluish (not greenish) tint of scales in the basal half of the dorsal hindwing and olive overscaling at the base of the forewing; nearly rectangular semihyaline spots on the forewing; on the hindwing underside, the distal spot near the costa usually somewhat separated from the inner dark-brown band, the basal spot near the costa being nearly fused with this band, thick and almost straight postdiscal dark-brown band; a little broader valva with a sinuous (broad W) dorsal margin and a strongly concave ventral margin of the valva, a more prominent and rounded ampulla; a pointed distal end of the harpe; closely placed and nearly parallel uncus arms that are somewhat shorter than in relatives; and a slightly narrower tegumen in dorsal view. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly363.28.4:C183T, aly390.28.3:A57G, aly443.38.11:G51A, aly208.8.2:T117C, aly23605.21.7:C516G; and COI barcodes do not distinguish this species from U. alva.

Barcode sequence of the holotype.

Sample NVG-20012G12, GenBank PV972386, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATAATAGGAGCCCCTGATATAGCTTTCCCTCGTATAAACAATATAAGATTTTGATTATTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCACCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCCCTTCATCTAGCAGGTATCTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATCATTAACATACGAATTAATAGATTATCTTTTGATCAAATACCATTATTTGTGTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACCGATCGAAACTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTCTATATCAACATTTATTT

Type material.

Holotype: ♂ currently in the Dempwolf collection (Austin, Texas, USA), to be deposited in the Museo de Historia Natural, Lima, Peru (MUSM), illustrated in Fig. 82–83 (genitalia Fig. 781–782), bears the following six printed rectangular labels, five white: [ Peru: Cuzco Dept, 1050m | Cosñipata Valley, Quebrada | Quitacalzón 13° 01’S, | 71° 29’W June 15. 2019 | Leg: W. Dempwolf ], [ DNA sample ID: | NVG-20012G12 | c/o Nick V. Grishin ], [ WRD 15,515 ], [ DNA sample ID: | NVG-24015F03 | c/o Nick V. Grishin ], [ genitalia | NVG241114–35 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Urbanus (Urbanus) | alvinus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂ with the same data as the holotype: NVG-20012G09, WRD 15511; NVG-20012G04, WRD 15512; and NVG-20012G11 (leg, DNA sequenced), NVG-24015F04 (abdomen, DNA stored), WRD 15514, genitalia NVG241114–36.

Type locality.

Peru: Cuzco Department, Cosñipata Valley, Quebrada Quitacalzón, elevation 1050 m, GPS −13.0167, −71.4833.

Etymology.

The name is formed from the name of its sister species, U. alva, made longer for this more southern species. The name is an adjective.

Distribution.

Currently known only from southern Peru.

Telegonus (Telegonus) alco Grishin, new species

https://zoobank.org/1FF57517-7EC6-4995-8CC5-1A6CCFB16FCA

(Fig. 3 part, 84–87, 783–784)

Definition and diagnosis.

Genomic analysis of specimens of Telegonus (Telegonus) chalco (Hübner, 1823) (type locality in Brazil) from across their range revealed a split into two clades that are genetically differentiated from each other at the species level in the nuclear genome (Fig. 3) (but their COI barcodes differ by only 0.6%, 4 bp). The clade with specimens from Brazil represents T. chalco. The clade consisting of specimens from Panama, Venezuela, and Ecuador does not have a name and represents a new species. This new species keys to “Urbanus chalco” (C.13.28) in Evans (1952), but differs from it and other relatives by a typically narrower white margin on the hindwing, better expressed brown areas by the ventral hindwing apex (in many typical T. chalco specimens the apex is white), slightly longer and narrower hindwing tails, a narrower in the middle valva with more convex costa, and a more rounded, larger basal process of the harpe by the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4506.8.1:A180G, aly4506.8.1:T237C, aly208.4.3:T1086C, aly383.18.4:C99T, aly383.18.4:C102A; and COI barcode: T193T, T355T, 400C, T571C.

Barcode sequence of the holotype.

Sample NVG-17097G01, GenBank PV972387, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTTTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCATTAATAATAGGAGCCCCAGACATAGCCTTCCCTCGTATAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACTTTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACCGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATCAAGGAGCATCCGTTGATTTAGCAATTTTCTCCTTACATCTTGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTATTACTTTTACTTTCTTTACCTGTTTTAGCTGGAGCTATCACAATATTATTAACCGATCGAAACTTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 84–85 (genitalia Fig. 783–784), bears the following six printed rectangular labels, five white: [ PANAMA-C.Z. | Farfan | 6 Oct. 1975 | leg.S.S. Nicolay ], [ DNA sample ID: | NVG-17097G01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G01 | c/o Nick V. Grishin ], [ genitalia | NVG241118–13 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913350 ], and one red [ HOLOTYPE ♂ | Telegonus (Telegonus) | alco Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 4♂♂: Panama: 1♂ NVG-17097G02, USNMENT 00913351 Panama Province, Paraiso, 9.0333, –79.6333, 2-Jul-1977, G. B. Small leg. [USNM] and 1♂ NVG-17097G03, USNMENT 00913352 Veraguas Province, Balleria, 1–3-Jan-1979, G. B. Small leg. [USNM]; 1♂ NVG-14111A06 Ecuador, Orellana, Yasuní Research Station, Rios Tivacuno and Tiputini, 220 m, GPS −0.6750, −76.3967, 25-Oct-1998, D. H. Ahrenholz leg. [USNM] (Fig. 86–87); and 1♂ NVG-14114A01 Venezuela, Yuracay, Hacienda Tropicale, ca. 10 km S San Felipe, 100–400 m, GPS 10.2917, −68.6667, 26-Jan-23-Feb-1993, G. Kareofelas and Witham leg. [LACM].

Type locality.

Panama: Panamá Oeste Province, near Playa Farfán, formerly known as “Farfan, Canal Zone.”

Etymology.

The name is formed from the name of its sister species, T. chalco, made shorter for this more northern species. The name is treated as a noun in apposition.

Distribution.

Panama to Ecuador.

Telegonus (Telegonus) loretus Grishin, new species

https://zoobank.org/BED9038C-CEB3-4C7C-B49B-8B6D1DFCEF6E

(Fig. 3 part, 88–89, 785–787)

Definition and diagnosis.

Genomic analysis of Telegonus (Telegonus) fulgerator (Walch, 1775) (type locality in Suriname) relatives reveals that a specimen from Loreto, Peru, is a sister in the Z chromosome tree to nearly all other species from the group (Fig. 3), and therefore represents a new species. This new species keys to “Astraptes fulgerator fulgerator” (C.14.2(b)) in Evans (1952), but differs from it and other relatives by the following combination of characters: four subapical forewing spots of different sizes; broad spots in the forewing central band with a diamond-shaped (nearly equal four sides) spot in cell CuA₁-CuA₂; the spot in cell CuA₂-1A+2A is triangular and offset distad from the band, not overlapping with the spot above it; the basal third of the wings on the dorsal side is scaled with aquamarine; the white area on the ventral hindwing is triangular, does not reach half of the costal margin length, with broad brown basal scaling occupying a third of the area; the ventral forewing has a round pale spot occupying about a quarter of the cell CuA₁-CuA₂ closer to the tornus; the ventral side of the body is covered with pale yellow-orange scales; the uncus arms are nearly parallel to each other in dorsal view and shorter than in other species; the basal process of the harpe by the ampulla is longer and more robust, the ampulla is more prominent; and the valva is broader. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly890.5.2:G36T, aly890.5.2:G39A, aly6286.5.7:G233A, aly6286.5.7:G310T, aly276634.2.3:T168G, aly172.5.6:G48G (not A), aly1487.2.10:T96T (not C), aly318.42.3:T45T (not C), aly172.5.6:C54C (not T), aly2275.8.30:G118G (not T); and COI barcode: T91A, T157C, A181T, T382C, T436A, T574A.

Barcode sequence of the holotype.

Sample NVG-14104A10, GenBank PV972388, 658 base pairs:

AACCCTATATTTTATTTTTGGAATTTGAGCAGGACTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCATTAATTGGAGATGACCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGACTAGTTCCATTAATAATAGGTGCCCCAGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTATTACCTCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCAAATATTGCTCATCAAGGAGCATCTGTCGATTTAGCAATTTTTTCCCTTCATCTTGCTGGTATCTCATCAATTCTTGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAACTTATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 88–89 (genitalia Fig. 785–787), bears the following five printed rectangular labels, four white: [ PERU: Loreto Dept. | Pebas 1200 m. | 03°19’S, 71°51’W | 22 May 2003 | J.J. Ramirez, coll. ], [ DNA sample ID: | NVG-14104A10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119F06 | c/o Nick V. Grishin ], [ genitalia | NVG240817–57 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Telegonus (Telegonus) | loretus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Loreto Region, Pebas, elevation 1200 m, approx. GPS −3.3167, −71.8500.

Etymology.

The name is derived from the Peruvian department of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northeastern Peru.

Telegonus (Telegonus) tenebricus Grishin, new species

https://zoobank.org/EE679DB9-87C2-4166-A9DE-7ABBA5882821

(Fig. 3 part, 90–91, 788–790)

Definition and diagnosis.

Genomic analysis of Telegonus (Telegonus) fulgerator (Walch, 1775) (type locality in Suriname) relatives reveals that specimens from southern Mexico (previously identified as T. azul) form a clade (in the Z chromosome tree) sister to several other species from the group, including both T. fulgerator and Telegonus (Telegonus) azul (Reakirt, [1867]) (type locality in Mexico: Veracruz) (Fig. 3), and therefore represent a new species. This new species keys to “Astraptes fulgerator azul” (C.14.2(a)) in Evans (1952), but differs from it and other relatives by the following combination of characters: rounder hindwing with more convex outer margin; four subapical forewing spots, three of about equal size, the one near the costa being smaller; narrow spots in the forewing central band more closely aligned with each other with an hourglass-shaped spot in cell CuA₁-CuA₂; spot in cell CuA₂-1A+2A is dot-like on the dorsal side and is aligned with the band, fully overlapping with the spot above it; basal third of forewings and a quarter of hindwings on the dorsal side are scaled with shiny pale blue; white area on the ventral hindwing is C-shaped, reaches half of the costal margin length, with brown basal scaling as a streak anteriorly framed with yellowish, occupying a third of the area; ventral forewing is brown in the cell CuA₁-CuA₂ except for the postdiscal band spot; ventral side of the body is covered with pale yellow-orange scales; uncus arms are divergent from the base in dorsal view, turning nearly parallel near their ends; basal process of harpe by the ampulla is narrower and less robust, the ampulla is less prominent; and the valva is narrower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1080.6.3:G145A, aly3616.3.1:A204G, aly5021.16.12:G135C, aly383.21.2:G1112A, aly383.21.2:T2712C; and COI barcode: C220C, C364C, T508C, T536T, C646C, however, due to low divergence and introgression, the barcode may not always distinguish this species from others.

Barcode sequence of the holotype.

Sample NVG-14082H01, GenBank PV972389, 658 base pairs:

AACCCTATATTTTATTTTTGGAATTTGAGCAGGACTAATTGGAACTTCCTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGTGCCCCAGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCAAATATCGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCCGGTATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTCTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATCTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 90–91, bears the following three rectangular labels (1^st handwritten, others printed), two white: [ PANTANTLA VER. | MEXICO 5–6-48 | COLL WEGENER ], [ DNA sample ID: | NVG-14082H01 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Telegonus (Telegonus) | tenebricus Grishin ]. Paratype: 1♂ 11-BOA-15610D02 (leg, DNA sequenced), NVG-24016B09 (abdomen, DNA stored) Mexico, Chiapas, 7.7 km SW of Ococingo, 3600’, 14-May-1987, C. J. Durden leg., genitalia NVG241220–03 (Fig. 788–790) [TMMC].

Type locality.

Mexico: Veracruz, “Pantantla” (i.e., Papantla).

Etymology.

In Latin, tenebricus means dark, dusky, or gloomy. The name refers to the darker aspect of this species, e.g., that lack of a paler area by the tornus of the ventral forewing. The name is an adjective.

Distribution.

Southern Mexico (Veracruz and Chiapas).

Telegonus (Telegonus) colombus Grishin, new species

https://zoobank.org/96CA06EE-C017-4550-A166-D026EFC57D5A

(Fig. 3 part, 92–93, 791–793)

Definition and diagnosis.

Genomic analysis of Telegonus (Telegonus) fulgerator (Walch, 1775) (type locality in Suriname) relatives reveals that a specimen from Meta, Colombia, is genetically differentiated from others at the species level (Fig. 3); e.g., its COI barcodes differ by at least 1.1% (7 bp), and therefore represents a new species. This new species keys to “Astraptes fulgerator azul” (C.14.2(a)) in Evans (1952), but differs from it and other relatives by the following combination of characters: three subapical forewing spots; broad spots in the forewing central band with a diamond-shaped (nearly equal four sides) spot in cell CuA₁-CuA₂; spot in cell CuA₂-1A+2A is triangular and offset distad from the band, not overlapping with the spot above it; basal third of forewings and a quarter of hindwings on the dorsal side are scaled with shiny pale blue; white area on the ventral hindwing is triangular, does not reach half of the costal margin length, with broad brown basal scaling occupying a third of the area; ventral forewing with a trapezoidal pale spot occupying about a quarter of the cell CuA₁-CuA₂ closer to its outer margin; ventral side of the body is covered with pale orange-yellow scales; in dorsal view, uncus arms are nearly parallel at the base and converging towards their ends; unusual gnathos with margin bent nearly at a right angle in lateral view; basal process of harpe by the ampulla is broader and more robust, the ampulla is less prominent, flattened; and the valva width is typical for the group. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly172.8.13:T94C, aly1445.6.2:C54T, aly259.27.8:G42A, aly1531.12.14:G57T, aly1531.12.14:G63C, aly1937.23.9:C67C (not A), aly327.3.3:T109T (not C), aly1080.1.22:C117C (not T), aly173.56.11:A27A (not T), aly7472.1.1:T96T (not C); and COI barcode: C5T, C49C, T106C, T217A, A466G.

Barcode sequence of the holotype.

Sample NVG-8083, GenBank PV972390, 658 base pairs:

AACCTTATATTTTATTTTTGGAATTTGAGCAGGACTAATTGGAACTTCCTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCAAATATCGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCTGGTATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGCGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATCTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 92–93 (genitalia Fig. 791–793), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ COLOMBIA: Meta | Rio Negro, 800 m. | 5–7 Feb ‘69 | leg. S. S. Nicolay ], [ DNA sample ID: | NVG-8083 | c/o Nick V. Grishin ], [ genitalia | NVG170208–68 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321923 ], and one red [ HOLOTYPE ♂ | Telegonus (Telegonus) | colombus Grishin ].

Type locality.

Colombia: Meta Department, Río Negro, elevation 800 m.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in eastern Colombia.

Telegonus (Telegonus) argentinus Grishin, new species

https://zoobank.org/435619C8-9D72-440F-A06C-B478250741CE

(Fig. 3 part, 94–95, 794–796)

Definition and diagnosis.

Genomic analysis of Telegonus (Telegonus) fulgerator (Walch, 1775) (type locality in Suriname) relatives reveals that specimens from Argentina and South Brazil are genetically differentiated from others at the species level (Fig. 3); e.g., their COI barcodes differ by at least 1.7% (11 bp), and therefore represent a new species. This new species keys to “Astraptes fulgerator fulgerator” (C.14.2(b)) in Evans (1952), but differs from it and other relatives by the following combination of characters: three subapical forewing spots with the spot closer to the costa being the largest; medium-broad spots in the forewing central band with a rectangular (about twice as long as wide) spot in cell CuA₁-CuA₂; spot in cell CuA₂-1A+2A is triangular and offset distad from the band, touching the spot above it; basal third of the wings on the dorsal side is scaled with aquamarine; white area on the ventral hindwing is triangular, does not reach half of the costal margin length, with broad brown basal scaling occupying a third of the area; the ventral forewing with a rectangular pale spot overscaled with brown occupying about a fifth to sixth of the cell CuA₁-CuA₂ closer to the tornus; ventral side of the body is covered with pale yellow scales; uncus arms are nearly parallel at the base and converging towards their ends, somewhat longer than in other species; basal process of harpe by the ampulla is rounded, knob-like, the ampulla is less prominent; and the valva is narrower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1379.11.3:A57G, aly1379.11.3:T84C, aly515.3.1:G612T, aly515.3.1:A667C, aly2096.46.1:T378C; and COI barcode: A79T, T136C, C220T, C235T, T247C, 646C.

Barcode sequence of the holotype.

Sample NVG-17109F08, GenBank PV972391, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGTACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTCCCATTAATAATAGGTGCTCCAGATATAGCTTTTCCCCGTATAAACAATATAAGATTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATCGTTGAAAATGGGGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCCAACATTGCCCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATCTTGCTGGTATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTCTTAGCAGGTGCTATTACTATATTATTAACAGACCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM), illustrated in Fig. 94–95, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ ARGENTINA:Misiones | Garuápe | 26.80°S, 54.97°W | 16 Sept. 1998 ], [ Astraptes fulgerator | (Walch) | det.Brian Harris 2002 ], [ DNA sample ID: | NVG-17109F08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Telegonus (Telegonus) | argentinus Grishin ]. Paratypes: 2♂♂: 1♂ NVG-8070 Brazil, Santa Catarina, Sao Bento do Sul, 850 m, GPS −26.2833, −49.4167, 4-Feb-1989, Rank leg., genitalia NVG170208–55 (Fig. 794–796) [USNM] and 1♂ NVG-14113G02 Argentina, Misiones, Posadas, GPS −27.38, −55.88, 10-Oct-1998 [LACM].

Type locality.

Argentina: Misiones Province, Garuhapé, GPS −26.80, −54.97.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

South Brazil and Argentina.

Telegonus (Telegonus) chuchuvis Grishin, new species

https://zoobank.org/ABD40998-8F79-4BBB-AECC-3D95B147FD71

(Fig. 3 part, 96–97, 797–799)

Definition and diagnosis.

Genomic analysis of Telegonus (Telegonus) fulgerator (Walch, 1775) (type locality in Suriname) relatives reveals that specimens from northern Ecuador form a clade sister to Telegonus (Telegonus) azul (Reakirt, [1867]) (type locality in Mexico: Veracruz) and are genetically differentiated from it at the species level in the nuclear genome (Fig. 3) (but their COI barcodes do not differ by more than a couple of base pairs), and therefore represent a new species. This new species keys to “Astraptes fulgerator azul” (C.14.2(a)) in Evans (1952), but differs from it and other relatives by the following combination of characters: four subapical forewing spots of different sizes; medium-broad spots in the forewing central band closely aligned with each other and with a rectangular (about twice as long as wide) spot in cell CuA₁-CuA₂; spot in cell CuA₂-1A+2A is triangular and is aligned with the band, nearly fully overlapping with the spot above it; basal quarter of forewings and fifth of hindwings on the dorsal side are scaled with blue (violet-tinted); white area on the ventral hindwing is triangular, does not reach half of the costal margin length, with brown basal scaling forming a rectangle at the base anteriorly framed with yellowish scales; the ventral forewing with a roundish pale spot overscaled with brown occupying about a fifth to sixth of the cell CuA₁-CuA₂ closer to the tornus; ventral side of the body is covered with pale orange-yellow scales; uncus arms are nearly parallel at the base and converging towards their ends; basal process of the harpe by the ampulla is medium width and height compared to other species, harpe with more convex dorsodistal margin directing the process partly posteriad, left ampulla is less prominent and flattened, the right ampulla is knob-like and more strongly sclerotized; and the valva width is typical for the group. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly31.7.2:C135A, aly31.7.2:G183A, aly2275.2.4:C70T, aly173.85.1:C26T, aly6423.1.5:C74G; and COI barcode: C220T, T536C, however, due to low divergence and introgression, the barcode may not always distinguish this species from others.

Barcode sequence of the holotype.

Sample NVG-8077, GenBank PV972392, 658 base pairs:

AACCCTATATTTTATTTTTGGAATTTGAGCAGGACTAATTGGAACTTCCTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGTGCTCCAGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCAAATATCGCTCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCCGGTATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTCTGAGCTGTAGGAATTACAGCATTATTACTATTACTTTCATTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATCTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 96–97 (genitalia Fig. 797–799), bears the following five printed rectangular labels, four white: [ ECUADOR: Esmeraldas: | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800900m | 0° 53.01’ N 78° 30.90’ W | IX.2001 I.Aldas leg. ], [ DNA sample ID: | NVG-8077 | c/o Nick V. Grishin ], [ genitalia | NVG170208–62 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321917 ], and one red [ HOLOTYPE ♂ | Telegonus (Telegonus) | chuchuvis Grishin ]. Paratypes: 2♀♀ from Ecuador, Esmeraldas [EBC]: NVG-18065C02 the type locality, Mar-2011, I. Aldas leg. and NVG-18065C01 Chuchuví, “Durango”, 500–800 m, Apr-2011, ex coll. M. Büche.

Type locality.

Ecuador: Esmeraldas Province, Río Chuchuví, km 12.5 Lita-San Lorenzo road, elevation 800–900 m, GPS 0.8835, −78.5150.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the type locality in northern Ecuador.

Telegonus (Rhabdoides) lesus Grishin, new species

https://zoobank.org/D1D4CDBF-824E-4087-AD00-4E5066CC2877

(Fig. 3 part, 98–99, 800–802)

Definition and diagnosis.

Genomic sequencing of a specimen from Colombia initially identified as Telegonus (Rhabdoides) galesus (Mabille, 1888) (type locality Peru: Chanchamayo), reveals that it is sister to Telegonus (Rhabdoides) subflavus Grishin, 2022 (type locality Ecuador: Riobamba) but is genetically differentiated from it at the species level (Fig. 3); e.g., their COI barcodes differ by 1.7% (11 bp), and therefore represents a new species. This species keys to “Astraptes galesus galesus” (C.14.33(b)) in Evans (1952), who included it within this taxon, but differs from it and other relatives by darker appearance without strong ocherous overscaling on both sides of the wings, broader brown bands on the dorsal forewing, a rather pointed (not broadly rounded) distal end of harpe, a longer and narrower basal process of harpe by the ampulla, which is more robust, and a more concave ventral margin of valva. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2284.22.2:A3327G, aly74519.1.1:A34C, aly74519.1.1:C59T, aly798.33.55:C24T, aly1857.6.1:T45C; and COI barcode: T70C, T304C, T367C, A526T, T596C.

Barcode sequence of the holotype.

Sample NVG-22107A01, GenBank PV972393, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACCGAATTAGGAACCCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCTCTAATAATAGGAGCCCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCACCAAGGAACATCCGTTGACTTAGCAATTTTTTCATTACATCTTGCTGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACTGCATTACTATTATTACTTTCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATCTAAACACTTCATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATCTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 98–99 (genitalia Fig. 800–802), bears the following ten printed (text in italics handwritten) rectangular labels, nine white: [ Colombia S. A | La Estrella | Antioquia (1800) ], [ rec’d from | J.E.Foerster ], [ Collection of | C.D.MacNeill ], [ Astraptes galesus | galesus (Mab.) | Det. C.D. MacNeill ‘89 ], [ ] (no text, antenna and antennal club are glued to this label), [ DNA sample ID: | NVG-22107A01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D08 | c/o Nick V. Grishin ], [ genitalia | NVG241114–03 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8568536 ], and one red [ HOLOTYPE ♂ | Telegonus (Rhabdoides) | lesus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Colombia, S. R. and L. M. Steinhauser leg. [MGCL]: 1♀ NVG-24073H12 Valle del Cauca, Rio Calima, below dam, 300 m, 24-Jan-1976, genitalia SRS-850 and 1♂ NVG-24064B07 Tolima, Quebrada Lindosa, Río San Fernando, 2000 m, 2-Jun-1974, genitalia SRS-849.

Type locality.

Colombia: Antioquia Department, La Estrella.

Etymology.

The name is formed from the name of its similar-looking relative, T. galesus, made shorter for this more northern species. The name is treated as a noun in apposition.

Distribution.

Currently known only from Colombia.

Telegonus (Rhabdoides) fortis Grishin, new species

https://zoobank.org/E5F9E32C-1B49-49E9-A5F7-D8F557ED6948

(Fig. 3 part, 100–101, 803–808)

Definition and diagnosis.

Genomic analysis of specimens we identified as Telegonus (Rhabdoides) anausis annetta (Evans, 1952) (type locality in Costa Rica) and their comparison with all other known close relatives of Telegonus (Rhabdoides) anaphus (Cramer, 1777) (type locality in Suriname) reveals three clades genetically differentiated from each other and T. anaphus with Telegonus (Rhabdoides) anausis Godman and Salvin, 1896 (type locality in St. Vincent, Grenada, Dominica, and Hispaniola) that represent three new species (Fig. 3). Each of the three species keys to “Astraptes anaphus annetta” (C.14.34(a)) in Evans (1952) and was placed by him within this taxon. The first, and the northernmost, new species differs from others by the following combination of characters: a more robust, wider in lateral view, and more prominently serrated dorsal segment of the harpe, which is evenly convex along the serrated margin towards the ampulla, where the anterior margin of the harpe is nearly straight, not noticeably concave; the ampulla is typically more robust and the costa of the left valva is more strongly convex anteriad of the ampulla; the tegumen is not humped at the junction with the uncus in lateral view; and the phallobase is curved more strongly. As a result of the significant variation within the type series, we are not able to distinguish this species by facies. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly594.10.17:A129G, aly3415.2.4:A21C, aly3415.2.4:C73G, aly1849.16.20:G54T, aly3125.6.3:A105G; and COI barcode: T106C, T115C, A127C, A205C, T403C, T571C.

Barcode sequence of the holotype.

Sample NVG-14111E06, GenBank PV972394, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGTGATGACCAAATTTACAATACTATTGTCACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCTTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTCTCACTCCATCTTGCCGGTATCTCATCTATTCTTGGTGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGGGCAGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATCACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 100–101, bears the following five printed (text in italics handwritten) rectangular labels, four white: [ TEXAS: | Hidalgo County | McAllen ], [ coll. 18-X-73 | William W. & | Nadine M. McGuire ], [ HESPERIIDAE, | Pyrginae: | Astraptes anaphus | annetta Evans, 1952 | ♀ det. R.O. Kendall | M. & B. No. 39a ], [ DNA sample ID: | NVG-14111E06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Telegonus (Rhabdoides) | fortis Grishin ]. Paratypes: 4♂♂ and 2♀♀: Mexico: 1♂ NVG-23069B11 (leg, DNA sequenced), NVG-24105H11 (abdomen, DNA stored) San Luis Potosí, El Salto Falls, 17-Nov-1974, Roy O. Kendall and C. A. Kendall leg., genitalia NVG250720–60 (Fig. 803–805) [TAMU]; 1♂ NVG-15117A09, CSU_ENT1037148 Sinaloa, Concordia, Panuco Rd off Hwy 40, 22–26-Nov-2003, P. A. and E. M. Opler leg. [CSUC]; 1♀ NVG-15117A08, CSU_ENT1037153 Jalisco, Puerto Vallarta, Boca de Tomatlan, 20 km W of Puerto Vallart on Mexico Hwy 200, 1-Jan-1994, Andrew D. Warren leg. [CSUC]; 1♂ NVG-15117A06, CSU_ENT1037158 Oaxaca, Candelaria Loxicha, 500 m, 14-Oct-1983, R. E. Stanford leg. [CSUC]; 1♀ NVG-14113F05 Veracruz, 13 km W Santiago de Tuxtle, RT180, 9-Apr-1977, E. C. Olson leg. [LACM]; and 1♂ NVG-19075D11 (leg, DNA sequenced), NVG-23119G02 (abdomen, DNA stored), USNMENT 01588581 Panama, Bocas del Toro, Trocha 3 de Noviembre, 320 m, 6-Jan-1977, G. B. Small leg., genitalia NVG241118–14 (Fig. 806–808) [USNM].

Type locality.

USA: Texas, Hidalgo Co., McAllen.

Etymology.

In Latin, fortis means strong, robust, or sturdy. The name refers to the more robust harpe of this species and is an adjective.

Distribution.

From the lower Rio Grande Valley in Texas, USA, throughout Mexico and Panama.

Comment.

Both T. anausis annetta and this new species have been recorded from South Texas and are sympatric.

Telegonus (Rhabdoides) occultus Grishin, new species

https://zoobank.org/F108246F-DDDD-464D-85F4-807A353C43E2

(Fig. 3 part, 102–103, 809–811)

Definition and diagnosis.

Genomic analysis of specimens we identified as Telegonus (Rhabdoides) anausis annetta (Evans, 1952) (type locality in Costa Rica) and their comparison with all other known close relatives of Telegonus (Rhabdoides) anaphus (Cramer, 1777) (type locality in Suriname) reveals three clades genetically differentiated from each other and T. anaphus with Telegonus (Rhabdoides) anausis Godman and Salvin, 1896 (type locality in St. Vincent, Grenada, Dominica, and Hispaniola) that represent three new species (Fig. 3). Each of the three species keys to “Astraptes anaphus annetta” (C.14.34(a)) in Evans (1952) and was placed by him within this taxon. The second new species is sister to the previous one and its male genitalia are similar to the previous new species but have a less robust dorsal end of the harpe that is narrower in lateral view, with a straight dorsoposterior margin, which is slightly serrated and a more concave anterior margin; the ampulla is less robust with a smoother transition to the costa anteriad on the left valva, thus the costa is less convex at the junction; the tegumen is slightly humped at the junction with the uncus in lateral view; and the phallobase is less curved. As a result of the significant variation within the type series, we are not able to distinguish this species by facies. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2508.11.2:C341G, aly2508.11.2:C444G, aly596.7.1:G123T, aly1610.2.2:G256A, aly1610.2.2:G288A. The COI barcode does not distinguish this species from some others, likely due to introgression.

Barcode sequence of the holotype.

Sample NVG-15117A07, GenBank PV972395, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGTGATGATCAAATTTATAACACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCACACCAAGGAGCATCTGTTGATTTAGCAATTTTCTCCCTTCATCTTGCTGGTATCTCATCTATTCTTGGTGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCCGTTTTAGCTGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGACCCAATTTTATATCAACACCTATTT

Type material.

Holotype: ♂ deposited in the Colorado State University Collection, Fort Collins, CO, USA (CSUC), illustrated in Fig. 102–103, bears the following five printed rectangular labels, four white: [ Candelaria Loxicha | Oaxaca, MEX 500m | 3 Sep 1982 ECW ], [ Barcode of Life | DNA voucher specimen | CSUPOBK-1091 ], [ DNA sample ID: | NVG-15117A07 | c/o Nick V. Grishin ], [ CSU_ENT | 1037157 ], and one red [ HOLOTYPE ♂ | Telegonus (Rhabdoides) | occultus Grishin ]. The holotype was collected by E. C. Welling. Paratypes: 5♂♂ and 1♀: Mexico: 1♂ NVG-19124B07 (leg, DNA sequenced), NVG-24016B10 (abdomen, DNA stored) San Luis Potosí, Mpio. Tamazunchale, Quinta Chilla, 500’, 12-Jul-1988, J. Kemner leg., genitalia NVG241220–04 (Fig. 809–811) [TMMC] and 1♀ NVG-15117A11, CSU_ENT1037142 Chiapas, Unión Juárez, San Jeronimo, 12-Jun-1979, E. C. Welling leg. [CSUC]; 1♂ NVG-18087D12 Colombia, Valle del Cauca, Río Aguacatal, 200 m, old [ca. 1900], Coll. Fassl. [ZfBS]; Ecuador: 1♂ NVG-19075E05, USNMENT 01588587 Esmeraldas, Rio Chuchuví, km 12.5 Lita-San Lorenzo Rd., 800–900 m, GPS 0.8835, −78.5150, Mar-2001, I. Aldas leg. [USNM] and 1♂ NVG-19075E06, USNMENT 01588588 Pichincha, Tinalandia, 16 km E Santo Domingo de los Colorados, 600 m, 5–11-May-1990, R. H. Leuschner leg. [USNM]; and 1♂ NVG-19075E02, USNMENT 01588584 Venezuela, Caracas, old [ca. 1900], Edw. T. Owen collection [USNM].

Type locality.

Mexico: Oaxaca, Candelaria Loxicha, elevation 500 m.

Etymology.

In Latin, occultus means cryptic, hidden, or concealed. The name refers to the cryptic nature of this species and is an adjective. This species is also cryptic in its COI barcode sequence that is indistinguishable from T. anausis and some T. anaphus.

Distribution.

Mexico to Ecuador and Venezuela.

Telegonus (Rhabdoides) leptus Grishin, new species

https://zoobank.org/EE13BA88-7771-4CE7-B6CD-5EA641D4D962

(Fig. 3 part, 104–105, 812–814)

Definition and diagnosis.

Genomic analysis of specimens we identified as Telegonus (Rhabdoides) anausis annetta (Evans, 1952) (type locality in Costa Rica) and their comparison with all other known close relatives of Telegonus (Rhabdoides) anaphus (Cramer, 1777) (type locality in Suriname) reveals three clades genetically differentiated from each other and T. anaphus with Telegonus (Rhabdoides) anausis Godman and Salvin, 1896 (type locality in St. Vincent, Grenada, Dominica, and Hispaniola) that represent three new species (Fig. 3). Each of the three species keys to “Astraptes anaphus annetta” (C.14.34(a)) in Evans (1952) and was placed by him within this taxon. The third new species is sister to both T. anaphus and T. anausis, but differs from them and other relatives by the following combination of characters: the process of the ampulla on the right valva is narrower; the gap between the harpe and ampulla is wider, especially on the left valva, the dorsodistal corner of the ampulla is more rounded on both valvae, particularly notable on the left valva; the dorsal margin of the harpe is with a concavity along the serrated area near the gap; the tegumen is not humped at the junction with the uncus in lateral view; uncus arms are closer to each other and fused for longer distance at the base; and the phallobase is less curved. As a result of the significant variation within the type series, we are not able to distinguish this species by facies. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly291.11.18:C53T, aly291.11.18:C79G, aly1450.10.1:A750G, aly1450.10.1:G1194A, aly258728.1.1:C83T; and COI barcode: T169C, A217G, T412G, T430C, C553G.

Barcode sequence of the holotype.

Sample NVG-14111E08, GenBank PV972396, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGGGCCCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTTTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCACCAAGGAGCATCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCGGGTATTTCATCAATTCTCGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCGGTCTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAATCTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 104–105, bears the following five printed (text in italics handwritten) rectangular labels, four white: [ MEXICO: | San Luis Potosi | Ciudad de Valles | ca.10 mi E of | Hotel Taninul ], [ coll. | 30 Jan 1980 | Roy O. Kendall | & C. A. Kendall ], [ HESPERIIDAE, | Pyrginae: | Astraptes anaphus | annetta Evans, 1952 | ♂ det. R.O. Kendall | M. & B. No. 39a ], [ DNA sample ID: | NVG-14111E08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Telegonus (Rhabdoides) | occultus Grishin ]. Paratypes: 3♂♂ and 2♀♀: Mexico: San Luis Potosí [TAMU]: 1♂ NVG-14111H09 (leg, DNA sequenced), NVG-23068H12 (abdomen, DNA stored) Tamazunchale, 22-Mar-1954, genitalia NVG241118–15 (Fig. 812–814) and 1♀ NVG-23069B10 El Naranjo, 14-Feb-1976; 1♂ NVG-24074A07 Hidalgo, Huajuntla, 26-Oct-2000, E. C. Knudson collection [MGCL]; and 1♀ NVG-15117A10, CSU_ENT1037141 Sinaloa, Concordia, Chirimollos, 4200’, 29-Nov-4-Dec-2002, P. A. and E. M. Opler leg. [CSUC] and 1♂ NVG-18087C01 Guatemala, Alta Verapaz, San Cristóbal Verapaz, Baleu, 1350 m, 15-Jul-1966, E. C. Welling leg. [EBC].

Type locality.

Mexico: San Luis Potosí, Ciudad de Valles, ~10 mi east of Hotel Taninul.

Etymology.

In Greek, λεπτός (leptos) means thin, fine, delicate, or slender. The name refers to the less robust harpe and the process of the ampulla, and is treated as a noun in apposition.

Distribution.

Mexico (Sinaloa, San Luis Potosí) to Guatemala.

Autochton (Autochton) bocus (Plötz, 1882), Autochton (Autochton) dhega (Mabille, 1891), and Autochton (Autochton) agathokles (Ehrmann, 1918) are valid species distinct from Autochton (Autochton) neis (Geyer, 1832)

Genomic analysis of specimens identified as Autochton (Autochton) neis (Geyer, 1832) (type locality in Brazil) that key to “Autochton neis” (C.16.6) in Evans (1952) reveals several distinct clades genetically differentiated at the species level (Fig. 4). Moreover, A. neis, identified using Evans (1952), is not monophyletic, with some specimens being closer related to Autochton (Autochton) reflexus (Mabille and Boullet, 1912) (type locality in Brazil: Santa Catarina), while others are sister to Autochton (Autochton) dora Grishin, 2023 (type locality in Ecuador) in the nuclear genome tree (Fig. 4). Therefore, “A. neis” is a complex consisting of several species. Four of them have names, and four are new, described below. Specimens from southern Brazil match best the original illustration of A. neis in their wing patterns (e.g., better aligned spots in the hyaline discal forewing band that has straighter margins as a result, the presence of a spot in cell M₃-CuA₁ completely joined with the hyaline discal forewing band, hindwing fringes are white in mid-termen only, rather broad near tornus with a rounded tornal spot), and we identify them as A. neis, suggesting that the type locality of this species may be in Rio de Janeiro. The holotype of Spathilipia [sic] agathokles Ehrmann, 1918 (type locality Venezuela: Suapure, NVG-15095B04) falls in a clade with specimens from Guyana (Fig. 4 blue) and differs from A. neis by 2.3% (15 bp) in COI barcode. A syntype of Cecropterus bocus Plötz, 1882 (type locality in Brazil: Pará) is in the clade with specimens from the Amazonian region, including a “syntype” from Suriname of Cecropterus bocus Möschler, 1877, a nomen nudum (Fig. 4 green), that is closer related to A. dora and differs from it by 1.2% (8 bp) in COI barcode. The difference is smaller than expected from the nuclear genome (Fig. 4a), possibly due to introgression. Finally, specimens from Mexico, including one from Veracruz, were identified by us as Cecropterus dhega Mabille, 1891 (type locality Mexico: Veracruz, Xalapa) (Fig. 4 purple) and they represent the 4^th species, closest to C. bocus, differing from it by 1.2% (8 bp) in COI barcode (the A. dora clade species share similar barcodes). Therefore, we propose that Autochton (Autochton) bocus (Plötz, 1882), reinstated status, Autochton (Autochton) dhega (Mabille, 1891), reinstated status, and Autochton (Autochton) agathokles (Ehrmann, 1918), reinstated status, are valid species distinct from Autochton (Autochton) neis (Geyer, 1832). Remaining four species are described as new (Fig. 4, red clades in the clade sister to Autochton (Autochton) integrifascia (Mabille, 1891) (type locality in Brazil: São Paulo, and Rio Grande do Sul)).

Figure 4.

Phylogenetic trees of remaining selected Eudamina groups inferred from protein-coding regions in a) the Z chromosome, based on 453,747 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Autochton (Autochton) xaca Grishin, new species

https://zoobank.org/984330A6-63D1-4FE3-BC53-1B1CE756B022

(Fig. 4 part, 106–107, 815–816)

Definition and diagnosis.

In the nuclear genome tree, this new species is sister to three others Autochton (Autochton) bocus (Plötz, 1882), reinstated status, (type locality in Brazil: Pará), Autochton (Autochton) dhega (Mabille, 1891), reinstated status, (type locality Mexico: Veracruz, Xalapa), and a new species described next (Fig. 4). It keys to “Autochton neis” (C.16.6) in Evans (1952) and was included by him in that taxon. It differs from its relatives by the following combination of characters: hyaline spots are better aligned in the forewing discal band than in other species, but not as close as in A. neis, the spot in the cell M₃-CuA₁ is either absent or very small compared to the width of the band (when present, it is completely detached from the band or only in contact with the spot in the cell CuA₁-CuA₂), subapical spots are smaller, the hindwing postdiscal dark band is broader, the ampulla has a more prominent hump, the harpe is broader, its distal margin lacks a concavity, the dorsal end is rounded and broader than in all other relatives. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly437.6.1:T486C, aly1847.4.2:C62T, aly12671.2.1:G126A, aly767.7.2:G588T, aly1019.2.2:A114T; and COI barcode: T10C, T358C, T400C, T499C, T562A.

Barcode sequence of the holotype.

Sample NVG-19119B11, GenBank PV972397, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCAGGATTAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCCTTCCCACGTATAAATAATATAAGATTTTGACTATTACCCCCATCTTTAACTCTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCACCTCTTTCTTCTAACATTGCCCATCAAGGAGCTTCCGTAGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCCTTATTTGTATGAGCCGTTGGAATTACAGCTCTTCTTCTTTTACTTTCTTTACCTGTTCTAGCAGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 106–107 (genitalia Fig. 815–816), bears the following seven rectangular labels (first two handwritten, others printed), six white: [ Mex:Oaxaca:2mi.N. | Candelaria-22 Oct.1988 | John Kemner ], [ Autochton ♂ | neis | Geyer | det.H.A.Freeman ], [ DNA sample ID: | NVG-19119B11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032C09 | c/o Nick V. Grishin ], [ genitalia | NVG241118–16 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602620 ], and one red [ HOLOTYPE ♂ | Autochton (Autochton) | xaca Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 2♀♀ from Mexico, Oaxaca: 1♂ NVG-23068C07 data as the holotype, except the date given as 22, 23, 25-Oct-1988 [TMMC]; 1♀ NVG-19119G06, USNMENT 01602669 Candelaria Loxicha, 20-Aug-1972 [USNM]; and Sierra Madre del Sur, J. Kemner leg. [TMMC]: 1♂ NVG-23068C06, La Soledad-Buena Vista, 5000’, 14-Apr-1990 [TMMC] and 1♀ NVG-23068C08 3 mi S San Miguel Suchixtepec, ~8200’, 16-Apr-1990.

Type locality.

Mexico: Oaxaca, 2 mi north of Candelaria Loxicha.

Etymology.

The name is derived from the type locality in [Oa]xaca and is treated as a noun in apposition.

Distribution.

Currently recorded from Oaxaca in Mexico.

Autochton (Autochton) nama Grishin, new species

https://zoobank.org/1E2CAD6E-7513-4B61-AEDE-2D357415D1F0

(Fig. 4 part, 108–109, 817–818)

Definition and diagnosis.

In the Z chromosome tree, this new species is sister to Autochton (Autochton) bocus (Plötz, 1882), reinstated status, (type locality in Brazil: Pará) and is genetically differentiated from it at the species level (Fig. 4); e.g., their F_st/G_min/COI barcode difference are 0.21/0.016/1.2% (8 bp). It keys to “Autochton neis” (C.16.6) in Evans (1952) and was included by him in that taxon. It differs from its relatives by the following combination of characters: hyaline spots are more strongly separated from each other in the forewing discal band, the spot in the cell M₃-CuA₁, not fused with the band but in contact with the spot in the cell CuA₁-CuA₂, is typically well developed compared to the width of the band, subapical spots are larger, the hindwing postdiscal dark band is narrower, the ampulla has a more prominent hump, the harpe is medium in size compared to other species, its distal margin is concave, the dorsal end is rounded, process-like, and broader than in other relatives, except the new species described above. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly517.15.2:G1151A, aly517.15.2:T1200A, aly6377.1.2:T3693G, aly6377.1.2:G294C, aly2275.5.2:G241T; and COI barcode: T266C, T355C, T403C, A412A, A565G.

Barcode sequence of the holotype.

Sample NVG-19119C01, GenBank PV972398, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGATTAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAACTAGGAACACCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCCTTCCCACGAATAAATAATATAAGATTCTGACTACTACCTCCATCATTAACTCTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTATCCCCCTCTTTCTTCCAATATTGCTCATCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTCTCCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCTCTTCTTCTTTTACTTTCTTTACCAGTTCTAGCTGGGGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTCTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 108–109 (genitalia Fig. 817–818), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ Farfan | CANAL ZONE | 8 Oct. ‘75 | S. S. Nicolay ], [ Autochton | neis ♂ | Det. | S.S. Nicolay ], [ DNA sample ID: | NVG-19119C01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032C10 | c/o Nick V. Grishin ], [ genitalia | NVG241118–17 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602622 ], and one red [ HOLOTYPE ♂ | Autochton (Autochton) | nama Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 4♂♂ Panama [USNM]: 1♂ NVG-19119C02, USNMENT 01602623 Panamá Oeste, Cocolí, 20-Oct-1962, genitalia H502 S.S. Nicolay and 1♂ NVG-14062F10 Darien, Cana (Cerro Pirre), 400 m, GPS 7.9333, −77.5667, 3-Aug-1981, G. B. Small leg., genitalia x-4093 J.M.Burns 1995 and Colombia [MFNB]: 1♂ NVG-21115A01 no locality details, 1877 and 1♂ NVG-23078G06 Santander Department, Cayumba, 4-Feb-1921, A. Schultze leg., http://coll.mfn-berlin.de/u/c759f0

Type locality.

Panama: Panamá Oeste Province, near Playa Farfán, formerly known as “Farfan, Canal Zone.”

Etymology.

The name is the last two syllables of the country of the type locality and is treated as a noun in apposition.

Distribution.

Panama and Colombia.

Autochton (Autochton) pacovena Grishin, new species

https://zoobank.org/9C9F0BBA-9457-46B6-9D1D-D6B8E5374948

(Fig. 4 part, 110–111, 819–820)

Definition and diagnosis.

This new species is closely related to Autochton (Autochton) agathokles (Ehrmann, 1918), reinstated status, (type locality Venezuela: Suapure) (e.g., their COI barcode difference is 1.7% (11 bp) and to a new species described next (Fig. 4). It keys to “Autochton neis” (C.16.6) in Evans (1952) and was included by him in that taxon. It differs from its relatives by the following combination of characters: hyaline spots are better aligned in a broader forewing discal band, the spot in the cell M₃-CuA₁ is typically small or absent (when present, it is fused with the discal band as in A. neis), subapical spots are smaller, the hindwing postdiscal dark band is narrower, the ampulla has a less prominent hump, the harpe is narrower, its distal margin is concave, the dorsal end is rounded but narrower, process-like, and the distal-ventral angle of the harpe is sharper. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2127.4.2:G45T, aly3516.5.3:G312A, aly3516.5.3:A315T, aly1500.5.8:G36A, aly1500.5.8:G51A; and COI barcode: T59T, T172C, A184G, A316A, T400T, T406C, T581C.

Barcode sequence of the holotype.

Sample NVG-19119G03, GenBank PV972399, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGATTAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAACTAGGAACACCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGGTTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTCTGATTATTACCCCCATCATTAACTCTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTATCCACCTCTTTCTTCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCTCTTCACTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCTCTTCTTCTTTTACTTTCTTTACCTGTTCTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 110–111 (genitalia Fig. 819–820), bears the following six printed rectangular labels, five white: [ VENEZUELA: Zulia; | El Tucuco, Sierra de | Perija,28–29 I 1978 | montane forest,black- | light, J.B.Heppner ], [ DNA sample ID: | NVG-19119G03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032C07 | c/o Nick V. Grishin ], [ genitalia | NVG241118–18 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602666 ], and one red [ HOLOTYPE ♂ | Autochton (Autochton) | pacovena Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 4♀♀ in USNM: 1♀ NVG-19119E06, USNMENT 01602649 Costa Rica, Turrialba, 5-May-1951, O. L. Cartwright leg., genitalia X-519 J.M.Burns 1978; Panama, Darien, Cana, G. B. Small leg.: 1♀ NVG-14062F11 Cerro Pirre, 950 m, GPS 7.9333, −77.7167, 6-Sep-1982, , genitalia X-4094 J.M.Burns 1995 and 1♀ NVG-19119H08, USNMENT 01602683 6-Jan-1984; and 1♀ NVG-19119C03, USNMENT 01602624 Colombia, Valle del Cauca, Anchicaya, 600 m, GPS 3.5500, −76.8833, 20–24-Jan-1992, J. Bolling Sullivan leg.

Type locality.

Venezuela: Zulia, El Tucuco, Sierra de Perija.

Etymology.

The name is a fusion: Pa[nama] + Co[lombia] + Ven[ezuel]a, and is treated as a noun in apposition.

Distribution.

Panama, Colombia, and Venezuela.

Autochton (Autochton) pera Grishin, new species

https://zoobank.org/FE2A270B-2DD3-4AEB-AD0B-B1DC308D157E

(Fig. 4 part, 112–113, 821–822)

Definition and diagnosis.

This new species is closely related to Autochton (Autochton) agathokles (Ehrmann, 1918), reinstated status, (type locality Venezuela: Suapure) (e.g., their COI barcode difference is 2.3% (15 bp) and to a new species described above (Fig. 4). It keys to “Autochton neis” (C.16.6) in Evans (1952) and was included by him in that taxon. It differs from its relatives by the following combination of characters: hyaline spots are more separated from each other in a broader forewing discal band, when present, the spot in the cell M₃-CuA₁ is small or of medium size, separated from the band but in contact with the spot in the cell CuA₁-CuA₂, subapical spots are larger, the hindwing postdiscal dark band is broader, the ampulla has a less prominent hump, the harpe is narrower, its distal margin is concave, the dorsal end is rounded, process-like, and constricted in the middle and the distal-ventral angle of the harpe is rounder. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly8774.1.15:C171T, aly8774.1.15:C1273A, aly1454.12.5:G75A, aly1454.12.5:C138T, aly1454.12.5:G141A; and COI barcode: T136C, 325T, T490T, A508G, T596C, T610C.

Barcode sequence of the holotype.

Sample NVG-19119C08, GenBank PV972400, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGATTAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAACTAGGAACACCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTCTGATTATTACCTCCATCATTAACTCTTTTAATTTCAAGTAGTATTGTAGAAAATGGGGCAGGAACTGGATGAACTGTTTATCCACCTCTTTCTTCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCTCTTCACTTAGCGGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTGTGAGCTGTTGGAATTACAGCTCTTCTTCTTTTACTTTCTTTACCTGTTCTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATCTAAATACTTCATTCTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 112–113, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PERU Madre De Dios | Rio La Torre 300m | Tambopata Res. | 28 Sept.’86 | S. S. Nicolay ], [ DNA sample ID: | NVG-19119C08 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602627 ], and one red [ HOLOTYPE ♂ | Autochton (Autochton) | pera Grishin ]. Paratype: 1♂ NVG-19124C02 (leg, DNA sequenced), NVG-24016B11 (abdomen, DNA stored) Peru, Madre de Dios, Laguna Sandoval, 3-Jun-1998, C. J. Durden leg., genitalia NVG241220–05 (Fig. 821–822) [TMMC].

Type locality.

Peru: Madre de Dios Region, Tambopata National Reserve, Río La Torre, elevation 300 m.

Etymology.

The name is derived from the country of the type locality: per[u]+a, and is treated as a noun in apposition.

Distribution.

Currently known from southeastern Peru.

Autochton (Autochton) colombianus Grishin, new species

https://zoobank.org/CC81CE71-89A2-4C1A-AA65-25BE585C58F6

(Fig. 4 part, 114–115, 823–824)

Definition and diagnosis.

Specimens from western Colombia initially identified as Autochton (Autochton) itylus Hübner, 1823 (type locality in Suriname) are genetically differentiated from it at the species level (Fig. 4); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore represent a new species. This new species keys to “Autochton itylus” (C.16.12) in Evans (1952), but differs from it by more strongly developed white scaling at the apex of the ventral hindwing and a longer stretch of white fringe in the area, a narrower and longer harpe, and a thinner and longer spike at the end of the harpe. This species does not seem to be cryptic, but due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly347.12.1:A1081G, aly430.6.1:G102C, aly430.6.1:G111A, aly490.12.9:G75T, aly490.12.9:A88C; and COI barcode: T25C, T118C, T250C, T367C, T394C.

Barcode sequence of the holotype.

Sample NVG-19119G09, GenBank PV972401, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGATTAGTAGGAACCTCATTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTCCCTCGTATAAATAACATAAGATTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCTAGAAGTATCGTAGAAAATGGTGCTGGAACAGGATGAACTGTTTATCCTCCTCTTTCATCTAATATTGCCCACCAAGGAGCTTCTGTTGATTTAGCAATCTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTCTTCTTTTATTACTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATCTTAATACCTCCTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATCTTTTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 114–115 (genitalia Fig. 823–824), bears the following six printed rectangular labels, five white: [ COLOMBIA:Chocó | Quibdo. 13 March 1976 | Leg. Gordon Small ], [ DNA sample ID: | NVG-19119G09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032C05 | c/o Nick V. Grishin ], [ genitalia | NVG241118–19 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01602672 ], and one red [ HOLOTYPE ♂ | Autochton (Autochton) | colombianus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Colombia: 1♂ NVG-19119E08, USNMENT 01602651 Valle del Cauca, Anchicaya, 600 m, GPS 3.5500, −76.8833, 20–24-Jan-1992, J. Bolling Sullivan leg. [USNM] and 1♀ NVG-19119G10, USNMENT 01602673 Chocó, Quibdo, 13-Mar-1976, G. B. Small leg. [USNM].

Type locality.

Colombia: Chocó Department, Quibdo.

Etymology.

The name is derived from the country of the type locality and is an adjective.

Distribution.

Colombia.

Autochton (Autochton) orontes (Plötz, 1882) is a valid species distinct from Autochton (Autochton) bipunctatus (Gmelin, [1790]) and Cecropterus zonilis Mabille, 1883 is its junior subjective synonym

Currently, Cecropterus orontes Plötz, 1882 (type locality Venezuela: La Guaira) is treated as a junior subjective synonym of Autochton (Autochton) bipunctatus (Gmelin, [1790]) (type locality in French Guiana). Genomic sequencing of a possible syntype of the former taxon and comparing it with several specimens from Panama, Colombia, and Venezuela reveals that they are genetically differentiated at the species level (Fig. 4); e.g., their COI barcodes differ by 1.8% (12 bp). Therefore, we propose that Autochton (Autochton) orontes (Plötz, 1882), reinstated status, is a valid species distinct from Autochton (Autochton) bipunctatus (Gmelin, [1790]). Cecropterus zonilis Mabille, 1883 (type locality in Colombia) has been regarded as a junior subjective synonym of A. bipunctatus, however, being from Colombia, it is more likely to be conspecific with A. orontes, and we place C. zonilis in synonymy with A. orontes.

Autochton (Autochton) bipunctaticus Grishin, new species

https://zoobank.org/96A73B8F-8780-43E4-A17E-512AF2450692

(Fig. 4 part, 116–117, 825–826)

Definition and diagnosis.

Genomic sequencing of specimens from southern Peru and Bolivia identified as Autochton (Autochton) bipunctatus (Gmelin, [1790]) (type locality in French Guiana) reveals that they are genetically differentiated from it at the species level (Fig. 4); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore they represent a new species. This new species keys to “Autochton bipunctatus” (C.16.10) in Evans (1952) and was included by him in this taxon, but differs from it and other relatives by the following combination of characters: the forewing discal band has a nearly straight or slightly undulated inner margin with all spots closely aligned, including a spot in the cell M₃-CuA₁ (the tornal spot is usually offset distad in A. bipunctatus); a dark spot near the costal margin on the ventral hindwing is offset distad from the basal dark band and is located in between the two bands; the postdiscal band is wider in the middle but narrowing more strongly at both ends; the harpe curves dorsad for about twice the height of the ampulla, nearly equal width towards the serrated dorsal margin; the ampulla is rounded, the costa is nearly straight, and the valva in length (from the base to the ampulla) is about twice its width. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3653.7.1:A225G, aly806.11.5:C324T, aly806.11.5:A417G, aly4305.32.1:C237T, aly4305.32.1:A2625G; and COI barcode: C40T, T187T, T463C, T547T, T641C.

Barcode sequence of the holotype.

Sample NVG-5748, GenBank PV972402, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCACACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGGTTATTACCTCCTTCTTTAACCTTATTAATTTCTAGAAGAATCGTAGAAAATGGTGCAGGAACTGGATGAACTGTTTATCCGCCCCTTTCTTCTAATATTGCCCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAATAGTATATCATTTGACCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTCTTCTTTTATTGCTTTCTTTACCTGTTCTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTATATCAACATTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 116–117 (genitalia Fig. 825–826), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU:MD 491m | Amazonia Lodge 2537 | 16.V.2012 Kinyon ], [ DNA sample ID: | NVG-14062G01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-5748 | c/o Nick V. Grishin ], [ genitalia | NVG160217–09 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Autochton (Autochton) | bipunctaticus Grishin ]. The first DNA sample label refers to a leg and the second refers to the abdomen; abdomen DNA was sequenced. Paratypes: 2♀♀: NVG-19119H07, USNMENT 01602682 Peru, Cuzco, Villa Carmen, Pilcopata, 1-May-2015, S. Kinyon leg. [USNM] and 1♀ NVG-18088D05 Bolivia, Rio Zongo, 750 m, old [ca. 1900], coll. Fassl [ZfBS].

Type locality.

Peru: Madre de Dios Region, Amazonia Lodge, elevation 491m.

Etymology.

The name is formed from its sister species epithet bipunctatus made longer to indicate more southern distribution of the new species. The name is an adjective.

Distribution.

Peru and Bolivia.

Papilio aulestis Cramer, 1780 is an incorrect original spelling of Papilio aulestes Cramer, 1780

In the original publication, Cramer (1780) gives two spellings of the name of a large Hesperid: aulestes in the text and aulestis in the index. In two works, dos Passos (1959; 1960) has argued that only one, aulestis, was an available name, because only the index gives a binomial combination (and this was the “first” binomial combination of the name), while the name aulestes in the text was not binomial and was unavailable (he called it “invalid” using a wrong term). However, aulestis and aulestes are not two different names, they are two different spellings of the same name. Moreover, both spellings were published in the same work issued on the same date and, according to the ICZN Code (ICZN 1999), this entire work should be considered a single unit (there is no such concept as “page priority” within a work issued on the same date). Thus, both spellings are the original spellings of the same name and, according to the ICZN Code Article 32.2.1, the choice should be made by the first reviser. Stoll (1782) [in Cramer volume 4] used the spelling aulestes as valid and, according to ICZN Art. 24.2.4, “original authors may be deemed to be First Revisers of spellings … whether or not the author cites both spellings together (that used as valid becomes the correct original spelling).” Stoll and Cramer worked together, both works (1780 and 1782) were published after Cramer’s death in 1776, and both works were volumes of Cramer books. Cramer was the author of the name aulestes published in volume 3, and Cramer’s name appears on the title page of volume 4, which was bound together with Stoll (1782). Therefore, we consider Cramer to be one of the original authors of these volumes (but not the author of all names published in these volumes), and apply Art. 24.2.4. Hence, the spelling aulestes is the correct original spelling and Papilio aulestis Cramer, 1780 is an incorrect original spelling of Papilio aulestes Cramer, 1780 (type locality in Suriname), as was confirmed by (Mielke 2004), who gave both spellings and qualified aulestis as a misspelling with “missp.” We note that dos Passos (1959; 1960) has not “selected” the spelling, because selection implies a choice, but dos Passos has argued that there were two names (not one), only one of these names was available, leaving no choice and making selection impossible. It makes sense that aulestis was simply a lapsus, because Aulestes was a character in Greek mythology, and there is no meaning associated with the word ‘aulestis’. Papilio aulestes Cramer, 1780 is a junior primary homonym of Papilio aulestes Cramer, 1777 (type locality in Suriname), presently Ancyluris aulestes (Riodinidae), and therefore cannot be used as a valid name for other species. Currently, a valid name applied to this Hesperiid is Astraptes janeira (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) (but see next).

Astraptes guyana Grishin, new species

https://zoobank.org/2CFD8C56-9451-4AAB-94EA-D82577EFA9FA

(Fig. 4 part, 118–121, 827–829)

Definition and diagnosis.

Genomic sequencing of specimens from the Amazonian region of South America identified as Astraptes janeira (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) reveals that they are genetically differentiated from the South Brazilian A. janeira at the species level (Fig. 4); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore they represent a new species. This new species keys to “Astraptes granadensis” [misspelling and misidentification] (C.14.16) in Evans (1952) and was included by him in that taxon. It differs from its relatives by the following combination of characters: the ventral hindwing has a central pale spot (missing in A. janeira); a hyaline spot in the forewing cell M₂-M₃ does not overlap much with the spot in the cell CuA₁-CuA₂ and does not reach towards the base of the cell; the harpe is longer and narrower, and its basal process near the ampulla is shorter, in particular on the right valva, where it is a mere bump. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly25.8.1:T63C, aly490.1.2:C3006T, aly127.66.5:T162C, aly127.66.5:T177G, aly423.1.4:A138G; and COI barcode: T74C, T118C, T274C, T376C, A520T.

Barcode sequence of the holotype.

Sample NVG-17097G12, GenBank PV972403, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTCTTAGTCTTCTTATTCGAACTGAACTAGGAACACCAGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTACTACCCCCCTCCCTAACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGTACAGGCTGAACTGTTTATCCCCCACTATCATCTAATATTGCTCATCAAGGAACCTCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACTATCATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTATTATTATTACTTTCTTTACCAGTATTAGCAGGAGCTATTACTATATTATTAACTGACCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACACCTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 118–119 (genitalia Fig. 827–829), bears the following six printed rectangular labels, five white: [ GUYANA: Acarai Mts./ridge | Sipu R. 2500’-3700’ | 6–9.XI.2000 | 1°20’N 58°57.’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-17097G12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032C02 | c/o Nick V. Grishin ], [ genitalia | NVG241118–20 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00275147 ], and one red [ HOLOTYPE ♂ | Astraptes | guyana Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 2♀♀: 1♀ NVG-17097G11, USNMENT 00179849 Guyana, Two Hat Mt., E. Kanuku Mts. S Slope, 800’, GPS 3.0383, −59.1217, 17-Sep-2-Oct-2000, S. Fratello et al. leg. [USNM] (Fig. 120–121); 1♂ NVG-14111B04 Ecuador, Napo, 8 km Napo-Ahuano, 480 m, GPS −1.0417, −77.7250, 12-Nov-1992, S. S. Nicolay leg. [USNM]; and Peru: 1♀ NVG-19071H02, USNMENT 01588525 no detailed locality, old [ca. 1900], Coll. W. Schaus [USNM] and 1♂ NVG-18124F01 (leg, DNA sequenced), NVG-24015F05 (abdomen, DNA stored), WRD 15060 Madre de Dios, Alto Madre de Dios at Pantiacolla Lodge, 400 m, GPS −12.6500, −71.2167, 6-Nov-2017, W. Dempwolf leg., genitalia NVG241114–37 [WRD].

Type locality.

Guyana: Acarai Mts., Sipu River, elevation 2500’–3700’, GPS 1.333, −58.950.

Etymology.

The name is for the type locality, similarly to the name of its sister species and is a noun in apposition.

Distribution.

Currently known from Guyana, Ecuador, and Peru.

Comment.

Although we have not carried out a detailed investigation of Papilio aulestes Cramer, 1780 (Hesperiidae; type locality in Suriname), which is a junior primary homonym of Papilio aulestes Cramer, 1777 (Riodinidae; type locality in Suriname), from the general localities of the two taxa and original illustrations, it is most likely that the Hesperiid P. aulestes and Astraptes guyana, new species, are conspecific. Therefore, we place Papilio aulestes Cramer, 1780 in synonymy with A. guyana, because the former is a junior primary homonym, and as such, is permanently invalid, although available.

Epargyreus argentinicus Grishin, new species

https://zoobank.org/E5212D17-4B8D-4EB4-8D6B-01B51A60AF87

(Fig. 4 part, 122–123, 830–831)

Definition and diagnosis.

Genomic analysis of a specimen from Argentina identified as Epargyreus tmolis (Burmeister, 1875) (type locality Argentina: Buenos Aires) reveals that they are not monophyletic and this specimen is in a distant clade not closely related to any other species (Fig. 4), and therefore represents a new species. This new species keys to “Epargyreus tmolis” (C.2.7) in Evans (1952), but differs from it and other relatives by the following combination of characters: forewing semihyaline spots are more rounded, the spot in the cell M₃-CuA₁ is broad, nearly square; the ventral hindwing has a central elongated silvery spot having a rather straight inner margin and only slightly sinuous outer margin connected to a silvery spot at the end of the discal cell, this spot is about half the width of the larger spot, broad comma-shaped on the right hindwing, an hourglass-shaped silvery spot in the cell Sc+R₁-RS, a nearly obsolete irregular postdiscal band of paler scales framing a narrow darker band, between this band and the silvery spots, the wing is overscaled in the middle with pale orangish-brown, a pale violaceous overscaling by the outer margin; the valva is narrower than its length (from the base to the ampulla), the ampulla has a dorsal process armed with spikes, the costa is strongly concave anteriad of this process, the harpe has a broad, poorly defined tooth in the middle of its dorsal margin and ends in a sharp tooth, concave at its distal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly327.3.1:A871G, aly2275.4.1:T95C, aly2275.4.1:A222C, aly2275.23.10:T43C, aly2275.23.10:C44T, aly6841.81.1:A158A (not G), aly6841.81.1:A543A (not T), aly536.114.5:A270A (not T), aly173.64.10:T51T (not C), aly3269.2.4:C700C (not G); and COI barcode: C235T, T286C, T460C, T539C, A631T.

Barcode sequence of the holotype.

Sample NVG-19039H08, GenBank PV972404, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCCTTATATTAGGAGCTCCAGATATAGCTTTTCCCCGTATAAATAATATAAGATTTTGATTATTACCTCCATCATTAACTCTCTTAATTTCAAGAAGTATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTCTTTCTTCCAATATTGCCCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATTATCAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATTACAGCTTTATTATTACTACTTTCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGGGGTGATCCCATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 122–123 (genitalia Fig. 830–831), bears the following seven printed rectangular labels, six white: [ ARGENTINA, Prov. Jujuy | Dept. Ledesma; 5.5–7.5km, | W of Rt.34 near entrance | Parque Nacional Callilegua | 1600m,14.II.1991; mesic forest | along river; K.Johnson et al. ], [ DNA sample ID: | NVG-19039H08 | c/o Nick V. Grishin ], [ Leg removed on | 20-Feb-2019 by | N. V. Grishin for | DNA extraction ], [ DNA sample ID: | NVG-24015E10 | c/o Nick V. Grishin ], [ genitalia | NVG241114–15 | c/o Nick V. Grishin ], [ {QR Code} | AMNH_IZC 00337722 ], and one red [ HOLOTYPE ♂ | Epargyreus | argentinicus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Argentina: Jujuy Province, Ledesma Department, 5.5–7.5 km west of Rt34, near entrance of Parque Nacional Calilegua, elevation 1600 m.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northern Argentina.

Epargyreus tmolucan Grishin, new species

https://zoobank.org/DFC210BD-3DB1-44C0-BFFF-BB208C77164F

(Fig. 4 part, 124–125, 832–833)

Definition and diagnosis.

Genomic analysis of specimens from Argentina identified as Epargyreus tmolis (Burmeister, 1875) (type locality Argentina: Buenos Aires) reveals that they are not monophyletic with it and originate in a clade distant from it, not being closely related to any other species (Fig. 4), and therefore they represent a new species. This new species keys to “Epargyreus tmolis” (C.2.7) in Evans (1952), but differs from it and other relatives by the following combination of characters: forewing semihyaline spots are more angular, the spot in the cell M₃-CuA₁ is dash-shaped; the ventral hindwing has a central oval silvery spot having a rounded inner margin and sinuous outer margin, a separated from it silvery dash at the end of the discal cell, no silvery spot in the cell Sc+R₁-RS, a narrow irregular postdiscal band of paler scales distad from which the wing is darker brown overscaled with pale violaceous by the outer margin; the valva is as broad as it is long (from the base to the ampulla), the ampulla has a dorsal process armed with spikes, the costa is nearly straight anteriad of this process, the harpe has a small tooth in the middle of its dorsal margin, ends in a sharp tooth, and there is no prominent concavity along its distal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.109.1:A449C, aly1937.17.1:T85G, aly240.2.13:C712T, aly240.2.13:C728T, aly272.2.13:A223C; and COI barcode: T40G, T49C, T85C, G506A, T634C.

Barcode sequence of the holotype.

Sample NVG-17096E04, GenBank PV972405, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTGGGTACTTCCTTAAGATTACTTATTCGAACTGAATTAGGAACTCCCGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATCCCCCTTATATTAGGAGCCCCCGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTACCTCCATCATTAACTCTTCTAATTTCAAGAAGCATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTCTTTCATCTAATATTGCCCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCCTTATTTATTTGAGCAGTTGGAATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGACCGAAATTTAAATACCTCTTTTTTTGATCCTGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 124–125, bears the following seven rectangular labels (4^th handwritten, others printed), six white: [ Tucuman | Argentina ], [ R.Schreiter. | Coll. ], [ Collection | WmSchaus ], [ 249 ], [ DNA sample ID: | NVG-17096E04 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00913195 ], and one red [ HOLOTYPE ♂ | Epargyreus | tmolucan Grishin ]. Paratypes: 2♂♂ from Argentina: Tucuman: 1♂ NVG-19039H10, AMNH_IZC 00337724 Yerba Buena, Yerba Buena-Anta Muerta, Rt.338, arroyo at km post 15: “El Paraiso”, 700 m, 8-Feb-1991, K. Johnson et al. leg. [AMNH] and 1♂ NVG-17096E05 (leg, DNA sequenced), NVG-22032B03 (abdomen, DNA stored), USNMENT 00913196 old [ca. 1900], R. Schreiter leg., genitalia NVG241118–21 (Fig. 832–833) [USNM].

Type locality.

Argentina: Tucumán.

Etymology.

The name is a fusion: tmol[is from T]uc[um]an, given to this relative of E. tmolis from Tucumán and is treated as a noun in apposition.

Distribution.

Argentina.

Neotype designation for Goniurus tarchon Hübner, [1819]

The name Goniurus tarchon Hübner, [1819] (type locality in America) was proposed for the illustrations of Papilio proteus in Sulzer (1776) (pl. 19, figs 1, 2), misidentifications, and has been treated as a junior subjective synonym of Chioides catillus catillus (Cramer, 1779) (type locality in Suriname) due to the similarity in wing patterns. In light of cryptic species closely related to C. catillus, insufficiently detailed illustrations of Goniurus tarchon, and the type locality being only very general (America), to learn more about the taxonomic identity of the species represented by this name, we searched for its syntypes among Hesperiidae holdings in all major collections listed in the Acknowledgments section. We failed to find any syntypes, which agrees with the statement in Horn et al. (1990) that they were lost.

Currently, there is no need for the neotypes of Papilio catillus Cramer, 1779 (type locality in Suriname) and its junior subjective synonym Papilio longicauda Sepp, [1847] (type locality in Suriname), because their identifications have not been questioned and, thus far, only a single species with similar facies in known from Suriname. However, there is an exceptional need for a neotype of G. tarchon to define this taxon objectively due to its very broad type locality “America” and cryptic species present among C. catillus relatives. Because type specimens of other names of its relatives proposed around the same time were from Suriname, it seems likely that the types of G. tarchon, illustrations of which look similar to Surinamese specimens of C. catillus, were collected in Suriname as well. Therefore, we selected a Surinamese specimen, a female, which, among specimens we examined, looks particularly similar to Sulzer’s illustrations in wing patterns and has broader hindwings, as the neotype. Hereby, N.V.G. designates the specimen in the USNM illustrated in Fig. 126–127 (DNA sample NVG-17097C11) as the neotype of Goniurus tarchon Hübner, [1819]. This neotype corroborates the current and long-standing treatment of the name as a junior subjective synonym of C. catillus catillus (Cramer, 1779) (Evans 1952; Mielke 2005).

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of G. tarchon, which is necessary because additional species are present among its close relatives, and to define the type locality that was stated in the original description as “America”; 75.3.2. The characters to differentiate this taxon from others are revealed from the illustrations of its type specimen(s) in Sulzer (1776) and are: brown ground color without green overscaling, a long tail on the hindwing of the same length as the wing, checkered hindwing fringes, four large yellowish central spots on the forewing and a smaller discal spot near the costal margin, three subapical yellowish spots on the forewing with darker brown areas around them on the ventral side, two darker-brown bands partly separated into spots on the ventral hindwing, the postdiscal band gets weaker and disappears towards the costal margin where it merges with the darker and striated submarginal area, which is separated from the band by the paler area near the tail; 75.3.3. The neotype specimen is a female bearing three labels: [ Suriname Commewijne De | Nieuwe Grond, secondary | forest 6.2 1982 | Olle Pellmyr ], [ DNA sample ID: | NVG-17097C11 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913269 ] and illustrated in Fig. 126–127; the neotype’s head is tilted to the left and its tail on the right hindwing has slight damage to the fringe in the middle on both sides; 75.3.4. We failed to find syntypes of G. tarchon among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and, taking into account the same statement in Horn et al. (1990), believe that they were lost; 75.3.5. The neotype closely agrees with the illustrations of G. tarchon type specimen(s) in all characters, as evidenced by comparing the neotype illustrated in Fig. 126–127 with the illustrations and the characters for this taxon listed above (75.3.2.); 75.3.6. The neotype is from Suriname and the original type locality given as “America” agrees with it; 75.3.7. The neotype is in the National Museum of Natural History, Washington, DC, USA (USNM). As a result of the neotype designation, the type locality of G. tarchon becomes Suriname: Commewijne District, De Nieuwe Grond. The COI barcode sequence of the neotype, sample NVG-17097C11, GenBank PV972406, 658 base pairs, is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTCTTTTAATTTCAAGAAGTATCGTTGAAAATGGAGCTGGAACTGGTTGAACTGTTTATCCCCCCCTTTCAGCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAACAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Chioides australis Grishin, new species

https://zoobank.org/205E6E95-A8F1-40A1-AAC4-BBB05172A675

(Fig. 4 part, 128–129, 834–835)

Definition and diagnosis.

Genomic analysis of Chioides Lindsey, 1921 (type species Eudamus albofasciatus Hewitson, 1867) reveals a clade sister to several other species in the nuclear genome that does not yet have a name and therefore represents a new species (Fig. 4). This new species keys to “Chioides catillus catillus” (C.4.1(c)) in Evans (1952) and was included by him in that taxon, but differs from it by the following combination of characters: a darker postdiscal bandlet between the veins CuA₁ and 1A+2A on the ventral hindwing, framed on both sides by paler scales, is broader, especially in the middle, and typically more lanceolate in shape; the basal dark spot in the ventral hindwing cell Sc+R₁-RS is usually as strongly expressed as the discal spot and other dark spots (not weaker than them); the harpe is broader, its ventral margin is more convex in lateral view and more strongly constrained by the distal process directed dorsad, which is smaller, with a well-developed rounded lobe, and a tooth directed anterodorsad. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly274.2.1:T714A, aly1651.34.6:C69T, aly1651.34.6:A96C, aly890.12.5:C54T, aly3598.7.3:A102G; and no differences among several species are observed in the COI barcode.

Barcode sequence of the holotype.

Sample NVG-17097D04, GenBank PV972407, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTCTTTTAATTTCAAGAAGTATCGTTGAAAATGGAGCTGGAACTGGTTGAACTGTTTATCCCCCCCTTTCAGCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAACAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 128–129 (genitalia Fig. 834–835), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ BOLIVIA:La Paz Province | San Lorenzo Valley, Rio | San Lorenzo 800 meters | 15°48.338’S,67°29.447’W | 12–19.iv.2003.B. Harris ], [ Chioides | det. Brian Harris 2003 ], [ DNA sample ID: | NVG-17097D04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G03 | c/o Nick V. Grishin ], [ genitalia | NVG241118–22 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00913274 ], and one red [ HOLOTYPE ♂ | Chioides | australis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂ and 3♀♀: 1♀ NVG-17097D02, USNMENT 00913272 Peru, Cuzco, Cosnipata Valley, Picopata, 30-Oct-2016, S. Kinyon leg. [USNM]; Brazil: 2♂♂ Rondônia, 67 km S Ariquemes, linea C-10, 5 km S of Cacaulândia, O. Gomes leg. [MGCL]: NVG-15024E03 9-Oct-1993 and NVG-15024E04 12-Nov-1995, 1♂ NVG-17097D05, USNMENT 00913275 Mato Grosso, Diamantino, Alto Rio Arinos, 350–400 m, GPS −14.2167, −56.2000, 10-Feb-1990, E. Furtado leg. [USNM], and 1♀ NVG-17097D06, USNMENT 00913276 Rio de Janeiro, Pau a Fome, May-1972, O. Mielke leg. [USNM]; and 1♀ NVG-17097D03, USNMENT 00913273 Argentina, Salta, Oran nr. Aguas Blancas, GPS −22.733, −64.367, 23-Jan-2004, Nancy Vannucci leg. [USNM].

Type locality.

Bolivia: La Paz Province, San Lorenzo Valley, Río San Lorenzo, elevation 800 m, GPS −15.8056, −67.4908.

Etymology.

In Latin, the word australis means southern, and the name reflects the southernmost distribution of this species among its relatives. The name is an adjective.

Distribution.

Southern half of South America, including Peru, Bolivia, Brazil, and Argentina.

Subtribe Loboclina Grishin, 2019

Aguna scheba (Plötz, 1881) is a species distinct from Aguna asander (Hewitson, 1867) with Epargyreus haitensis Mabille and Boullet, 1912 as its subspecies and Aguna asander jasper Evans, 1952 as its junior subjective synonym

Eudamus scheba Plötz, 1881 (type locality in “South America,” no further details) is currently treated as a junior subjective synonym of Aguna asander (Hewitson, 1867) (type locality Brazil: Amazonas, Tefé) (Mielke 2005). Genomic analysis places the lectotype of E. scheba (NVG-22068G04) among specimens from Jamaica (Fig. 5), suggesting that it may have been collected there (Fig. 5). Phenotypically, the syntype agrees with specimens from Jamaica in having semihyaline spots that are smaller and a ventral hindwing darker than A. asander from South America. Therefore, the type locality of E. scheba is likely in Jamaica. The COI barcode sequence of the lectotype, sample NVG-22068G04, GenBank PV972408, 658 base pairs is:

Figure 5.

Phylogenetic trees of selected Loboclina inferred from protein-coding regions in a) the Z chromosome, based on 340,206 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACATCTTTAAGATTACTTATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCTTAATATTAGGAGCCCCCGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTCTTCTAATTTCTAGAAGTATCGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCTCTTTCTTCTAATATTGCCCATCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAATAATTTATCATTTGATCAAATATCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGGGGGGATCCTATTTTATATCAACATTTATTT

Genomic phylogeny reveals that specimens identified as A. asander from the Caribbean Islands form a clade genetically differentiated from continental populations at the species level (Fig. 5); e.g., their COI barcodes differ by 3.2% (21 bp). The oldest name for the insular species is E. scheba, which we propose to treat as a species-level taxon Aguna scheba (Plötz, 1881), reinstated status. Moreover, the lectotype of A. scheba is placed among specimens from Jamaica that we have identified as Aguna asander jasper Evans, 1952 (type locality in Jamaica). Therefore, we propose that Aguna asander jasper Evans, 1952 is a new junior subjective synonym of A. scheba. Epargyreus haitensis Mabille and Boullet, 1912 (type locality in Haiti) currently treated either as a subspecies or a junior subjective synonym of A. asander, is placed with A. scheba in the genomic trees (Fig. 5), and we propose to place it as a subspecies (rather than a synonym) of the latter due to genetic differentiation: Aguna scheba haitensis Mabille and Boullet, 1912, new species-subspecies combination.

Aguna peruander Grishin, new species

https://zoobank.org/F9A4247A-E98C-4CA4-9D61-1FB8026B7652

(Fig. 5 part, 130–131, 836–837)

Definition and diagnosis.

In addition to Aguna scheba (Plötz, 1881), reinstated status, (type locality deduced as Jamaica by genomic sequencing of the lectotype) being a species distinct from Aguna asander (Hewitson, 1867) (type locality Brazil: Amazonas, Tefé), we find that a specimen from Amazonian Peru is genetically differentiated from others at the species level (Fig. 5); e.g., its COI barcode differs by 2.3% (15 bp), and therefore represents a new species. This new species keys to Aguna asander asander (C.5.1(a)) in Evans (1952) and to A. asander in Austin and Mielke (1998), but differs from it and other relatives by the darker ventral hindwing with a vestigial and narrow pale discal band, larger than in most specimens semihyaline forewing spots, a longer uncus, a more extended harpe with a less pronounced dorsoposterior ridge, and a better-developed ventroposterior angle. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly50.11.3:A45G, aly536.8.1:A240G, aly536.8.1:A453G, aly536.8.1:A720G, aly1830.2.4:A465G, aly13116.1.2:G117G (not A), aly13116.1.2:T399T (not C), aly13116.1.2:A640A (not T), aly527.6.7:C201C (not T), aly527.6.7:T204T (not C); and COI barcode: A184C, T220A, T478C, T536C, T637A.

Barcode sequence of the holotype.

Sample NVG-18016C08, GenBank PV972409, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACATCTTTAAGATTACTTATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGAAATTGACTAGTACCCTTAATATTAGGAGCACCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTCTTTTAATCTCTAGAAGTATCGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCTCTTTCTTCTAATATTGCCCACCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAACTTATCATTTGATCAAATATCCTTATTTATTTGAGCTGTTGGAATTACAGCATTATTACTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAACACATCATTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 130–131 (genitalia Fig. 836–837), bears the following six printed rectangular labels, five white: [ PERU: Amazonas | Cumba, 500 m. | 05° 57’ S, 78° 39’ W | 25 September 1999 | Ahrenholz, Robbins, Lamas ], [ DNA sample ID: | NVG-18016C08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–23 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450776 ], and one red [ HOLOTYPE ♂ | Aguna peruander | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Amazonas Region, Cumba, elevation 500 m, GPS −5.95, −78.65.

Etymology.

The name reflects the country of the type locality (Peru) of this close relative of A. asander: peru+[as] ander, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Amazonas Region of Peru.

Aguna leucogramma (Mabille, 1888) is a species distinct from Aguna albistria (Plötz, 1881)

Genomic analysis reveals that Eudamus leucogramma Mabille, 1888 (type locality Venezuela: Porto Cabello) currently regarded as a subspecies of Aguna albistria (Plötz, 1881) (type locality in Brazil: Pará) is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 2.4% (16 bp). Therefore, we propose to treat it as a species-level taxon: Aguna leucogramma (Mabille, 1888), reinstated status.

Thymele guatemalaina Ehrmann, 1907 is a junior subjective synonym of Aguna albistria (Plötz, 1881) and not of Aguna leucogramma (Mabille, 1888)

Genomic sequencing of the holotype of Thymele guatemalaina Ehrmann, 1907 (type locality Guatemala: Cajabon, NVG-15095E02) currently treated as a junior subjective synonym of Aguna leucogramma (Mabille, 1888), reinstated status, (type locality Venezuela: Porto Cabello), reveals that they are not monophyletic and instead the holotype is placed with specimens of Aguna albistria (Plötz, 1881) (type locality in Brazil: Pará) (Fig. 5).

Phenotypic assessment agrees with this conclusion, because the holotype has a narrower ventral hindwing discal band, not broader, as in A. leucogramma. Therefore, we propose that Thymele guatemalaina Ehrmann, 1907, new synonym placement, is a junior subjective synonym of Aguna albistria (Plötz, 1881), and express doubt that Guatemala is the true type locality for this South American taxon. We suggest that the holotype might have been mislabeled and its provenance will be investigated by genomic comparison involving additional specimens from across the range. The COI barcode sequence of T. guatemalaina holotype, sample NVG-15095E02, GenBank PV972410, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGACTAGTAGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTATGCTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTCTTTTAATTTCTAGAAGTATTGTTGAAAATGGTGCAGGTACAGGATGAACAGTTTATCCCCCTCTTTCTTCCAATATTGCCCATCAAGGAGCCTCAGTAGATTTAGCTATTTTTTCCCTACATTTAGCAGGAATCTCTTCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTCGATCAAATATCCTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTACTTCTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCGGCAGGAGGAGGTGATCCTATTTTATACCAACATTTATTT

Aguna leucoriga Grishin, new species

https://zoobank.org/FE7382DE-6E27-4282-8073-756CA3939A78

(Fig. 5 part, 132–133, 838–839)

Definition and diagnosis.

In addition to Aguna leucogramma (Mabille, 1888) (type locality Venezuela: Porto Cabello) being a distinct species from Aguna albistria (Plötz, 1881) (type locality in Brazil: Pará), a specimen from Southeast Brazil is genetically differentiated from Aguna albistria at the species level (Fig. 5); e.g., its COI barcode differs by 1.4% (9 bp), and therefore it represents a new species. This new species keys to Aguna albistria albistria (C.5.13(b)) in Evans (1952) and to Aguna albistria in Austin and Mielke (1998), but differs from it by the hindwing white stripe narrowing towards the costal margin (typically the same width or broader in A. albistria), a longer uncus, a shorter and more concave costa of the valva, and a larger process of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2627.8.3:T258C, aly489.3.2:A84G, aly499.7.7:T438C, aly923.18.9:G60A, aly272.10.19:A177G, aly275211.5.10:T426T (not C), aly275211.5.10:T444T (not A), aly1080.12.39:A105A (not G), aly1080.12.39:A1455A (not G), aly2127.1.1:C156C (not T); and COI barcode: T35C, A43G, T205C, T226C, T439C.

Barcode sequence of the holotype.

Sample NVG-18016D04, GenBank PV972411, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGACTAGTAGGGACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCCTTATACTAGGAGCCCCTGACATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTCTTTTAATTTCTAGAAGTATTGTTGAAAATGGTGCAGGTACAGGATGAACAGTTTATCCCCCTCTTTCTTCCAACATTGCCCATCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCCCTACATTTAGCAGGAATCTCTTCTATTCTTGGAGCTATCAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTCGATCAAATATCCTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTACTTCTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTC

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 132–133 (genitalia Fig. 838–839), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRAZIL: MG 1250m | Serra do Cipo | 19°16’S 43°35’W | 17 Apr 1991 | Robbins & Becker ], [ DNA sample ID: | NVG-18016D04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B11 | c/o Nick V. Grishin ], [ genitalia | NVG241118–25 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450784 ], and one red [ HOLOTYPE ♂ | Aguna leucoriga | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Minas Gerais, Serra do Cipo, elevation 1250 m, GPS −19.267, −43.583.

Etymology.

In Greek, λευκό (lefko) means white and ρίγα (riga) means a stripe. The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected in Southeast Brazil.

Aguna paraica Grishin, new species

https://zoobank.org/2E5943C2-E3C2-442F-B14C-112CCD654765

(Fig. 5 part, 134–135, 840–841)

Definition and diagnosis.

A female from Pará, Brazil, identified as Aguna clina Evans, 1952 (type locality in Colombia: Bogotá) is not monophyletic with it and instead is sister to several other species of Aguna Williams, 1927 (type species Eudamus camagura Williams, 1926) (Fig. 5), and therefore represents a new species. This new species keys to Aguna longicauda Austin and O. Mielke, 1998, together with Aguna penicillata Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia for both species) in the female key by Austin and Mielke (1998), and is most similar to these two species in having broad, yellowish semihyaline forewing spots and a V-shaped central notch on the caudal margin of the lamella postvaginalis, but differs from both of them by a broadly rounded, near semi-circular margin of the lamella postvaginalis on both sides of the central notch, which is deeper than in A. penicillata. In addition, the new species differs from A. penicillata by having a broader hindwing white band, and from A. longicauda by a triangular rather than rounded sclerotized portion of the lateral lobes of the lamella antevaginalis. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly727.22.2:T60C, aly531.21.3:T53A, aly10226.8.1:T621C, aly6648.2.7:C31A, aly233.6.4:C90G, aly707.14.1:T75T (not C), aly707.14.1:T30T (not A), aly283.2.7:G153G (not T), aly1222.26.2:C94C (not T), aly824.22.9:G141G (not A); and COI barcode: A256T, A352C, T526C, T562C, T616C.

Barcode sequence of the holotype.

Sample NVG-18016E01, GenBank PV972412, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATCTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTCTTATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGTTTTTGACTTCTACCTCCATCTTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTATCCCCCTCTTTCCTCTAACATTGCACATCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCTTTATTCATTTGAGCAGTTGGTATTACCGCATTATTATTATTACTTTCTTTACCTGTTTTAGCCGGAGCTATTACAATATTATTAACAGATCGAAATTTAAACACATCATTCTTTGACCCTGCAGGGGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 134–135 (genitalia Fig. 840–841), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ BRAZIL: PARÁ | Cuiaba–Santarem Hwy. | Km 1164 | 17 July ‘78 | S. S. Nicolay ], [ Aguna ♂ | clina | Det. E. | S.S. Nicolay ], [ DNA sample ID: | NVG-18016E01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B03 | c/o Nick V. Grishin ], [ genitalia | NVG241118–32 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450789 ], and one red [ HOLOTYPE ♀ | Aguna paraica | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Pará, km 1164 of Cuiaba–Santarem Hwy.

Etymology.

The name is derived from the Brazilian state of the type locality: Para+ica, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the lower Amazonian region of Brazil.

Aguna paracoelus Grishin, new species

https://zoobank.org/2E41EF5D-5B4E-459C-9CEE-7D9708A65F19

(Fig. 5 part, 136–137, 842–844)

Definition and diagnosis.

Identified by G. T. Austin as Aguna coeloides Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia), this female from Pará, Brazil, is actually sister to Aguna coelus (Stoll, 1781) (type locality in French Guiana) and is genetically differentiated from it at the species level in the nuclear genome (Fig. 5a) (but their COI barcodes do not differ), and therefore represents a new species. This new species keys to A. coeloides in the female key by Austin and Mielke (1998), but differs from it by a much deeper central notch on the lamella postvaginalis, more similar to A. coelus, and differs from A. coelus by the less triangular sides of the lamella postvaginalis on both sides of the notch, and the distal margin that is arc-shaped, more similar to that of A. coeloides. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1585.15.1:A75G, aly1585.15.1:G78A, aly322.13.2:C335G, aly322.13.2:C810T, aly5965.2.3:C2292T, aly954.1.10:G69G (not A), aly6209.2.1:C1177C (not T), aly6841.22.4:A546A (not T), aly827.18.5:C60C (not T), aly1080.27.6:A741A (not G); and no difference is observed in the COI barcode.

Barcode sequence of the holotype.

Sample NVG-18016E08, GenBank PV972413, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCTCTTTCATCTAATATTGCCCATCAAGGAGCATCAGTTGATCTAGCAATTTTTTCTTTGCACTTAGCAGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 136–137 (genitalia Fig. 842–844), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ BRAZIL: PARÁ | Cuiaba–Santarem Hwy. | Km 1270 | 18 July ‘78 | S. S. Nicolay ], [ genitalia Vial | GTA-3027 ], [ Aguna coeloides | Austin & Mielke, 1997 | det. G.T. Austin ], [ DNA sample ID: | NVG-18016E08 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450796 ], one yellow [ USNM ], and one red [ HOLOTYPE ♀ | Aguna paracoelus | Grishin ].

Type locality.

Brazil: Pará, km 1270 of Cuiaba - Santarem Hwy.

Etymology.

The name for this relative of A. coelus is derived from the state of the type locality: para + coelus, also meaning that it is a species similar to but different from A. coelus. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the lower Amazonian region of Brazil.

Aguna aguna Grishin, new species

https://zoobank.org/3FF3F08D-33DE-42C6-A7F6-123027BCF6F1

(Fig. 5 part, 138–139, 845–846)

Definition and diagnosis.

A paratype of Aguna coeloides Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia) from Panama is not monophyletic with it and instead is sister to Aguna nicolayi Austin and O. Mielke, 1998 (type locality in Brazil: Mato Grosso), being genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore it represents a new species. This species keys to A. coeloides in Austin and Mielke (1998), but differs from it and other relatives by a larger and more robust bulge of the ampulla, which, together with a more strongly developed serrated dorsal margin of the harpe near the ampulla, is more similar to A. nicolayi, from which it differs by the general shape of the valva, which is more similar to A. coeloides in being longer, and by having a more extended harpe with a narrower and more pointed distal end, and a relatively longer uncus compared to the tegumen. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly173.38.5:A1155T, aly172.8.2:C60T, aly172.8.2:A78G, aly1080.4.5:G316C, aly274.24.2:T150A, aly2012.65.3:C186C (not G), aly6954.2.1:G602G (not A), aly6954.2.1:A1113A (not G), aly1656.40.1:A364A (not G), aly770.8.2:T99T (not C); and COI barcode: G38A, T157C, A166G, T505C, T653C.

Barcode sequence of the holotype.

Sample NVG-18016E07, GenBank PV972414, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAATTGGAACTTCATTAAGTTTACTTATTCGTACTGAATTAGGCACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCCCTTTCATCAAATATTGCACATCAAGGAGCATCAGTAGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCCTTATTCATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATACCAACATCTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 138–139 (genitalia Fig. 845–846), bears the following six rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), five white: [ Panama: Veraguas | Isla Coiba | Represa | 25-II-1981 | GBSmall ], [ genitalia Vial | GTA-2967 ], [ DNA sample ID: | NVG-18016E07 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450795 ], one blue [ PARATYPE | Aguna coeloides | Austin & Mielke, 1997 ], and one red [ HOLOTYPE ♂ | Aguna aguna | Grishin ].

Type locality.

Panama: Veraguas Province, Coiba Island.

Etymology.

For such a species-rich genus as Aguna, we were surprised not to find a tautonym. Here, this opportunity is taken, and the name is a noun in apposition.

Distribution.

Currently known only from the holotype collected on Coiba Island off the southern coast of Panama.

Aguna manchancha Grishin, new species

https://zoobank.org/C169C640-D7C2-45C3-83AB-6C94251A818F

(Fig. 5 part, 140–141, 847–848)

Definition and diagnosis.

A close relative of Aguna latimacula Austin and O. Mielke, 1998 (type locality in Brazil: Minas Gerais), this new species is sister to both A. latimacula and Aguna cirrus Evans, 1952 (type locality in Brazil: São Paulo) in the nuclear genome tree and is strongly differentiated genetically from both of them (Fig. 5); e.g., its COI barcodes differ by 3.3% (22 bp) from A. latimacula and by 2.9% (19 bp) from A. cirrus. This new species keys to A. latimacula in Austin and Mielke (1998), but differs from it and other relatives by a better defined lobe on the ampulla, the lobe rises dorsad at a nearly right angle to the costa of the valva, more similar to A. cirrus, and a slightly narrower harpe with a more convex ventral margin; differs from A. cirrus by a relatively longer uncus compared to the tegumen, a more robust serrated portion of the harpe by the ampulla, and a more extended harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly275184.2.3:A76T, aly275184.2.3:T559A, aly275184.2.3:C707A, aly363.60.23:G147A, aly363.60.23:G195A; and COI barcode: 82C, T205C or A, A337G, T400A, T463C.

Barcode sequence of the holotype.

Sample NVG-18016F07, GenBank PV972415, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACTTCATTAAGATTACTTATTCGTACTGAATTAGGCACCCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTGTATCCCCCCCTTTCATCAAATATTGCACATCAAGGAGCATCAGTAGATTTAGCTATTTTTTCATTACACTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAACATACGAATTAATAATTTATCATTTGATCAAATATCCTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 140–141 (genitalia Fig. 847–848), bears the following six printed rectangular labels, five white: [ BRAZIL, RO 160–350m | vic. Caucalandia | 10°32’S 62°48’W | 27 Oct 1991 | Leg. J. Kemner ], [ DNA sample ID: | NVG-18016F07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B07 | c/o Nick V. Grishin ], [ genitalia | NVG241118–30 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450806 ], and one red [ HOLOTYPE ♂ | Aguna manchancha | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 4♂♂ and 2♀♀ in USNM: 1♂ NVG-18016E12, USNMENT 01450800 Colombia, Caqueta, Florencia, 1300’, 23-Jan-1969, S. S. Nicolay leg.; 2♀♀ Guyana, Acarai Mts., Sipu River, 900–2500’, GPS 1.3867, −58.9467, 29-Oct-12-Nov-2000, S. Fratello et al. leg.: NVG-18016D10, USNMENT 00179746 and NVG-18016H05, USNMENT 00275138; and Brazil, Rondônia: 1♂ NVG-18016F08, USNMENT 01450807 8 km N of Cacaulândia, 190 m, GPS −10.5000, −62.8667, 5-Nov-1989, D. H. Ahrenholz leg., genitalia H1077 S. S. Nicolay and 62 km S Ariquemes, Fazenda Rancho Grande, 165 m, GPS −10.5333, −62.8000: 1♂ NVG-18016H03, USNMENT 01450822 27-Aug-8-Sep-1994, Ron Leuschner leg. and 1♀ NVG-18016H08, USNMENT 01450824 14–25-Nov-1993, Brian Harris leg.

Type locality.

Brazil: Rondônia, vicinity of Cacaulândia, elevation 160–250 m, approx. GPS −10.53, −62.80.

Etymology.

In Latin, latimacula means broad spot. The name of this relative of A. latimacula is a Spanish equivalent and is treated as a noun in apposition.

Distribution.

Widely distributed from Colombia through the Guianas to Rondônia in Brazil.

Aguna guyanae Grishin, new species

https://zoobank.org/8FDBDA16-1A7A-4125-9FB8-85AA04650415

(Fig. 5 part, 142–143, 849–851)

Definition and diagnosis.

Sister to Aguna venezuelae O. Mielke, 1971 (type locality in Venezuela: Maracay) in the nuclear genome tree, this new species is genetically differentiated from it (Fig. 5); e.g., their COI barcodes differ by 2% (13 bp). This new species keys (incompletely) to A. venezuelae in Austin and Mielke (1998) by the morphology of male genitalia, but differs from it and other relatives by a much narrower ventral hindwing white band not expanded in the middle, the smaller forewing semihyaline spots, a prominent and rounded lobe of the ampulla that protrudes farther dorsad from the strongly developed serrated dorsal margin of the harpe due to the harpe being narrower, and the harpe with a more pointed (but still terminally rounded) distal end. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2239.4.4:C141T, aly15656.2.3:C450T, aly600.4.2:T19C, aly600.4.2:G42A, aly2423.10.7:A94C, aly151.43.1:T36T (not A), aly2532.11.6:G85G (not A), aly1651.5.1:T1350T (not C), aly1651.5.1:A1413A (not G), aly1603.12.1:C60C (not T); and COI barcode: A217A, C284T, 400A, A421G, T487C.

Barcode sequence of the holotype.

Sample NVG-18017A09, GenBank PV972416, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACTTCATTAAGATTACTTATTCGTACTGAATTAGGCACTCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATCGTTACAGCTCATGCTTTTATCATAATTTTCTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAACTTTATTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCCCTTTCATCAAATATTGCACATCAAGGAGCATCAGTAGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCGTCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTCGATCAAATATCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 142–143 (genitalia Fig. 849–851), bears the following six printed rectangular labels, five white: [ GUYANA: Cuyuni R, | Kamaria Falls 100’ | 30.XI.-5.XII.2000 | 6°24’N 58°546’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-18017A09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B08 | c/o Nick V. Grishin ], [ genitalia | NVG241118–29 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00179810 ], and one red [ HOLOTYPE ♂ | Aguna guyanae | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana: Cuyuni-Mazaruni Region, Cuyuni River, Kamaria Falls, elevation 100’, approx. GPS 6.40, −58.77.

Etymology.

The name for this species from Guyana is similar to the name of its sister species from Venezuela: A. venezuelae. The name is treated as a noun in the genitive case.

Distribution.

Currently known only from the holotype collected in Guyana.

Comment.

The holotype is not the best-preserved specimen, and its abdomen (with genitalia) was damaged, however, its DNA quality is excellent and allows unambiguous identification.

Aguna curvicoelus Grishin, new species

https://zoobank.org/C59C2A5F-DA6C-417D-B87A-F7302157C47A

(Fig. 5 part, 144–145, 852–853)

Definition and diagnosis.

Identified by G. T. Austin as Aguna coelus (Stoll, 1781) (type locality in French Guiana), this female from Panama is actually more closely related to Aguna coeloides Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia), and is genetically differentiated from it and other relatives at the species level (Fig. 5); e.g., their COI barcodes differ by 4.0% (26 bp), and therefore it represents a new species. This new species keys to A. coelus in the female key by Austin and Mielke (1998), but differs from it by the hindwing white band that is more curved and wider than in most specimens of other species, the notch in the lamella postvaginalis that is deeper, and the side plates of the lamella that are not as triangular as in A. coelus, but are more sloped than in A. coeloides. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1139.32.2:A54G, aly2204.12.2:C105T, aly322.29.22:A148T, aly1651.18.8:A60G, aly173.59.8:G40T, aly577.24.2:G204G (not A), aly3881.1.3:A85A (not C), aly423.1.3:T471T (not A), aly216.66.1:C2232C (not T), aly1405.20.17:A138A (not C); and COI barcode: T154C, T304C, T530C, T568C, A628T.

Barcode sequence of the holotype.

Sample NVG-18016E05, GenBank PV972417, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATACTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCCTCTTTAACTCTTTTAATTTCTAGAAGTATCGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCCCTTTCATCTAATATTGCTCACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCTTTATTTATTTGAGCTGTCGGAATTACAGCACTACTATTATTACTTTCATTACCTGTTTTAGCAGGAGCCATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 144–145 (genitalia Fig. 852–853), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMÁ: Darien Prov.| Cana 1100m. | 25-VII-81 | Gordon B. Small ], [ genitalia Vial | GTA-2981 ], [ Aguna coelus | (Stoll, [1781]) | det. G.T. Austin ], [ DNA sample ID: | NVG-18016E05 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450793 ], and one red [ HOLOTYPE ♀ | Aguna curvicoelus | Grishin ].

Type locality.

Panama: Darién Province, Cana, elevation 1100 m.

Etymology.

The name for this relative of A. coelus is given for rounder wing shape and curvier ventral hindwing white band. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in eastern Panama.

Aguna lumba Grishin, new species

https://zoobank.org/93F99296-390A-408C-8139-FCE549FDDBE8

(Fig. 5 part, 146–147, 854–855)

Definition and diagnosis.

This new species is related to Aguna coeloides Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia) and genetically differentiated from it at the species level (Fig. 5); e.g., although their COI barcodes differ by 1.5% (10 bp), the nuclear genome differentiation is more pronounced than the COI barcodes suggest, with F_st/G_min in the Z chromosome of 0.40/0.006. This new species keys to A. coeloides in Austin and Mielke (1998), but differs from it by a much more strongly developed and more elongated lobe of the ampulla; its dorsoposterior ridge that gradually levels (rather than forming a step) towards the serrated dorsal margin of the harpe, which is more prominent, with larger serrations; a more undulate costal margin of the valva; and a longer uncus compared to the tegumen. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly275215.14.1:A354G, aly275215.14.1:C416A, aly3512.12.3:G69A, aly594.12.25:T159C, aly1139.40.2:A105G; and COI barcode: A85C, T106C, T145T, T259T, T277C, T337G, T478C, T616C.

Barcode sequence of the holotype.

Sample NVG-18016H10, GenBank PV972418, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCATCCTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTGTATCCCCCCCTTTCATCTAATATTGCACATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACACTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAACTTATCATTTGATCAAATATCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGTGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 146–147 (genitalia Fig. 854–855), bears the following six printed rectangular labels, five white: [ ECUADOR: Sucumbíos, | Cerro Lumbaquí Norte, | 0° 01’70” N, 77° 19’22” W | 800–950 m, 18–22 Aug 2002 | J.P.W. Hall & M.A. Solis ], [ DNA sample ID: | NVG-18016H10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G04 | c/o Nick V. Grishin ], [ genitalia | NVG241118–28 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450826 ], and one red [ HOLOTYPE ♂ | Aguna lumba | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-18016H11, USNMENT 01450827, the same data as the holotype.

Type locality.

Ecuador: Sucumbíos Province, Cerro Lumbaquí Norte, elevation 800–950 m, approx. GPS 0.0283, −77.3203.

Etymology.

The name is derived from the type locality, mount Lumbaquí, and is treated as a noun in apposition.

Distribution.

Currently known only from the northeastern Ecuador.

Aguna yasuna Grishin, new species

https://zoobank.org/1288508E-3FF0-4CE3-AA4B-4A7084DB40A1

(Fig. 5 part, 148–149, 856–857)

Definition and diagnosis.

Sister to Aguna coeloides Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia) and genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 2.4% (16 bp), this new species keys to A. coeloides in Austin and Mielke (1998), but differs from it and other relatives by a narrower and more bulging posterodorsad lobe of the ampulla that is separated from the serrated dorsal margin of the harpe by a wider gap; a more concave in the middle ventral margin of the harpe; a narrower harpe; and a slightly longer uncus compared to the tegumen. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.132.2:G289A, aly536.132.2:T310C, aly528.39.11:A132T, aly37338.40.1:G1635A, aly37338.40.1:G1662A; and COI barcode: A85A, A229G, T259C, A274T, T355C, T400C.

Barcode sequence of the holotype.

Sample NVG-18016G10, GenBank PV972419, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGATATGGCATTTCCTCGAATAAATAATATAAGATTCTGACTTTTACCTCCTTCCTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCCCCTTTCATCCAATATTGCACACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 148–149, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ ECUADOR: Orellana Prov | Yasuni Research Station | Rios Tivacuno & Tiputini | 76° 23.8’ W, 0, 40.5’ S | 29 October 1998, 220 m. | D.H.Ahrenholz MD leg. ], [ DNA sample ID: | NVG-18016G10 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450821 ], and one red [ HOLOTYPE ♂ | Aguna yasuna | Grishin ]. Paratype: 1♂ NVG-18017A01 (leg, DNA sequenced), NVG-22036B09 (abdomen, DNA stored), USNMENT 01450829 Ecuador, Orellana, Tiputini Biodiversity Station, Lower Rio Tiputini, 200 m, GPS −0.6320, −76.1442, 10–15-Aug-2002, J. P. W. Hall and M. A. Solia leg., genitalia NVG241118–27 (Fig. 856–857) [USNM].

Type locality.

Ecuador: Orellana Province, Yasuní Research Station near Río Tiputini, elevation 220 m, GPS −0.6750, −76.3967.

Etymology.

The name is derived from the type locality, Yasuní Research Station, and is treated as a noun in apposition.

Distribution.

Currently known only from the northeastern Ecuador.

Aguna stenozonius Grishin, new species

https://zoobank.org/61243439-39A6-466D-BEA3-4F12C06C84D4

(Fig. 5 part, 150–151, 858–859)

Definition and diagnosis.

Sister to Aguna aurunce (Hewitson, 1867) (type locality in Brazil: Amazonas) this new species keys to it in Austin and Mielke (1998), but is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 2.7% (18 bp). This new species differs from its relatives by the reduced pale coloration, a very small dorsal spot, and a narrower ventral hindwing white band; the wings are less rounded and more elongated towards the tornus, without a tail, semihyaline spots by the forewing costa are slightly and progressively offset distad from the discal cell spot; the harpe is less narrowing distad and has a more strongly developed serrated dorsal edge, a more bulging ampulla, and longer uncus arms. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1019.20.2:G708A, aly923.25.1:G508T, aly923.25.1:A1456C, aly923.25.1:T1557C, aly1931.14.3:C117G, aly923.25.1:A1458A (not C), aly525.105.1:C411C (not G), aly423.27.3:A42A (not T), aly1139.26.41:C46C (not T), aly1139.26.41:T54T (not C); and COI barcode: T49C, T118C, T121C, T157C, A229G, A412T.

Barcode sequence of the holotype.

Sample NVG-18016H07, GenBank PV972420, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAGTAGGAACTTCCTTAAGACTTCTTATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAACACCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATGGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGAAGCATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTCTCCACTAATATTGCACACCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAACTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCATTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTCTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 150–151 (genitalia Fig. 858–859), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ GUYANA: Acarai Mts. | Sipu R. 900’-2500’ | 29.X.-12.XI.2000 | 1°23.2’N 58°56.8’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-18016H07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B05 | c/o Nick V. Grishin ], [ genitalia | NVG241118–31 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00179795 ], and one red [ HOLOTYPE ♂ | Aguna stenozonius | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana: Acarai Mts., Sipu River, elevation 900’–2500’, GPS 1.3867, −58.9467.

Etymology.

The subspecies epithet of its relative, A. aurunce hypozonius, is formed from Greek roots: ὑπό (hypo-) means under or beneath (referring to the ventral side), and zonius is a Latinized form of ζώνη (zone), meaning belt or girdle (referring to the white stripe). In the new species, the ventral “belt” is narrow, and στενό- (Steno-) means narrow in Greek. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Guyana.

Aguna latifasciata Grishin, new species

https://zoobank.org/593AFE00-0B0B-448A-86E8-1BB04B540983

(Fig. 5 part, 152–153, 860–861)

Definition and diagnosis.

A specimen from Northern Peru identified as Aguna latifascia Austin and O. Mielke, 1998 (type locality in Ecuador: Limoncocha) is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore it represents a new species. This new species keys to A. latifascia in Siewert et al. (2015), but differs from it and other relatives in the following ways. The shape of the ventral hindwing white band is as in A. latifascia, i.e., strongly enlarged from the vein M₁ posteriad, but the costal portion (spots in cells Sc+R₁-Rs and Rs-M₁) is reduced to a narrow line. In male genitalia, the new species is more similar to Aguna prasinus Siewert, Leviski, O. Mielke and Casagrande, 2015 (type locality in Panama) in having a dorsal portion of the harpe nearly triangular, but the distal part of the harpe is longer and more rounded, and the valva is narrower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly527.15.5:T156C, aly2582.38.3:C506G, aly1146.35.5:G54C, aly25.6.4:A2138G, aly2487.16.4:A245G, aly144.33.1:A61A (not G), aly85.33.2:T1428T (not C), aly4645.9.5:C72C (not A), aly529.13.6:C63C (not T), aly2379.8.3:G45G (not A); and COI barcode: T103C, G389A, A412G, T442C, T500C, 610C.

Barcode sequence of the holotype.

Sample NVG-18016F06, GenBank PV972421, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCTGGTTTAGTTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTCTGATTATTACCTCCATCTTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGTACTGGATGAACTGTTTACCCACCTCTTTCATCTAATATTGCTCATCAAGGAGCTTCTGTAGACTTAACAATTTTCTCTTTACATTTAGCGGGTATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCACTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 152–153 (genitalia Fig. 860–861), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ PERU: Loreto Prov. | Rio Amazonas, 200m | Explorama Inn, 25 | mi E Iquitos; 9–12 | & 17–21 Sept. 1990 | Ron Leuschner ], [ MONA/ 8 | EPARGYREUS | EXADEUS | Det.R.Leuschner ], [ DNA sample ID: | NVG-18016F06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036B06 | c/o Nick V. Grishin ], [ genitalia | NVG241118–26 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450805 ], and one red [ HOLOTYPE ♂ | Aguna latifasciata | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Loreto Region, 25 mi east of Iquitos, Amazon River, Explorama Lodge, elevation 200 m.

Etymology.

The name is formed from the name of its relative, A. latifascia, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northeastern Peru.

Lobotractus bajasur Grishin, new species

https://zoobank.org/9EA96A01-D181-4CEA-B202-1E8174082DEE

(Fig. 5 part, 154–155, 862–863)

Definition and diagnosis.

Genomic analysis of Lobotractus Grishin, 2019 (type species Eudamus valeriana Plötz, 1881) reveals an unnamed clade of specimens from Baja California Sur, Mexico, that is sister to both Lobotractus mysie (Dyar, 1904) (type locality in USA: Arizona, Patagonia Mountains) and Lobotractus valeriana (Plötz, 1881) (type locality in Mexico) and is genetically differentiated from them at the species level (Fig. 5); e.g., their COI barcodes differ by 6.5%–6.7% (43–44 bp), and therefore this clade represents a new species. This new species keys to “Thorybes valeriana” (C.19.6) in Evans (1952), but differs from it and other relatives in the following ways: from a more distant relative Lobotractus uvydixa (Dyar, 1914) (type locality in Mexico: Guerrero) by the darker ventral side of wings with less contrasting bands, the terminally narrower harpe (more massive in L. uvydixa), thus being more similar to L. mysie and L. valeriana, but the harpe is longer than in L. valeriana, more strongly curved dorsad; the lobe of the ampulla is larger and broader, closely connected to the harpe, thus not leaving a gap and curving inward with its triangular portion seen in the dorsal view; and uncus arms being knob-like rather than strongly separated as in other species. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4265.5.1:C9T, aly4265.5.1:A87G, aly577.7.2:G126A, aly577.7.2:C139A, aly3616.11.2:A69C; and COI barcode: T50C, T70C, A79T, T263C, A373G, T641C.

Barcode sequence of the holotype.

Sample NVG-23071H01, GenBank PV972422, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACATCACTAAGTCTTCTTATTCGTACCGAATTAGGTACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGACTAGTACCCCTTATACTAGGAGCCCCTGATATAGCATTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCATCCTTAACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTTTATCCCCCTCTTTCTACTAATATTGCTCATCAAGGGGCTTCAGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAGATTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACCTCATTCTTCGACCCAGCAGGTGGGGGAGATCCTATTCTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 154–155, bears the following three printed rectangular labels, two white: [ San Andres | 27-VIII-07 Mexico | Baja Cal. Sur | Wet canyon west | of Biosphera | Mark Walker leg. ], [ DNA sample ID: | NVG-23071H01 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Lobotractus | bajasur Grishin ]. Paratypes: 5♂♂ from Mexico: Baja California Sur: 1♂ NVG-23071H02 (leg, DNA sequenced), NVG-24016B12 (abdomen, DNA stored) data as the holotype, genitalia NVG241220–06 (Fig. 862–863); 2♂♂ Bahia de la Concepcion, 10-Sep-1968, C. Callaghan leg. [MGCL]: NVG-15102D02 genitalia X-2087 J. M. Burns 1985 and NVG-15102D01; 1♂ NVG-15105B04 Ayo. Candelaria, 26-Nov-1961, genitalia 1437 J. M. Burns 1984 [CAS]; and 1♂ NVG-15105B02 1 mi E of Migrimo, 18-Jul-1971, H. G. Real and R. E. Main leg. [CAS].

Type locality.

Mexico: Baja California Sur, San Andrés.

Etymology.

The name is derived from the state of the type locality and is treated as a noun in apposition.

Distribution.

Baja California Sur in Mexico.

Lobotractus myseriana Grishin, new species

https://zoobank.org/31BA364B-CF70-4DC9-A5EF-BE0DDE031654

(Fig. 5 part, 156–159, 864–865)

Definition and diagnosis.

Genomic analysis of Lobotractus Grishin, 2019 (type species Eudamus valeriana Plötz, 1881) reveals an unnamed clade of specimens from Oaxaca, Mexico, that is sister to both Lobotractus mysie (Dyar, 1904) (type locality in USA: Arizona, Patagonia Mountains) and Lobotractus valeriana (Plötz, 1881) (type locality in Mexico) in the nuclear genome tree and is genetically differentiated from them at the species level (Fig. 5); e.g., their COI barcodes differ by 4.4%–4.9% (29–32 bp), therefore representing a new species. This new species keys to “Thorybes valeriana” (C.19.6) in Evans (1952), but differs from it and other relatives in the following ways: from a more distant relative Lobotractus uvydixa (Dyar, 1914) (type locality in Mexico: Guerrero) by the terminally narrower harpe (more massive in L. uvydixa), thus being more similar to L. mysie and L. valeriana, but even narrower than in them, shorter, and less curved dorsad; the lobe of the ampulla is long but narrower, does not strongly curve inward and appears flat in dorsal view, and there is a gap between it and the harpe; the uncus arms are more divergent, i.e., in dorsal view, the uncus broadens distad more strongly than in relatives. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.149.4:G795A, aly16.5.1:G15A, aly4550.4.1:C48T, aly1603.73.3:A67T, aly1603.73.3:C107T; and COI barcode: T4C, A22G, C205T, T397C, A631G.

Barcode sequence of the holotype.

Sample NVG-15102C10, GenBank PV972423, 658 base pairs:

AACCTTATATTTTATTTTCGGGATCTGGGCAGGATTAATTGGTACTTCATTAAGATTACTTATTCGTACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTCTTATATTAGGAGCCCCTGATATAGCATTCCCCCGTATAAATAATATAAGATTTTGATTATTACCCCCATCCTTAACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTTTACCCCCCTCTTTCTACTAATATTGCTCATCAAGGAGCTTCAGTAGATCTAGCAATTTTCTCATTACATTTAGCAGGAATTTCCTCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAACATACGAATTAATAGCTTATCATTTGATCAAATACCCTTATTTGTTTGAGCTGTTGGAATTACAGCCTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGAGGAGGGGATCCAATTTTATATCAACATCTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 156–157, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ MEXICO: OAXACA | Hwy 175, c. 5 mi N | Oaxaca, c. 6000 ft | 17° 03’ N 96° 43’ W | 26-VII-1991 J.Kemner ], [ Codatractus mysie | (Dyar) | ♂ |det. J.M.Burns 1996 ], [ DNA sample ID: | NVG-15102C10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Lobotractus | myseriana Grishin ]. Paratypes: 7♂♂ the same locality and collector as the holotype: 1♂ NVG-23071G08 30-Apr-1988 [TMMC]; 1♂ NVG-15102C08 22-Jul-1988, genitalia X-3239 J. M. Burns 1991 [USNM]; 1♂ NVG-15099E11 (leg, DNA sequenced), NVG-23108C04 (abdomen, DNA stored) 22-Jul-1988, genitalia NVG241118–33 (Fig. 864–865) [CMNH] (Fig. 158–159); 1♂ NVG-15102C09 26-Jul-1988, genitalia X-3238 J. M. Burns 1991 [USNM]; 1♂ NVG-23068F08 10-Aug-1988 [TMMC]; 1♂ NVG-15099B07 19-Jun-1989 [CMNH]; and 1♂ NVG-15102C11 3-Aug-1992, genitalia X-3585 J. M. Burns 1993 [USNM].

Type locality.

Mexico: Oaxaca, Tlalixtac, Hwy 175 ~5 mi north of Oaxaca, elevation ~6000’.

Etymology.

The name is a fusion of the names of two relatives of this species: mys[ie] + [val]eriana, and is treated as a noun in apposition.

Distribution.

Currently known only from around the type locality.

Comment.

GPS coordinates specified on the locality label of the holotype point inside Oaxaca City and not 5 mi north of it.

Lectotype designation for Eudamus philistus Hopffer, 1874

Eudamus philistus Hopffer, 1874 was described from an unstated number of males collected in Chanchamayo (Junín, Peru). We located and sequenced a single syntype of E. philistus in the MFNB collection (NVG-15031D07). The syntype is missing tornal areas of both wings, and was assumed to be tailless, but a long-tailed specimen was identified as Ridens philistus by Bernard Hermier in the Museum d’Histoire Naturelle de Genève, and our genomic analysis reveals that the syntype is conspecific with a tailed species sister to Ridens harpagus (C. Felder and R. Felder, 1867) (type locality Colombia: Bogotá) (Fig. 5). To define the taxonomic identity of the name E. philistus objectively, N.V.G. hereby designates the syntype in the MFNB collection, the male with the following six rectangular labels (1^st red, 4^th green, others white; 3^rd and 4^th handwritten, others printed): [ Lectotypus ], [ 16219 ], [ Fühler rechts | angesetzt! ], [ Philistus | Hpfr* | Chanchamayo | Peru Theod. Müll ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 940b1a ], and [ DNA sample ID: | NVG-15031D07 | c/o Nick V. Grishin ] as the lectotype of Eudamus philistus Hopffer, 1874. The lectotype is missing tornal areas (and tails) of both hindwings, and only the anterior part of the left hindwing is present. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15031D07, GenBank PV972424, 658 base pairs is:

AACTTTATACTTTATTTTTGGAATCTGAGCTGGTTTAATTGGAACTTCATTAAGATTACTTATTCGTACTGAATTAGGAATTCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTCTTACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACAGGTTGAACGGTTTATCCCCCTCTTTCAACTAATATTGCCCACCAAGGAGCATCTGTTGACTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTATTACTTTCTTTACCTGTATTAGCAGGAGCTATTACCATATTACTTACTGATCGAAACTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGGGACCCAATTTTATATCAACACTTATTT

Ridens philia Evans, 1952 is a species distinct from Ridens philistus (Hopffer, 1874)

Genomic analysis reveals that the lectotype of Ridens philistus (Hopffer, 1874) (type locality Peru: Junín, Chanchamayo) is in a different clade from Ridens philistus philia Evans, 1952 (type locality in Colombia: Cauca), and therefore these two taxa are distinct species (Fig. 5). Hence, we propose that Ridens philia Evans, 1952, new status, is a species-level taxon. The origin of Evans’ (1952) mistake is the misidentification of R. philistus, which is a tailed species, but Evans assumed it was tailless due to its drawings depicting a tailless butterfly, possibly the damaged syntype (missing both tails, designated as the lectotype above). The species that Evans identified as R. philistus does not have a name and is new, described next.

Ridens ankon Grishin, new species

https://zoobank.org/3E1412FA-0850-411D-AB6E-E726DF6DC54B

Fig. 5 part, 160–161)

Definition and diagnosis.

This is the species that Evans (1952) misidentified as Ridens philistus (Hopffer, 1874) (type locality in Peru, a tailed species, see above), and therefore keys to it (C.12.5(b)) in Evans (1952). As Evans suggested, this new species is indeed closely related to Ridens philia Evans, 1952, new status (type locality in Colombia) (Fig. 5, COI barcode difference of 1.7% (11 bp)), but differs from it and other relatives by the absence of hindwing tails (present in R. philistus), the hyaline spot in the cell M₃-CuA₁ extending basad till the origin of the vein CuA₁, and the prominently developed subapical band of six spots (weakly expressed, some spots absent in R. philia) that is strongly bent in the middle at a nearly right angle in an elbow-like fashion, but not lamed-shaped (⌧) as in R. philistus. This species is not cryptic and can be recognized by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly2178.54.1:A1185G, aly193.3.2:G643A, aly193.3.2:A645C, aly1468.24.2:A201T, aly848.2.7:G85C, aly390.20.4:A45A (not C), aly127.88.6:G124G (not C), aly276558.34.1:G2127G (not A), aly2874.5.3:T111T (not C), aly216.25.1:T72T (not C); and COI barcode: A268G, A373A, A415G, T514T, T523C, 559A.

Barcode sequence of the holotype.

Sample NVG-22072B07, GenBank PV972425, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGCTTAATTGGAACTTCCTTAAGATTACTTATTCGTACTGAATTAGGAATTCCCGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCACATGCCTTTATCATAATCTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGATTATTGCCCCCATCTCTTACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAACTAATATTGCCCATCAAGGAGCATCTGTCGACTTAGCCATTTTTTCTCTTCATTTAGCTGGGATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATGCGAATTAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATCACAGCATTATTATTATTACTTTCTTTACCTGTATTAGCAGGAGCTATTACCATATTACTTACCGATCGAAACTTAAATACTTCATTTTTTGATCCTGCAGGAGGTGGGGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 160–161, bears the following four printed rectangular labels, three white: [ ECUADOR: CHIMBORAZO | Atzatapungu, 4100 m | v.1976; R. de Lafebre ], [ A. C. Allyn | Acc. 1976–8 ], [ DNA sample ID: | NVG-22072B07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Ridens ankon | Grishin ].

Type locality.

Ecuador: Chimborazo, Atzatapungu, elevation 4100 m.

Etymology.

In Greek, ἀγκών (ankōn) means elbow, bend, or corner. The name is given for an L-shaped band of forewing apical spots and is a noun in apposition.

Distribution.

Currently known from Ecuador (the holotype) and Peru (per Evans (1952), specimens not included in the type series).

Lectotype designation for Eudamus fulminans Herrich-Schäffer, 1869

Eudamus fulminans Herrich-Schäffer, 1869 was described from an unstated number of specimens collected in Tropical America (no further locality details). We located and sequenced a single syntype of E. fulminans in the MFNB collection (NVG-15031B06) with the locality “Brazil” on one of the labels. Genomic analysis places it among specimens from South Brazil, suggesting that it might have been collected there (Fig. 5). To define the taxonomic identity of the name E. fulminans objectively, N.V.G. hereby designates the syntype in the MFNB collection, the female with the following six rectangular labels (1^st purple, others white; 2^nd, 4^th, and 5^th handwritten, others printed): [ Origin. ], [ fulminans m. | Brasil. ], [ Coll. H.–Sch. ], [ Thym. Fulminans | HS. ], [ Fulminans | H-Sch. ], and [ DNA sample ID: | NVG-15031B06 | c/o Nick V. Grishin ] as the lectotype of Eudamus fulminans Herrich-Schäffer, 1869. The original text on the 2^nd label is in Herrich-Schäffer’s handwriting and “m” stands for “mihi” (Latin for “of me”), placed after a species name as an attribution of the new species to the writer. This notation was common over a century ago, instead of the author’s name being written directly. This “m” confirms that the label was written by Herrich-Schäffer, and it offers additional evidence that this specimen was a syntype. The word ‘Brasil’ on this label is in darker ink and was added later (not clear by whom). The 4^th label is in Staudinger’s handwriting. The lectotype is missing its head, abdomen, and nearly the entire right hindwing. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). As a result, the type locality of R. fulminans is in Brazil, likely in southern Brazil as deduced by genomic comparison. The COI barcode sequence of the lectotype, sample NVG-15031B06, GenBank PV972426, 658 base pairs is:

AACTCTATATTTTATTTTTGGAATTTGAGCCGGTTTAATTGGAACTTCCCTAAGATTACTTATTCGTACTGAATTGGGAATCCCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCGCACGCCTTTATTATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGACTAGTACCCCTAATATTGGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTCTTACCCTTTTAATTTCCAGAAGAATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAACTAATATTGCCCACCAAGGAGCATCTGTCGACTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACGATTATTAATATACGAATTAATAACTTATCATTTGACCAAATACCTTTATTTATCTGAGCTGTCGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTATTGGCAGGGGCTATTACCATATTACTTACCGATCGAAATTTAAATACTTCATTTTTTGATCCCGCTGGAGGGGGGGACCCAATTTTATATCAACATTTATTT

Ridens fulima Evans, 1952 is a junior subjective synonym of Ridens fulminans (Herrich-Schäffer, 1869)

Genomic analysis places the lectotype of Ridens fulminans (Herrich-Schäffer, 1869) (type locality in Brazil, likely in southern Brazil as deduced by genomic comparison) (Fig. 5) among specimens from South Brazil that we identified as Ridens fulima Evans, 1952 (type locality in Brazil: Espirito Santo), suggesting that they are conspecific. Therefore, we propose that Ridens fulima Evans, 1952 is a new junior subjective synonym of Ridens fulminans (Herrich-Schäffer, 1869). Because Evans misidentified R. fulminans, he re-described it as R. fulima, but the species he misidentified as R. fulminans does not have a name and is described next as new.

Ridens fulmina Grishin, new species

https://zoobank.org/2C9BB832-D5A7-4425-B8B3-A6208751E76B

(Fig. 5 part, 162–165, 866–867)

Definition and diagnosis.

This new species is another misidentification by Evans (1952), who misidentified it as Ridens fulminans (Herrich-Schäffer, 1869) (type locality in Brazil, likely in southern Brazil as deduced by genomic comparison). Thus, specimens of this new species key to “R. fulminans” (C.12.7) in Evans (1952), which simply is this species, in part, except at least a male from Bolivia that Evans called “aberrant,” which is Ridens angulinea Grishin, 2023 (type locality in Peru). In brief, the hindwing is lobed but not tailed, the body and wing bases above are greenish-blue, hindwing fringes are white at the tornus, the hyaline spot in the forewing cell CuA₁-CuA₂ is with about equally long upper and lower edges and its inner edge is offset distad from the discal cell spot, but the two spots still overlap (spots are not as narrow as in R. angulinea), and the spot in the forewing cell M₃-CuA₁ extends basad till the origin of the vein CuA₁ but is not merged into the discal band as in R. fulminans. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly640.4.12:A69G, aly2774.17.3:T201A, aly2774.17.3:G240A, aly420.48.11:G51C, aly420.48.11:C90A; and COI barcode may not distinguish it from other species, possibly due to introgression.

Barcode sequence of the holotype.

Sample NVG-14104D03, GenBank PV972427, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGCTTAATTGGAACTTCCTTAAGATTACTTATTCGTACCGAATTAGGAATTCCCGGTTCTTTAATTGGCGATGACCAAATTTATAATACTATTGTAACAGCACATGCCTTTATCATAATCTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCATCTCTTACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAACTAATATTGCCCATCAAGGGGCATCTGTCGACTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATGCGAATTAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCCGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTATTGGCAGGAGCTATTACCATATTACTTACCGATCGAAACTTAAATACTTCATTTTTTGATCCTGCAGGAGGCGGAGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 162–163 (genitalia Fig. 866–867), bears the following four printed rectangular labels, three white: [ PERU: Huanuco | Tingo Maria, 800 m. | May-June, 1994 ], [ genitalia NO. | X-56 73 | J.M.Burns 2003 ], [ DNA sample ID: | NVG-14104D03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Ridens fulmina | Grishin ]. Paratypes: 3♂♂ from Peru: 1♂ NVG-21114H04 (leg, DNA sequenced), NVG-23081A12 (abdomen, DNA stored) Huayabamba, old [ca. 1900], Garlepp leg., genitalia NVG240912–08 [MFNB] (Fig. 164–165) and Huánuco, Tingo Maria: 1♂ NVG-18089A10 650 m, no date, ex coll. Rojas Villegas [EBC] and 1♂ NVG-22099G04, CASENT8566826 12-Nov-1966, coll. Thomas W. Davies [CAS].

Type locality.

Peru: Huánuco Region, Tingo María, elevation 800 m.

Etymology.

The name is a shorter version of the name (fulminans) Evans incorrectly assigned to this species and is treated as a noun in apposition.

Distribution.

Currently known only from Peru.

Ridens gracilis Grishin, new species

https://zoobank.org/2BE1CED7-BD61-46E8-ADFE-D482C8150AAA

(Fig. 5 part, 166–167, 868–869)

Definition and diagnosis.

Genomic analysis of a Ridens Evans, 1952 (type species Eudamus ridens Hewitson, 1876) specimen from Panama that keys to Ridens fulima Evans, 1952 (type locality in Brazil: Espirito Santo) (C.12.8) in Evans (1952) reveals that it is sister to Ridens bridgmani (Weeks, 1902) (type locality in Bolivia) (Fig. 5), and therefore represents a new species. This new species differs from its relatives by only faint greenish-blue overscaling on wing bases above while having strongly greenish-blue dorsal side of the body; more gracile wings: the forewing is elongated towards the apex and the hindwing has a longer tornus; a relatively straight forewing hyaline band with spots aligned with each other; a small dash near the band in the cell M₃-CuA₁; and four subapical spots of average size for the genus. This species is not cryptic and is recognizable by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1260.20.3:A43C, aly1260.20.3:A45G, aly862.3.3:A63T, aly216.66.1:T2364C, aly216.66.1:A2433C, aly5412.2.1:T61T (not A), aly5412.2.1:G94G (not A), aly54.33.1:T651T (not C), aly528.14.2:G105G (not T), aly235.6.1:T144T (not G); and COI barcode: T187C, T349C, C364A, T403A, T427C.

Barcode sequence of the holotype.

Sample NVG-14104B11, GenBank PV972428, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGTACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTACCCCCATCATTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCACCCCTCTCAACTAATATTGCACATCAAGGAGCCTCTGTTGATTTAGCAATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATCCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAACTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 166–167 (genitalia Fig. 868–869), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PANAMA: 1200 m. | Darien, Cana | 1. Feb. 1984 | Gordon Small ], [ genitalia NO. | X-57 22 | J.M.Burns 2003 ], [ DNA sample ID: | NVG-14104B11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Ridens gracilis | Grishin ].

Type locality.

Panama: Darién Province, Cana, elevation 1200 m.

Etymology.

The name is given for straighter and more gracile wings and bands and is an adjective.

Distribution.

Currently known only from the holotype collected in eastern Panama.

Venada chiapa Grishin, new species

https://zoobank.org/68AE700E-1ACD-48EC-AAAA-324F12077F02

(Fig. 5 part, 168–169, 870–871)

Definition and diagnosis.

This new species is sister to Venada lamella Burns, 2013 (type locality in Costa Rica). but is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 3.2% (21 bp). This new species keys to Venada advena (Mabille, 1889) (type locality in Panama: Chiriqui) (C.18) in Evans (1952) and differs from its congeners by the following combination of characters: two semihyaline yellow dashes near the middle of the forewing costal margin are slightly offset distad from the discal spots and are partly overlapping with it; distal border of the forewing spot in cell M₃-CuA₁ away from the distal border of the spot in the discal cell; central semihyaline forewing spots are larger and apical spots are in line; somewhat broader wings in males; the uncus is longer compared to the tegumen, its arms are narrower and less widely separated from each other; the valva is longer, its costa has a narrower and more pronounced hump in the middle; the harpe is more angular, gradually narrowing dorsad after the sharp turn, with both margins rather straight in the lateral view. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2012.47.1:T1077C, aly159.16.1:A32G, aly159.16.1:T53C, aly133.32.2:T21C, aly133.32.2:A93G, aly2555.1.5:G65G (not A), aly2555.1.5:T67T (not C), aly349.37.3:T1149T (not C), aly2612.6.2:T4542T (not G), aly2612.6.2:A5595A (not G); and COI barcode: T79C, C85T, T475C, T536C, G622A, T637C.

Barcode sequence of the holotype.

Sample NVG-15022D03, GenBank PV972429, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGACTAGTAGGAACATCATTAAGATTACTAATTCGTACTGAATTAGGCACCCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGACTATTACCTCCATCATTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTATACCCCCCTCTTTCAACTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGCGAATTAACAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCTTTATTACTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCGGGAGGAGGGGACCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 168–169 (genitalia Fig. 870–871), bears the following eight printed (text in italics handwritten) labels, seven white: [ MEXICO: CHIAPAS | Sta. Rosa Comitan | VII.1968 | T. Escalante ], [ A. C. Allyn | Acc. 1973–48 ], [ SRS Database | No.135 ], [ MGCL/FLMNH | Specimen no. | 21270 ], [ DNA sample ID: | NVG-15022D03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24064C07 | c/o Nick V. Grishin ], [ genitalia | NVG241111–03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Venada chiapa | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Mexico: Chiapas, Santa Rosa Comitan.

Etymology.

The name is derived from the type locality and is treated as a feminine noun in apposition.

Distribution.

Currently known only from the holotype collected in Chiapas, Mexico.

Venada maria Grishin, new species

https://zoobank.org/42620731-6413-4872-AB7A-3A023553BDE7

(Fig. 5 part, 170–173, 872–873)

Definition and diagnosis.

This new species forms a clade with the next new species, and this clade is sister to Venada lamella Burns, 2013 (type locality in Costa Rica) but is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 5.5% (36 bp). This new species keys to Venada advena (Mabille, 1889) (type locality in Panama: Chiriqui) (C.18) in Evans (1952) and differs from its congeners by the following combination of characters: males with a single semihyaline yellow dash in the forewing cell Sc-R₁ strongly offset distad from the discal spots (not two dashes aligned with the spots or near them); the female paratype lacks the dash; central semihyaline forewing spots are smaller and apical spots are in line; the spot of the forewing discal band in upper part of cell CuA₂-1A+2A, very small, just traceable; a long harpe, reaching dorsad more than in all other species, and shorter uncus arms more widely separated posteriad. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly159.2.1:G111A, aly318.14.5:T1395C, aly318.14.5:A1485T, aly164.77.2:G285A, aly1282.22.1:A54C; and COI barcode: T103C, T121C, A211G, T547A, T595C.

Barcode sequence of the holotype.

Sample NVG-14112F02, GenBank PV972430, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACATCATTAAGATTACTAATTCGAACTGAATTAGGTACCCCCGGATCTTTAATTGGTGACGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCTCTTATGCTAGGAGCTCCTGATATAGCATTTCCACGTATAAATAATATAAGATTTTGACTATTACCTCCGTCATTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTATACCCCCCTCTTTCAACAAATATTGCCCATCAAGGAGCCTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAACATACGAATTAATAACTTATCATTTGATCAAATACCTTTATTTATCTGAGCAGTTGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACAATACTACTAACAGATCGAAACTTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 170–171 (genitalia Fig. 872–873), bears the following five printed labels, four white: [ Tingo Maria, | Peru X-07 ], [ DNA sample ID: | NVG-14112F02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24016C01 | c/o Nick V. Grishin ], [ genitalia | NVG241220–11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Venada maria | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. The holotype is originally from the collection of the Texas Lepidoptera Survey and is likely collected by E. C. Knudson. Paratype: 1♀ NVG23012C12 no data [ZSMC] (Fig. 172–173).

Type locality.

Peru: Huánuco Region, Tingo María.

Etymology.

The name is derived from the type locality and is a feminine noun in apposition.

Distribution.

Currently known only from central Peru.

Venada boliva Grishin, new species

https://zoobank.org/FDA0BA85-5C3E-447F-A111-730CCD5FD54C

(Fig. 5 part, 174–177, 874–875)

Definition and diagnosis.

This new species forms a clade with the previous new species, and this clade is sister to Venada lamella Burns, 2013 (type locality in Costa Rica), but is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 5.0% (33 bp). This new species keys to Venada advena (Mabille, 1889) (type locality in Panama: Chiriqui) (C.18) in Evans (1952) and differs from its congeners by the following combination of characters: two semihyaline yellow dashes near the middle of the forewing costal margin with their outer margin aligned with the outer margin of the discal cell spot; more rounded wings; pale-brownish hindwing fringes (darker than orange or orange-yellow of some other species); central semihyaline forewing spots are larger, only two or three forewing apical spots: spots in cells R₄-R₅ (in both specimens) and R₅-M₁ (in the paratype, in the holotype it is offset distad from the rest) are not expressed; distal border of the forewing spot in cell M₃-CuA₁ away from the distal border of the spot in the discal cell; the valva is almost rectangular, with a nearly straight costa; the harpe closely follows the distal margin of the valva, the gap between them is rather straight and narrow, the harpe is broader than in close relatives, it does not protrude much dorsad of the valva; the uncus arms are longer and more parallel to each other. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly876.8.1:T1317C, aly361.2.5:A337G, aly361.2.5:C345T, aly294.20.2:T55C, aly128.16.3:T135C; and COI barcode: T142C, A190G, A199C, A511G, A592G, A628G.

Barcode sequence of the holotype.

Sample NVG-22018B08, GenBank PV972431, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACATCATTAAGATTACTAATTCGCACTGAATTAGGTACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAATTGACTCGTACCCCTTATATTAGGAGCCCCTGATATAGCATTCCCTCGTATAAATAACATAAGATTTTGATTACTACCTCCATCACTAACCCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTATACCCCCCTCTTTCAACAAATATTGCCCATCAAGGAGCTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCATCCATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAACTTATCATTTGATCAAATACCTTTATTTATTTGGGCAGTTGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGGAATTTAAATACTTCATTTTTTGACCCTGCAGGAGGGGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 174–175 (genitalia Fig. 874–875), bears the following five labels (1^st handwritten, others printed), four white: [ Farinas | Boliv. ], [ DNA sample ID: | NVG-22018B08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23086D10 | c/o Nick V. Grishin ], [ genitalia | NVG241118–34 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Venada boliva | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-18056C07 Bolivia, Río Zongo, coll. Fassl [ZfBS] (Fig. 176–177).

Type locality.

Bolivia: La Paz Region, Farinas.

Etymology.

The name is derived from the country of the type locality and is treated as a feminine noun in apposition.

Distribution.

Currently known only from Bolivia.

Subtribe Cephisina Grishin, 2019

Cephise fulvus Grishin, new species

https://zoobank.org/B945885E-75A1-49B3-887B-93EF456BE0A4

(Fig. 6 part, 178–179, 876–878)

Definition and diagnosis.

Identified as Cephise glarus (Mabille, 1888) (type locality in Brazil: Pará), a specimen from Rondonia, Brazil, is genetically differentiated from it at the species level (Fig. 6); e.g., their COI barcodes differ by 6.8% (45 bp), and therefore it represents a new species. This new species keys to “Cephise cephise cephise” (D.6(a)) in Evans (1952) and was described under the name “Cephise glarus” by (Austin and Mielke 2000), who included this new species in C. glarus, the latter known to us only from the lectotype (sequenced as NVG-15031G09). The new species is most similar to C. glarus, but differs from it by a more elongated hindwing with a less convex outer margin and narrower tornal lobe; redder (instead of more yellow towards olive) wing bases above, smaller brown postdiscal spots within a reddish area on the dorsal hindwing, wider subapical spot near the forewing costal margin, a smaller semihyaline spot in the forewing cell CuA₂-1A+2A, and a semihyaline spot shifted farther distad in the forewing cell M₂-CuA₁, more noticeable by its larger distance from the discal cell spot. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly3268.14.13:C78T, aly272.5.2:A105C, aly1041.9.4:A66G, aly536.213.5:G223A, aly6517.5.2:A1816C, aly1405.20.11:G113G (not C), aly1297.13.7:A1112A (not G), aly1019.2.2:A79A (not C), aly671.22.3:T90T (not C), aly23605.21.2:G189G (not A); and COI barcode: T121A, T151C, T475C, A565G, T589C.

Barcode sequence of the holotype.

Sample NVG-24064H02, GenBank PV972432, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGATCCTCATTAAGACTTTTAATTCGAACTGAATTAGGAACTTGTGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTCACAGCTCATGCTTTTATTATAATCTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATGCTAGGAGCACCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTACTTCCCCCATCTTTAACTTTATTAATTTCAAGTAGTATCGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTCTCTTCTAATATTGCTCACCAAGGTTCTTCAGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTTCAACAATTATTAATATACGAATTAACAATATATCTTTTGATCAAATACCTTTATTTATCTGAGCTGTAGGAATTACAGCACTATTATTATTACTTTCTTTACCTGTTTTAGCAGGGGCTATTACTATACTTTTAACAGACCGAAACTTAAACACCTCTTTTTTTGATCCAGCAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 178–179 (genitalia Fig. 876–878), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ BRAZIL:Rondônia 62 | km SW Ariquemes, nr | Fzda Rancho Grande | 4–16-XI-1997 JEEger | MV & UV Lights ], [ Genetalic Vial | GTA-8876 ], [ DNA sample ID: | NVG-24064H02 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cephise | fulvus Grishin ]. Paratype: 1♂ (not sampled for DNA) Brazil, Rondonia, 62 km S Ariquemes, Linha C-20, 7 km E of B-65, Fazenda Rancho Grande, 16 Aug. 1993, genitalia vial GTA-3689.

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, near Fazenda Rancho Grande.

Etymology.

In Latin, fulvus means tawny, brownish-yellow, or reddish-yellow. The name refers to the tawny color of the wing bases in this species, brighter and more orange than in its congeners and is an adjective.

Distribution.

Currently known only from the holotype collected in Rondônia, Brazil.

Subtribe Telemiadina Grishin, 2019

Ectomis (Asina) sine Grishin, new species

https://zoobank.org/D599AC7B-1CAE-4226-A107-788ECE798DE5

(Fig. 6 part, 180–181, 879–881)

Definition and diagnosis.

In the genomic trees, specimens identified as Ectomis (Asina) asine (Hewitson, 1867) (type locality in Nicaragua) partition into two clades: in addition to E. asine represented by the larger clade, the second clade consisting of specimens from Mexico is sister to Ectomis (Asina) roma (Evans, 1952) (type locality in Brazil: Pará) and is genetically differentiated at the species level (Fig. 6); e.g., their COI barcodes differ by 4.6% (30 bp), and therefore this second clade represents a new species. This new species keys to “Polythrix asine” in Evans (1952), but differs from it and other relatives by the following combination of characters: four or five (not three) subapical hyaline spots on the forewing, the spot in the cell R₅-M₁ is offset distad from the rest (or all four spots are larger than in relatives); the spot in the cell M₃-CuA₁ appears slightly more inserted between the discal cell spot and the spot in the cell CuA₁-CuA₂ (not separated from them); the postdiscal lower spot in the cell CuA₂-1A+2A is relatively larger, and only slightly smaller than the basal spot; the tooth on the ampulla is longer than in E. asine; and the central notch in the lamella postvaginalis is shallower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1121.4.9:A75G, aly536.95.5:T99C, aly707.3.4:G159A, aly1019.13.1:T5577C, aly85.35.4:C120T; and COI barcode: T145C, A160G, A382G, T394C, T548C.

Barcode sequence of the holotype.

Sample NVG-17102C08, GenBank PV972433, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAACAGAATTAGGAACTCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATCATAATTTTTTTTATGGTTATACCCATTATAATTGGAGGATTTGGAAATTGACTTGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAACATAAGTTTTTGATTATTACCCCCTTCACTAACTCTTTTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGCTGAACAGTTTACCCCCCACTCTCAGCCAATATCGCTCATCAAGGATCTTCCGTGGATTTAGCAATCTTCTCATTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATCAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACTGCTTTACTTCTTCTTCTTTCTCTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 180–181 (genitalia Fig. 879–881), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Tamps. Mexico | Galeana Canyon | leg. E.C.Knudson | 12-X-76 ], [ DNA sample ID: | NVG-17102C08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G05 | c/o Nick V. Grishin ], [ genitalia | NVG241118–35 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913683 ], and one red [ HOLOTYPE ♀ | Ectomis (Asina) | sine Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 1♀ from Mexico: 1♂ NVG-23067D04 Tamaulipas, 1–4 km N of Gomez Farias, 19-Aug-1972, C. J. Durden leg. [TMMC] and Oaxaca, J. Kemner leg.: 1♂ NVG-23067D06 Candelaria Loxicha, 20-Feb-1988 [TMMC] and 1♀ NVG-23113E02 2 mi N of Candelaria Loxicha, 18-Oct-1988 [CMNH].

Type locality.

Mexico: Tamaulipas, Galeana Canyon.

Etymology.

The name removes the negating a- from the name of its close relative, E. asine, and is treated as a noun in apposition.

Distribution.

Currently known from Tamaulipas and Oaxaca in Mexico.

Lectotype designation for Eudamus caunus Herrich-Schäffer, 1869

Eudamus caunus Herrich-Schäffer, 1869 was described from an unstated number of specimens collected in Tropical America (no further locality details). We located and sequenced a single syntype of E. caunus in the MFNB collection (NVG-15029G06). Genomic analysis places it among specimens from Southeast and South Brazil, suggesting that it might have been collected there (Fig. 6). To define the taxonomic identity of the name E. caunus objectively, N.V.G. hereby designates the syntype in the MFNB collection, the female with the following eight rectangular labels (1^st purple, others white): [ Origin. ], [ Caunus | HS. ], [ asine Hew ], [ Coll. H.–Sch. ], [ Caunus | H.-Sch. ], [ GEN.PREP., | MIELKE | 1996 ], [ {QR Code} http://coll.mfn-berlin.de/u/ | e1f9b1 ], and [ DNA sample ID: | NVG-15029G06 | c/o Nick V. Grishin ] as the lectotype of Eudamus caunus Herrich-Schäffer, 1869. The lectotype is missing both antennae, the outer marginal area of the left hindwing, and a segment of the right hindwing outer margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). As a result, the type locality of E. caunus is likely in Southeast or South Brazil and will be deduced further by genomic sequencing of additional specimens. The COI barcode sequence of the lectotype, sample NVG-15029G06, GenBank PV972434, 658 base pairs is:

AACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGGACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTCGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCTCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTAATATCGCGCATCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCCTTATTTGTATGAGCTGTAGGTATTACAGCTTTACTTCTTCTTCTTTCTTTACCTGTTCTAGCTGGAGCTATTACTATACTTCTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Ectomis (Ectomis) lipas Grishin, new species

https://zoobank.org/E8A32A20-95EC-4BF9-8CDF-AB1AD0DAB313

(Fig. 6 part, 182–183, 882–883)

Definition and diagnosis.

Genomic analysis of specimens identified as Ectomis (Ectomis) caunus (Herrich-Schäffer, 1869) (type locality in Southeast or South Brazil as deduced by genomic comparison of the lectotype NVG-15029G06) reveals that they partition into two clades, genetically differentiated at the species level (Fig. 6); e.g., their COI barcodes differ by 3.5% (23 bp). One clade contains the lectotype of E. caunus, and the other clade, consisting of specimens from Tamaulipas, Mexico, corresponds to a distinct species. This new species keys to “Polythrix caunus” (C.7.10) in Evans (1952) and was included by him in this species, but differs from it by the tails being broader at the base in males; the hyaline spot in the forewing cell M₃-CuA₁ being less inserted between the spots in the discal cell and the cell CuA₁-CuA₂; a broader and straighter along the dorsal margin basal prong of the harpe, protruding less dorsad of the ampulla; and a narrower distal segment of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly314.7.1:G856A, aly640.2.5:G535A, aly747.2.1:G622A, aly531.29.1:T171C, aly531.29.1:T172A; and COI barcode: T49C, C81T, T304C, C318T, A592T.

Barcode sequence of the holotype.

Sample NVG-19013F05, GenBank PV972435, 658 base pairs:

AACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAATTCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCCTCATTAATACTATTAATTTCAAGAAGAATCGTTGAAAACGGAGTAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTAATATTGCACATCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGACCAAATACCCTTATTTGTATGAGCTGTAGGTATTACAGCTCTTCTTCTTCTTCTTTCTTTACCTGTTCTAGCTGGAGCTATTACTATACTTCTAACAGATCGTAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 182–183 (genitalia Fig. 882–883), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ MEXICO: | Tamaulipas | Rancho Pico de Oro | nr. Los Kikos ], [ coll. 24-Jan-1975 | Roy O. Kendall | & C. A. Kendall ], [ HESPERIIDAE, | Pyrginae: | Polythrix caunus | (Herr.-Schaef., 1869) | det. R.O. Kendall | ♂ M. & B. No. 19.1 ], [ DNA sample ID: | NVG-19013F05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Ectomis (Ectomis) | lipas Grishin ]. Paratypes: 1♂ and 2♀♀ from Mexico, Tamaulipas: 1♀ NVG-17113H06 Paso del Abra, nr. El Abra, 14-Nov-1974, Roy O. Kendall and C. A. Kendall leg. [TAMU] and 1–4 km N of Gomez Farias, C. J. Durden leg. [TMMC]: 1♂ NVG-19124E07 19-Aug-1972 and 1♀ NVG-19125B01 26-Dec-1972.

Type locality.

Mexico: Tamaulipas, Rancho Pico de Oro, nr. Los Kikos.

Etymology.

The name is derived from the Mexican state of the type locality, [Tamau]lipas, and is treated as a noun in apposition.

Distribution.

Currently known only from Tamaulipas in Mexico.

Ectomis flammula (Herrich-Schäffer, 1869) is a species distinct from Ectomis auginus (Hewitson, 1867)

Genomic analysis of a syntype of Eudamus flammula Herrich-Schäffer, 1869 (type locality in Tropical America, sequenced as NVG-15029G02) currently treated as a junior subjective synonym of Ectomis auginus (Hewitson, 1867) (type locality Brazil: Amazonas, Tefé) places it in a clade different from E. auginus, and instead closer to Ectomis caunus (Herrich-Schäffer, 1869) (type locality in Tropical America) away from all known species (Fig. 6). Therefore, we propose that Ectomis flammula (Herrich-Schäffer, 1869), reinstated status, is a species distinct from Ectomis auginus (Hewitson, 1867).

To define the taxonomic identity of the name E. flammula objectively, N.V.G. hereby designates the syntype in the MFNB collection, the female with the following seven rectangular labels (1^st purple, others white): [ Origin. ], [ auginus ], [ Coll. H.–Sch. | Surinam ], [ Flammula | H-Sch. ], [ GEN.PREP., | MIELKE | 1996 ], [ {QR Code} http://coll.mfn-berlin.de/u/ | e1f9e2 ], and [ DNA sample ID: | NVG-15029G02 | c/o Nick V. Grishin ] as the lectotype of Eudamus flammula Herrich-Schäffer, 1869. The lectotype is missing both antennae and the right hindwing tail. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). As a result, the type locality of E. flammula becomes Suriname, as stated on the label of the lectotype, and will be tested by genomic sequencing of specimens from the Guianas. The COI barcode sequence of the lectotype, sample NVG-15029G02, GenBank PV972436, 658 base pairs is:

AACTTTATACTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAACTGAATTAGGAACACCCGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTCTTATATTAGGAGCCCCCGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACATTATTAATCTCAAGAAGAATTGTTGAAAACGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTAATATTGCACATCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATCACAACAATTATTAATATACGAATTAGAAATTTATCATTTGACCAAATACCTTTATTTGTGTGAGCTGTAGGTATTACAGCTTTACTTCTTCTTCTTTCTTTACCTGTCTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATCTAAATACTTCATTTTTTGATCCTGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Ectomis (Ectomis) pernicioides Grishin, new species

https://zoobank.org/3ECE9441-57D8-48B6-99DA-E3AB2743031E

(Fig. 6 part, 184–185, 884–885)

Definition and diagnosis.

Genomic analysis of a specimen from South Brazil identified as Ectomis (Ectomis) perniciosus (Herrich-Schäffer, 1869) (type locality in Tropical America) reveals that it is genetically differentiated from it at the species level (Fig. 6); e.g., their COI barcodes differ by 3.2% (21 bp), and therefore it represents a new species. This new species keys to “Chrysoplectrum perniciosus perniciosus” (C.9.4(b)) in Evans (1952), but differs from it by the discal cell spot being nearly triangular, not square as in a typical E. perniciosus; less developed pale overscaling in the submarginal area of the ventral hindwing; the harpe being closer to the ampulla, and the two distal teeth of the harpe being sharper, not rounded. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly531.17.4:G45T, aly240.15.5:C129T, aly6654.11.5:T28C, aly6654.11.5:T33C, aly1838.61.1:C462T, aly1155.9.2:T261T (not C), aly1260.11.10:T129T (not C), aly2487.15.1:G98G (not T), aly2487.15.1:G99G (not T), aly1313.27.7:T1098T (not C); and COI barcode: T46C, T169C, T529C, A622C, T637C.

Barcode sequence of the holotype.

Sample NVG-21126E08, GenBank PV972437, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGACTTGTCCCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAACCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTAATATTGCACATCAAGGTTCATCTGTAGATTTAGCAATTTTCTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCCCTTCTTCTTCTTTTATCATTACCTGTATTAGCAGGAGCAATTACTATACTTTTAACAGATCGAAACCTAAATACCTCATTTTTTGACCCTGCCGGAGGGGGGGATCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 184–185 (genitalia Fig. 884–885), bears the following five rectangular labels (1^st handwritten, others printed), four white: [ Cas. Bra. | G. ], [ DNA sample ID: | NVG-21126E08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23081B01 | c/o Nick V. Grishin ], [ genitalia | NVG240912–09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Ectomis (Ectomis) | pernicioides Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: São Paulo, Casa Branca.

Etymology.

In Latin, perniciosus means destructive, highly injurious, ruinous, or deadly. It is unclear why this name was given to the sister of this new species. The name of the new species adopts the root from perniciosus forming a longer name for this more southern species and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Southeast Brazil.

Ectomis (Ectomis) albovenissima Grishin, new species

https://zoobank.org/771FB0A5-34A7-4576-8E89-4EF473F3EFE3

(Fig. 6 part, 186–187, 886–887)

Definition and diagnosis.

Three unusual-looking specimens of Ectomis Mabille, 1878 (type species Ectomis adoxa Mabille, VI-1878, which is a junior subjective synonym of Plesioneura cythna Hewitson, IV-1878) from South Brazil form a clade sister to several other species (Fig. 6), and therefore they represent a new species that keys (incompletely) to “Chrysoplectrum albovenae” (C.9.7) in Evans (1952). It differs from all other species by veins on both sides of the wings far more conspicuously whitish than in C. albovenae and by the absence of the semihyaline discal band present in the latter. This species is not cryptic and is reliably diagnosed by phenotype. In DNA a combination of the following base pairs is diagnostic in the nuclear genome: aly876.30.1:G175A, aly2837.3.3:G110T, aly2618.5.1:T1476C, aly235.13.5:G54A, aly1409.4.2:A1853C; and COI barcode: A295C, T479A, T523C, T548C, T589C.

Barcode sequence of the holotype.

Sample NVG-22104A11, GenBank PV972438, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTATTCCCCTTATATTGGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAACCTTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTAATATTGCACATCAAGGTTCATCTGTAGATTTAGCAATTTTCTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATATCTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATCACTGCTCTTCTTCTTCTTCTATCACTACCTGTATTAGCAGGTGCAATTACTATACTTTTAACAGACCGAAACTTAAATACTTCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 186–187, bears the following five printed (text in italics handwritten) labels (1^st round, others rectangular, 1^st and last red, others white): ( ) no text on this red round label, [ IX-4 1968 | Brasilien | Nova Teutonia | 27° 11’ S - 52° 23’ I | Fritz Plaumann | 300 – 500 m ] the first and the last lines are along the left and the right sides of the label, respectively, written from bottom to top, [ DNA sample ID: | NVG-22104A11 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8567145 ], and [ HOLOTYPE ♂ | Ectomis (Ectomis) | albovenissima Grishin ]. Paratypes: 2♂♂ the same locality and collector as the holotype: 1♂ NVG-22104A12, CASENT 8567145, 2-Sep-1968 and 1♂ NVG-22104A10 (leg, DNA sequenced), NVG-24015E04 (abdomen, DNA stored), CASENT 8567144, 4-Sep-1968, genitalia NVG241114–11 (Fig. 886–887).

Type locality.

Brazil: Santa Catarina, Nova Teutônia, elevation 300–500 m, GPS −27.183, −52.383.

Etymology.

The name references the diagnostic character of all wing veins being whiter than the ground color, and is an adjective.

Distribution.

Known only from the type locality in South Brazil.

Telemiades nidas Grishin, new species

https://zoobank.org/1D5ACCB8-4B52-49A3-B068-29AD37EC0CAE

(Fig. 6 part, 188–189)

Definition and diagnosis.

Genomic analysis reveals that a specimen of Telemiades Hübner, 1819 (type species Papilio avitus Stoll, 1781) from Panama is sister to Telemiades penidas (Hewitson, 1867) (type locality in Brazil: Pará) and is genetically differentiated from it at the species level (Fig. 6); e.g., their COI barcodes differ by 5.6% (50 bp), and therefore it represents a new species. This new species keys to Telemiades penidas (E.6.10) in Evans (1953), but differs from it by females with less well-defined dark spots and bands, smaller hyaline forewing spots in the discal area, a yellower tint, brighter and more saturated fulvous colors of the wing bases beneath (not whiter as in T. penidas), and a darker brown submarginal area on the ventral hindwing. Due to and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2284.3.3:G364A, aly2284.3.3:G393C, aly208.59.5:T116C, aly2487.45.1:A135G, aly2130.23.1:A457C, aly1018.16.3:C150C (not G), aly1018.16.3:C157C (not A), aly2284.12.3:T156T (not C), aly322.29.18:A90A (not G), aly3015.1.3:A110A (not C); and COI barcode: T34C, A334G, 352C, T355C, T418C, T581C.

Barcode sequence of the holotype.

Sample NVG-18016B11, GenBank PV972439, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGCATAATTGGCACATCTCTAAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGTGACGACCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTACCTCTTATATTAGGGGCCCCCGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGTTGAACGGTTTACCCCCCTCTTTCCGCCAATATTGCCCATCAAGGTTCATCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATCTCCTCTATTTTAGGGGCAATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATCTATCATTTGATCAAATACCCTTATTTGTATGGGCAGTCGGAATTACAGCTTTATTATTACTTCTTTCTCTACCAGTATTAGCTGGAGCTATTACCATACTTCTAACAGATCGAAATCTTAATACATCATTTTTTGACCCTGCGGGAGGAGGTGATCCTATTTTATATCAACACTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 188–189, bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PANAMA:COLON | Santa Rita Ridge | 9°22’N 79°43’W | 1500’ 1.I.1960 | leg. G.B.Small ], [ genitalia NO. | X-65 88 | J.M.Burns 2008 ], [ DNA sample ID: | NVG-18016B11 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450767 ], and one red [ HOLOTYPE ♀ | Telemiades | nidas Grishin ].

Type locality.

Panama: Colón Province, Santa Rita Ridge, elevation 1500’, GPS 9.3667, −79.7167.

Etymology.

The name is formed from the name of the sister species, [T. pe]nidas, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Telemiades canticus Grishin, new species

https://zoobank.org/4E36E2F0-98C1-48C3-8DDE-741D42A6C9E9

(Fig. 6 part, 190–191)

Definition and diagnosis.

Genomic analysis reveals that a specimen of Telemiades Hübner, 1819 (type species Papilio avitus Stoll, 1781) from Oaxaca, Mexico, is sister to Telemiades choricus (Schaus, 1902) (type locality in Mexico: Veracruz) but is genetically differentiated from it at the species level (Fig. 6); e.g., their COI barcodes differ by 4.3% (28 bp), and therefore it represents a new species. This new species keys to “Telemiades epicalus sila” (E.6.10) in Evans (1953), but differs from it by the following combination of characters in males: the subapical hyaline spot in the forewing cell R₅-M₁ is offset distad from the other two and is well-developed, not much smaller than the spot in the cell R₃-R₄; the hindwing has a somewhat rounder outer margin; and dark spots on the dorsal side are more diffuse and connected with each other. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly412.17.11:A109T, aly1254.5.1:G222A, aly1603.82.17:C210T, aly133.28.2:A18C, aly420.10.12:C84T, aly686.41.5:A177A (not G), aly9687.3.1:A105A (not C), aly925.11.10:A378A (not G), aly173.51.3:C243C (not T), aly133.28.2:C21C (not T); and COI barcode: T133A, T172C, C367T, T529C, T589C.

Barcode sequence of the holotype.

Sample NVG-18016A02, GenBank PV972440, 658 base pairs:

AACTTTATATTTCATTTTTGGAATTTGAGCTGGAATAATTGGTACATCTTTAAGATTATTAATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATGGTTATACCCATCATAATTGGAGGATTTGGTAATTGACTTGTACCTCTTATATTAGGTGCACCTGATATAGCTTTCCCTCGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCTTATTAATCTCAAGAAGTATTGTTGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAGCTAATATTGCACATCAAGGTTCATCAGTAGACTTAGCAATTTTTTCCCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAACTTTATTACTACAATTATCAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCCTTATTATTACTTCTTTCCTTACCTGTTTTAGCTGGAGCTATTACCATACTTTTAACTGACCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 190–191, bears the following six printed (text in italics handwritten) rectangular labels (first two handwritten, others printed), five white: [ Mex: Oaxaca: 2 mi. N. | Candelaria – 5 Nov.1989 | John Kemner – el. 1800’ ], [ Telemiades ♂ | choricus | (Schaus) | det.H.A.Freeman ] [ genitalia NO. | X-65 70 | J.M.Burns 2008 ], [ DNA sample ID: | NVG-18016A02 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450746 ], and one red [ HOLOTYPE ♂ | Telemiades | canticus Grishin ].

Type locality.

Mexico: Oaxaca, 2 mi north of Candelaria, elevation 1800’.

Etymology.

The name of its sister species, T. choricus, may mean ‘of or pertaining to a chorus or choral’, and canticus may mean ‘of or pertaining to a song or singing, or musical’. The name is an adjective.

Distribution.

Currently known only from the holotype collected in Oaxaca, Mexico.

Telemiades squador Grishin, new species

https://zoobank.org/7BDA7990-DD59-45DB-B2F3-3C10D688D5D9

(Fig. 6 part, 192–193, 888–890)

Definition and diagnosis.

Genomic analysis reveals that a specimen of Telemiades Hübner, 1819 (type species Papilio avitus Stoll, 1781) from Ecuador is in the same clade with Telemiades megallus Mabille, 1888 (type locality in Colombia) and Telemiades squanda Evans, 1953 (type locality in Brazil: Rio de Janeiro), but is genetically differentiated from them at the species level (Fig. 6); e.g., their COI barcodes differ by 3.6% (24 bp) (from both T. squanda and T. megallus), and therefore represents a new species. This new species keys to Telemiades squanda (E.6.6) in Evans (1953); male genitalia place it in the megallus group of Siewert et al. (2020), and it differs from its relatives by the following combination of characters in males: no white tornal area on the ventral hindwing (thus differing from T. megallus), the wings of males are less rounded than in T. squanda or T. moa Siewert, O. Mielke and Casagrande (type locality in Brazil: Acre), overall darker tones and darker purple sheen than in T. squanda (this purple sheen is also visible beneath but is less distinct on the forewing than in T. moa), and the dark spot in the cell Sc+R₁-Rs is more strongly offset distad from the spot in the discal cell than in T. squanda; all the spots being more conspicuous and larger than in T. moa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly322.41.6:C96T, aly322.41.6:G114A, aly1689.6.2:A186T, aly13198.3.2:G87A, aly728.6.1:T198A, aly234.10.3:G111G (not A), aly208.3.6:C90C (not T), aly876.5.1:A115A (not C), aly127.33.4:A334A (not C), aly155.6.54:G176G (not A); and COI barcode: A80G, A295C, T313C, T448C, A550T, T598C, A628A, A631A.

Barcode sequence of the holotype.

Sample NVG-18015G02, GenBank PV972441, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTACTAATTCGAACTGAATTAGGAGCCCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTACCTCTAATATTAGGAGCCCCCGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGACTTCTTCCCCCCTCTTTAACTTTACTAATTTCCAGAAGAATCGTCGAAAACGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTTTCAGCTAATATCGCCCACCAAGGTTCATCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGTGCAATTAATTTTATCACCACAATCATTAACATACGAATTAGAAATCTATCATTTGATCAAATACCTTTATTCGTTTGAGCTGTTGGTATTACAGCTTTACTTTTACTTCTTTCTCTTCCAGTTTTAGCTGGAGCTATTACAATACTTTTAACAGATCGAAATCTCAATACATCATTTTTCGACCCTGCAGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 192–193 (genitalia Fig. 888–890), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR: Napo Pr. | 8 km Napo-Ahuano | 1° 2.5’ S 77° 43.5’ W | 7 Nov. 1992, 480m. | S. S. Nicolay, leg. ], [ genitalia NO. | X-65 49 | J.M.Burns 2007 ], [ DNA sample ID: | NVG-18015G02 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450641 ], and one red [ HOLOTYPE ♂ | Telemiades | squador Grishin ].

Type locality.

Ecuador: Napo Province, km 8 of Puerto Napo-Ahuano Road, elevation 480 m, GPS −1.0417, −77.725.

Etymology.

The name is a fusion of the name of its sister species and a country of the type locality: squ[anda]+[Ecu] ador and is a noun in apposition.

Distribution.

Currently known only from the holotype collected east of the Andes in Ecuador.

Polygonus amazonus Grishin, new species

https://zoobank.org/6781D765-A5EA-432F-A427-7C5E500B2745

(Fig. 6 part, 194–195, 891–892)

Definition and diagnosis.

A clade of Polygonus Hübner, 1825 (type species Polygonus lividus Hübner, [1825], which is a junior subjective synonym of Papilio leo Gmelin, [1790]) consisting of specimens from the Amazonian region in South America is genetically differentiated from others at the species level (Fig. 6); e.g., their COI barcodes differ by 3.3% (22 bp) from Polygonus savigny (Latreille, [1824]) (type locality in Southeast or South Brazil), by 1.8% (12 bp) from Polygonus punctus E. Bell and W. Comstock, 1948 (type locality in St. Vincent), and by 1.7% (11 bp) from Polygonus pardus Grishin, 2023 (type locality in USA: Texas, Hidalgo Co.); and therefore represents a new species. This new species keys to “Polygonus manueli manueli” (C.3.2(a)) in Evans (1952), which in part refers to what is currently known as P. savigny, but differs from it and other relatives by better defined, darker, and more strongly purple-sheened spots and bands on the ventral hindwing, which is less yellow towards the base than in P. savigny, and has a more developed purple sheen between the spots and bands, the spot in the ventral hindwing cell CuA₂-1A+2A is usually less shifted basad along the CuA₂ vein together with the spot in CuA₁-CuA₂, the keel on the dorsoanterior margin of the harpe is better developed, the dorsal terminal prong of the harpe is typically narrower, and the posterior prong is larger. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1139.38.1:T558C, aly1139.38.1:A609G, aly1139.38.1:C624T, aly479.3.3:C27T, aly671.39.1:A373G; and COI barcode: T59T, T133T, T202C, T283C, T412T.

Barcode sequence of the holotype.

Sample NVG-17101G10, GenBank PV972442, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGCATAGTAGGTACATCTCTTAGATTATTAATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTTATACTTGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCCTTAACCCTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGTACAGGTTGAACAGTTTACCCCCCTCTTTCAGCTAATATTGCTCATCAAGGTTCTTCAGTAGATTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTCGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTTCTTTCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCCTTTTTTGACCCTGCAGGAGGAGGAGATCCTATCCTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 194–195, bears the following five rectangular labels (2^nd handwritten, others printed), four white: [ PERU: Loreto Prov. | Rio Amazonas, 200m | Explorama Inn, 25 | mi E Iquitos | 17–21 Sept. 1990 | Brian P. Harris ], [ Polygonus | leo ], [ DNA sample ID: | NVG-17101G10 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913636 ], and one red [ HOLOTYPE ♂ | Polygonus | amazonus Grishin ]. Paratypes: 3♂♂: Peru, Madre de Dios: 1♂ NVG-5031 Parque Manu, Pakitza, 400 m, GPS −12.1167, −70.9667, 9-Sep-1989, R. Robbins leg., genitalia NVG151101–82 [USNM] and 1♂ NVG-19126B10 (leg, DNA sequenced), NVG-23108A08 (abdomen, DNA stored, dissected, genitalia Fig. 891–892), WRD 15,333 Alto Madre de Dios at Pantiacolla Lodge, 400 m, GPS −12.6500, −71.2167, 19-Jun-2019, W. R. Dempwolf leg. [WRD] and 1♂ NVG-17101G11, USNMENT 00913637 Brazil, Rondônia, 62 km S Ariquemes, Fazenda Rancho Grande, 165 m, GPS −10.5333, −62.8000, 14–25-Nov-1993, Brian Harris leg. [USNM].

Type locality.

Peru: Loreto Region, 25 mi east of Iquitos, Amazon River, Explorama Lodge, elevation 200 m.

Etymology.

This species is from the Amazonian region, hence the name that is treated as a noun in apposition.

Distribution.

The Amazonian region.

Tribe Oileidini Grishin, 2019, Subtribe Typhedanina Grishin, 2019

Typhedanus ampyxacus Grishin, new species

https://zoobank.org/64515708-3E10-4598-96CE-F45EFE3F451A

(Fig. 6 part, 196–197, 893–895)

Definition and diagnosis.

Genomic analysis reveals that specimens from Oaxaca, Mexico, identified as Typhedanus ampyx (Godman and Salvin, 1893) (type locality in Mexico: Yucatan) partition into two clades genetically differentiated at the species level (Fig. 6); e.g., their COI barcodes differ by 6.2% (41 bp). One clade corresponds to T. ampyx and the other one represents a new species. This new species keys to T. ampyx (C.6.8) in Evans (1952), but differs from it by having brighter yellow areas on the hindwing more contrasting with the dark ground color and on the dorsal hindwing are larger, with better defined borders and dark veins near them on the ventral hindwing, and a weaker to vestigial pattern of dark spots and bands that are not much visible on the ventral side due to its overall darker color. Due to somewhat cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly10226.17.7:A44G, aly731.8.1:C291T, aly10226.56.1:T90C, aly967.7.1:G99C, aly1146.51.1:C1304T; and COI barcode: T145C, T277C, A298T, T436C, A565T.

Barcode sequence of the holotype.

Sample NVG-19124B06, GenBank PV972443, 658 base pairs:

AACTTTATATTTTTTATTTGGAATTTGAGCAGGTATAATTGGAACATCCCTAAGATTATTAATTCGTACTGAATTAGGAACCCCAGGATCATTAATTGGAGATGATCAAATTTATAACACTATTGTAACAGCTCACGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCTCTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAACAACATAAGATTTTGACTTTTACCCCCTTCCCTAACCTTACTTATTTCAAGTAGTATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCTCTTTCATCAAATATTGCACATCAAGGATCATCAGTCGATCTAGCAATTTTCTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCCATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCCTTATTTATTTGAGCAGTAGGTATTACAGCATTACTATTATTACTTTCCTTACCTGTTCTAGCAGGTGCTATTACTATGCTTCTTACTGATCGAAATTTAAATACTTCTTTTTTTGACCCAGCCGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 196–197 (genitalia Fig. 893–895), bears the following seven rectangular labels (3^rd handwritten, others printed, 2^nd and the last red, others white): [ Mexico: Oaxaca | Hwy190 Oaxaca-Tehuantepec | km 156, ¼ mi W El Coyul | 2700’ 2.ix.1989 | thorn forest | J. Kemner leg. #120 ], [ Texas Memorial | Museum –UTexas | JKemner Spec. | 1573 ], [ 120 ], [ DNA sample ID: | NVG-19124B06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24016C05 | c/o Nick V. Grishin ], [ genitalia | NVG241220–07 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Typhedanus | ampyxacus Grishin ]. The numbers 1573 and 120 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2^nd and 3^rd labels were original labels on the holotype. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♀♀ from Mexico, Oaxaca: NVG-17102B09, USNMENT 00913672 64 mi W Tehuantepec, 5-Sep-1972, G. F. and S. Hevel leg. [USNM] and NVG-22104B01, CASENT8567147 20 mi E El Camaron, 22-Jul-1956, J. W. MacSwain leg. [CAS].

Type locality.

Mexico: Oaxaca, km 156 of Hwy190 (Oaxaca-Tehuantepec), ¼ mi west of El Coyul, elevation 2700’.

Etymology.

The name is a modified fusion of the name of its sister species and the state of the type locality: ampyx + [Oax]ac[a] +us, and is treated as a noun in apposition.

Distribution.

Currently known only from Oaxaca, Mexico.

Typhedanus umbrosus Grishin, new species

https://zoobank.org/9783FF37-85AB-448A-9715-86D1BCF437C3

(Fig. 6 part, 198–199, 896–898)

Definition and diagnosis.

Genomic analysis of specimens identified as Typhedanus umber (Herrich-Schäffer, 1869) (type locality in Tropical America, likely in Colombia or Venezuela) reveals their partition into two clades genetically differentiated at the species level (Fig. 6); e.g., their COI barcodes differ by 3% (20 bp). One clade corresponds to T. umber as evidenced by its sequenced syntype (NVG-15032C01). The second clade with specimens from northern Colombia corresponds to a new species that keys to T. umber (C.6.7) in Evans (1952), but differs from it by a more concave outer margin of the hindwing in males, and a more produced hindwing tornus in females; strongly asymmetrical valvae with the ampulla expanded and not separated by a notch from the harpe in the left valva. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly798.22.10:C121T, aly798.22.10:G153A, aly1139.19.1:C976A, aly1603.12.13:T720C, aly281.6.3:A48G; and COI barcode: T10C, T205A, T241C, T574C, T613C.

Barcode sequence of the holotype.

Sample NVG-21014C01, GenBank PV972444, 658 base pairs:

AACTTTATACTTTTTATTTGGAATTTGAGCTGGTATAATTGGAACATCCTTAAGATTATTAATTCGTACTGAATTAGGAACCCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATACTAGGAGCTCCTGATATAGCTTTCCCCCGCATAAATAATATAAGATTCTGATTATTACCCCCTTCTTTAACTTTACTTATTTCAAGAAGTATCGTAGAAAATGGAGCTGGAACAGGATGAACAGTATACCCCCCTCTCTCATCAAATATTGCTCATCAAGGTTCATCAGTTGACTTAGCAATTTTCTCTCTTCATTTAGCTGGTATTTCTTCAATTCTAGGAGCTATTAATTTCATTACTACAATTATTAACATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTATCTGAGCAGTAGGTATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACCATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTCGACCCAGCAGGAGGAGGTGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 198–199 (genitalia Fig. 896–898), bears the following eight printed rectangular labels (4^th handwritten, others printed), seven white: [ Bonda (250 ft.) | Dept.Magdalena, | Colombia,S.A. ], [ Nov ], [ Holland | Collection ], [ 5 ], [ DNA sample ID: | NVG-21014C01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23108B07 | c/o Nick V. Grishin ], [ genitalia | NVG241118–37 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Typhedanus | umbrosus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-21014C02, the same data as the holotype.

Type locality.

Colombia, Magdalena Department, Bonda, elevation 250’.

Etymology.

The name is formed from its sister species T. umber and is treated as a noun in apposition.

Distribution.

Currently known only from northern Colombia.

Cogia huila Grishin, new species

https://zoobank.org/141A0ADB-E794-4263-94DC-6C0D124E6AD3

(Fig. 6 part, 200–201, 899–902)

Definition and diagnosis.

Specimens from Coahuila, Mexico, are genetically differentiated from Cogia caicus (Herrich-Schäffer, 1869) (type locality in Mexico, likely Oaxaca) (Zhang et al. 2023c) at the species level in the nuclear genome (Fig. 6a) (but their COI barcodes do not differ significantly), and therefore represent a new species. This new species keys to C. caicus (E.5.8) in Evans (1953) and is sister to it in genomic trees (Fig. 6), being most similar to this species, but differing from all its close relatives by the following combination of characters: generally smaller in size; the harpe is slightly narrower distad than in C. caicus (but not as narrow as in C. moschus Edwards, 1882 and even C. chiagua Grishin, 2023), about equal width until the rounded end and not slightly expanded from its middle towards the rounded portion; the dorsally serrated basal portion of the harpe (from the ampulla to the tooth) is longer, about half of the harpe length along the dorsal margin, but the serrated portion of the ampulla is shorter than in C. caicus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly274.29.2:T69C, aly311.10.1:C448T, aly173.20.4:T105C, aly4305.6.4:C34A, aly728.50.1:G587A; and COI barcode: A181G, C343T, 556C, but due to similarity among close relatives, the barcode may not be reliable for identification.

Barcode sequence of the holotype.

Sample NVG-23071G12, GenBank PV972445, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCCCCATCATTAACATTATTAATTTCTAGAAGTATTGTAGAAAATGGTGCTGGTACTGGATGAACAGTATATCCTCCCCTTTCATCAAATATTGCACATCAAGGTTCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTATTACTTTTACTTTCTTTACCTGTCTTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 200–201, bears the following four printed rectangular labels, three white: [ CL. Zaragosa 5. | md. Can. Bonito | DurdenC& 76103A23 ], [ Cogia | caicus | moschus | (Edwards, 1882) ], [ DNA sample ID: | NVG-23071G12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cogia huila | Grishin ]. The holotype was collected on 12-Apr-1976 (i.e., “76103”: day 103 of 1976, A23 is the collection event referring to this specimen in Durden’s master catalog), and 5 after “Zaragosa” on the first label is the code for this locality in mid to upper Canyon Bonito). Paratypes: 7♂♂ with the same data as the holotype but collected on 12-Apr-1976 (1♂ NVG-24104C10); 3-May-1981 (1♂ NVG-17113D05 (leg, DNA sequenced), NVG-23068D01 (abdomen, DNA stored), genitalia NVG241118–39 (Fig. 901–902); 1♂ NVG-24104C12; 1♂ NVG-24104D01; and 1♂ NVG-24104D02); and 4-May-1981 (1♂ NVG-19124H04 (leg, DNA sequenced), NVG-23068C12 (abdomen, DNA stored), genitalia NVG241118–38 (Fig. 899–900) and 1♂ NVG-24104C11).

Type locality.

Mexico: Coahuila, Zaragoza Municipality, mid to upper El Cañón Bonito.

Etymology.

The name is derived from the Mexican state of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Coahuila, Mexico.

Comment.

For comparison, we illustrate genitalia of two C. caicus males from different localities in Mexico [MGCL]: NVG-23033C11 from Guerrero, Acahuizotla, Aug-1956, T. Escalante leg., genitalia NVG241018–01 (Fig. 903–904) and NVG-22079A03 from Oaxaca, ca. 5 mi N of Oaxaca, 6000’, 14-Aug-1989, J. Kemner leg., genitalia GTA-10948 (Fig. 905, left valva only).

Subfamily Tagiadinae Mabille, 1878, Tribe Tagiadini Mabille, 1878

Coladenia sundae de Jong and Treadaway, 1992 is a species distinct from Coladenia agni (Nicéville, 1884)

Genomic comparison of the holotype of Coladenia agni sundae de Jong and Treadaway, 1992 (type locality in Indonesia: Sumatra) with specimens of Coladenia agni agni (Nicéville, 1884) (type locality in India: Sikkim) reveals that they are genetically differentiated at the species level (Fig. 6); e.g., their COI barcodes differ by 1.8% (12 bp). Therefore, we propose that Coladenia sundae de Jong and Treadaway, 1992, new status, is a species distinct from Coladenia agni (Nicéville, 1884).

Coladenia javi Grishin, new species

https://zoobank.org/A77016D7-E60A-49C1-BEC5-6ABCAA4A85A1

(Fig. 6 part, 202–203, 906–908)

Definition and diagnosis.

Genomic analysis of a specimen from Java that we initially identified as Coladenia sundae de Jong and Treadaway, 1992, new status, (type locality in Indonesia: Sumatra) is genetically differentiated from it at the species level (Fig. 6); e.g., their COI barcodes differ by 1.8% (12 bp), and therefore represents a new species. This species keys to “Coladenia agni igna” (C.5.3(a)) in Evans (1949), which he misidentified, and was included by him in that taxon, currently treated as a species Coladenia igna (G. Semper, 1892) (type locality in Philippines: Luzon) and is restricted to the Philippines. The new species differs from its relatives by the following combination of characters in females: discal hyaline spots on the forewing are not fused and instead stand out from each other, not strongly framed by a darker color; ocherous overscaling is only weakly developed; brown spots in the hindwing postdiscal band stand out less from the ground color and are less distinct towards the inner margin; the fringes are brown on both wings, including the areas near the apex and the tornus, and two submarginal hyaline spots between veins M₁ and M₃ on the forewing are well-expressed. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly379.1.4:G69A, aly3268.18.7:C168T, aly1350.9.1:A942G, aly23605.7.3:G123A, aly525.98.3:G24A, aly1158.11.3:C741C (not T), aly363.15.1:G42G (not C), aly1577.12.1:A1587A (not T), aly1497.5.3:T219T (not A), aly1313.23.5:T1155T (not C); and COI barcode: T70C, A127C, A160A, T287C, T613C, T616C.

Barcode sequence of the holotype.

Sample NVG-18104D03, GenBank PV972446, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCCGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAACCGAATTAGGAAATCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACAATTGTCACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTACTCCCCCCTTCATTAACTTTACTAATTTCAAGAAGAATTGTTGAAAATGGATCAGGAACTGGATGAACTGTTTACCCTCCTTTATCTGCTAATATTGCCCACCAAGGAGCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCCTCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATTTATCATTTGATCAAATACCCCTTTTTGTTTGATCTGTTGGTATTACAGCATTATTACTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACATCATTTTTCGACCCTGCTGGAGGTGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 202–203 (genitalia Fig. 906–908), bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [ Tjibodas | MtGede | Java ], [ Sept. | ‘09 ], [ Bryant& | PalmerColl ], [ DNA sample ID: | NVG-18104D03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G06 | c/o Nick V. Grishin ], [ genitalia | NVG241118–40 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531131 ], and one red [ HOLOTYPE ♀ | Coladenia | javi Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Indonesia: Java, Mount Gede, Cibodas.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in West Java.

Abaratha (Abaratha) saraya Doherty, 1886 is a valid species distinct from Abaratha (Abaratha) agama (Moore, 1858)

Genomic analysis of the holotype [in CMNH] of Abaratha saraya Doherty, 1886 (type locality in India, Kumaon, sequenced as NVG-20126G04) (Fig. 204–205), currently treated as a junior subjective synonym of Abaratha (Abaratha) agama agama (Moore, 1858) (type locality in Java), reveals that the two taxa are genetically differentiated from each other at the species level (Fig. 6); e.g., their COI barcodes differ by 6.1% (40 bp). Moreover, A. saraya is sister to Abaratha (Abaratha) alida Nicéville, 1891 (type locality in Myanmar), while differing from it at the species level as well (Fig. 6); the COI barcode difference of 5% (33 bp). Therefore, we propose that Abaratha (Abaratha) saraya Doherty, 1886, reinstated status, is a valid species distinct from Abaratha (Abaratha) agama (Moore, 1858).

Abaratha (Abaratha) bhutana Grishin, new species

https://zoobank.org/4D36F0C0-E794-44E8-B69E-114C8F6886D2

(Fig. 6 part, 206–207, 909–911)

Definition and diagnosis.

Genomic analysis of a male Abaratha F. Moore, 1881 (type species Pterygospidea ransonnetii R. Felder, 1868) from Bhutan reveals that it is sister to Abaratha (Abaratha) agama (Moore, 1858) (type locality in Java), but is genetically differentiated at the species level (Fig. 6); e.g., their COI barcodes differ by 3% (20 bp), and therefore it represents a new species. This new species keys to “Caprona agama agama” (C.18.2(a)) in Evans (1949) and was included by him in that taxon, but differs from it and other relatives by the following combination of characters in males of the “normal form” (WSF) of Evans (1949): overall paler than most specimens of other species, submarginal black spots on the ventral hindwing are smaller and better separated from each other, the cream spot at the end of the forewing discal cell “leaks” distad, especially on the ventral side with cream patches in M₁-M₂ and M₂-M₃ cells, yellow streaks are present in cells R₁-R₂ and R₂-R₃; the aedeagus is terminally enlarged into a flap armed with several small teeth along its edge; the uncus is strongly asymmetrical; valvae are only slightly asymmetrical, both narrowing to a point, the left valva is overall narrower and only slightly constricted before the terminal rod-like section of the harpe, which itself is constricted near the tip projecting as a small tooth. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly526.16.1:A806G, aly1113.11.16:C81T, aly10630.3.5:C30A, aly423.18.1:T943C, aly423.18.1:A964C, aly536.14.17:C84C (not T); and COI barcode: T13C, T50T, C220T, T316C, C505T, C556T.

Barcode sequence of the holotype.

Sample NVG-18105A05, GenBank PV972447, 658 base pairs:

AACTTTATACTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCACTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGCTCAGGAACAGGATGAACAGTTTATCCCCCTTTATCAGCTAATATTGCCCATCAAGGAGCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAGTAAGAAATTTATTTTTTGATCAAATACCCTTATTTGTATGAGCTGTAGGTATTACAGCTTTATTATTATTACTTTCATTACCTGTTTTAGCAGGAGCCATTACAATACTTTTAACTGATCGAAATCTTAACACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTC

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 206–207 (genitalia Fig. 909–911), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BHUTAN | May 1893 | GOLDINGTON ], [ DNA sample ID: | NVG-18105A05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G07 | c/o Nick V. Grishin ], [ genitalia | NVG241118–41 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531192 ], and one red [ HOLOTYPE ♂ | Abaratha (Abaratha) | bhutana Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Bhutan.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Bhutan.

Abantis (Caprona) ana Grishin, new species

https://zoobank.org/5A445F40-C418-4688-A2CF-88A8DEF507D9

(Fig. 6 part, 208–209, 912–914)

Definition and diagnosis.

Genomic analysis reveals that a female from Kenya is genetically differentiated from Abantis (Caprona) pillaana (Wallengren, 1857) (type locality in South Africa) at the species level (Fig. 6); e.g., their COI barcodes differ by 1.4% (9 bp) (mitochondrial genomes do not differ strongly between species in this group, see Fig. 6b), and keys to it (II.13.1) in Evans (1937). This new species differs from its relatives by the following combination of characters: a dark spot contrasting with the pale ground color is not well-developed in the middle of the ventral hindwing cell CuA₂-1A+2A (usually prominent in Abantis (Caprona) adelica (Karsch, 1892) (type locality in Togo)); the outer margin of the discal paler band on the dorsal hindwing is broken in the middle (the pale line spans from the costa to the inner margin in Abantis (Caprona) cassualalla (Bethune-Baker, 1911) (type locality in Angola) and in most A. adelica); the subapical hyaline spot in the forewing cell R₅-M₁ is offset distad from the other three spots, and the spot in the cell R₂-R₃ is slightly offset basad (the band of these spots is more regular in A. cassualalla); a darker area distad of the hyaline spot at the base of the forewing cell M₃-CuA₁ is typically in line with such areas towards the inner margin (usually offset distad in A. pillaana); and reddish areas on the dorsal side of the wings, if present, are less orange than in A. pillaana. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly182.2.6:C45T, aly182.2.6:C51T, aly5.22.4:A74G, aly971.21.1:A101T, aly971.21.1:G113A, aly443.26.1:T1062T (not C), aly1651.35.3:T66T (not C), aly19.1.3:T482T (not C), aly65305.1.10:C42C (not T), aly3011.2.2:C92C (not T); and COI barcode: T70T, T220T, C235T, T427C, C634C.

Barcode sequence of the holotype.

Sample NVG-17068G06, GenBank PV972448, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAACTGAATTAGGAAACCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTTCAGGAACAGGTTGAACAGTTTATCCCCCTTTATCAGCTAATATCGCCCACCAAGGAGCTTCTGTAGATTTAGCTATCTTTTCTTTACATTTAGCTGGAATTTCTTCAATCTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCTTTTGATCAAATACCTCTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCTCTTCCAGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATCTTAATACTTCTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATATCAACACTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 208–209 (genitalia Fig. 912–914), bears the following seven rectangular labels (2^nd handprinted, others printed), six white: [ Mrima Hill | Mombasa K.C. | Sept.1957 | R.Carcasson ], [ Caprona | pillaana | pillaana | Wallgr. ], [ Kenya Natl. | Mus. exchange ], [ DNA sample ID: | NVG-17068G06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G08 | c/o Nick V. Grishin ], [ genitalia | NVG241118–42 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Abantis (Caprona) | ana Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Kenya: Mombasa, Mrima Hill.

Etymology.

The name formed from its sister species name, shortened to indicate more northern distribution, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Kenya.

Subfamily Pyrrhopyginae Mabille, 1877 Tribe Pyrrhopygini Mabille, 1877 Subtribe Mimoniadina Grishin, 2019

Mysoria (Mysarbia) centralia Grishin, new species

https://zoobank.org/B6C9DD95-2B68-4699-A018-ACECA382833C

(Fig. 6 part, 210–211, 915–916)

Definition and diagnosis.

Genomic analysis of specimens from Panama and Colombia identified as Mysoria sejanus stolli (O. Mielke, 2002) (type locality in Suriname, lectotype sequenced as NVG-22011E10) reveals their genetic differentiation at the species level from all subspecies of Mysoria sejanus (Hopffer, 1874) (type locality in Peru), which are genetically similar (Fig. 6); e.g., the COI barcodes of the Panamanian specimens and the lectotype differ by 3.5% (23 bp), and therefore these specimens belong to a new species. This new species keys to “Mysoria thasus thasus” (a junior homonym, its replacement and the current name is M. sejanus stolli) (A.12.4(a)) in Evans (1951), sharing with it greenish sheen on the ventral side of the wing, red cheeks, and a red spot between antennae, but the collar is black as in M. sejanus sejanus; the basal tooth of the harpe is thinner and the distal end is rounder. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1838.41.12:G54C, aly6398.10.10:A197C, aly925.18.2:C79A, aly1155.6.1:T228C, aly2417.7.1:G72T; and COI barcode: T40C, A61G, A127G, C238T, T358C, A565G.

Barcode sequence of the holotype.

Sample NVG-18031B11, GenBank PV972449, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTCGGAACATCCTTAAGATTATTGATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTGACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATATTGGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACCCTACTTATTTCTAGAAGCATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCCCCCCTTTCTTCTAACATTGCCCATCAAGGAGCTTCTGTAGATTTGGCTATTTTTTCTCTCCACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTGTTATTACTTTTATCTTTACCTGTTTTAGCCGGGGCTATTACTATATTATTAACTGATCGAAATATTAATACCTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 210–211, bears the following six rectangular labels (3^rd handwritten, others printed with text in italics handwritten), five white: [ PANAMA:DARIEN | Cana (Cerro Pirre) | 500m | 7°56’N 77°43’W | 15 VII 1983 | leg. G.B.Small ], [ genitalia NO. | X-46 80 | J.M.Burns 2000 ], [ Mysoria thasus | ♂ ], [ DNA sample ID: | NVG-18031B11 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466066 ], and one red [ HOLOTYPE ♂ | Mysoria (Mysarbia) | centralia Grishin ]. Paratype: 1♂ NVG-18054C01 (leg, DNA sequenced), NVG-23078G02 (abdomen, DNA stored) Colombia, La Liberia, 27-Mar-1922, A. Schultze leg., genitalia NVG240912–13 (Fig. 915–916) [MFNB].

Type locality.

Panama: Darién Province, Cana, Cerro Pirre, elevation 500 m, approx. GPS 7.9333, −77.7167.

Etymology.

The name reflects the type locality of this species in Central America and is treated as a noun in apposition.

Distribution.

Panama and Colombia.

Subfamily Pyrginae Burmeister, 1878 Tribe Achlyodini Burmeister, 1878 Subtribe Pythonidina Grishin, 2019

Gindanes phagesia (Hewitson, 1868), Gindanes panaetius Godman and Salvin, 1895, and Gindanes brebna Evans, 1953 are species distinct from Gindanes brebisson (Latreille, [1824])

Genomic analysis of taxa currently regarded as subspecies of Gindanes brebisson (Latreille, [1824]) (type locality in Brazil), such as Pterygospidea phagesia Hewitson, 1868 (type locality in Brazil: Pará), Gindanes panaetius Godman and Salvin, 1895 (type locality in Nicaragua and Panama), and Gindanes brebissoni [sic] brebna Evans, 1953 (type locality in Bolivia: Cochabamba), reveals genetic differentiation between them at the species level (Fig. 7); e.g., COI barcodes differ by 3.3% (22 bp) between P. phagesia and G. panaetius and by 4.8% (32 bp) between G. brebisson and G. brebissoni [sic] brebna. Therefore, we propose to treat them as species: Gindanes phagesia (Hewitson, 1868), reinstated status, Gindanes panaetius Godman and Salvin, 1895, reinstated status, and Gindanes brebna Evans, 1953, new status. As a result, G. brebisson becomes monotypic.

Figure 7.

Phylogenetic trees of selected Pythonidina (and Viola) inferred from protein-coding regions in a) the Z chromosome, based on 321,672 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Gindanes brebus Grishin, new species

https://zoobank.org/4093B7AF-8098-4200-A94A-476F0463A125

(Fig. 7 part, 212–213, 917–918)

Definition and diagnosis.

In addition to the four species of Gindanes Godman and Salvin, 1895 (type species Gindanes panaetius Godman and Salvin, 1895) discussed above, genomic analysis reveals that a specimen from northeastern Peru is genetically differentiated from all others at the species level (Fig. 7); e.g., its COI barcode differs from its sister species in the nuclear genome Gindanes brebna Evans, 1953 (type locality in Bolivia: Cochabamba) by 4.7% (31 bp). Therefore, this specimen represents a new species that keys to “Gindanes brebissoni [sic] phagesia” (E.40.2(c)) in Evans (1953), but differs from it by a well-developed square semihyaline spot in the forewing cell R₂-R₃ that is always missing in G. phagesia, in which the spot is in the cell R₃-R₄ (the spot is also present in the new species, but is smaller than the R₂-R₃ spot); larger semihyaline spots near the middle of the forewing costal margin; and less distinct brown spots in the pale-blue area of the ventral hindwing. The characteristic spot in the cell R₂-R₃ is only present in its sister, G. brebna, in which this and other subapical spots are much larger. Due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6286.9.3:G124A, aly877.7.1:G33A, aly1968.6.16:C76T, aly1838.24.4:A492G, aly1838.24.4:C498T, aly1772.7.1:T458T (not C), aly2976.2.6:C128C (not A), aly420.45.2:C252C (not T), aly443.27.2:G144G (not C), aly3263.11.16:A233A (not C); and COI barcode: T106C, T250C, T259C, T334C, A565G, T652C.

Barcode sequence of the holotype.

Sample NVG-15093G12, GenBank PV972450, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAACATAAGATTCTGATTACTTCCTCCATCTTTATTATTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACCGTTTATCCCCCTCTTTCCGCTAATATTGCCCATCAAGGATCATCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAGAAATCTTTCATTTGATCAAATACCATTATTTGTTTGAGCAGTAGGAATTACAGCTTTATTATTATTATTATCTCTTCCTGTTTTAGCTGGGGCTATTACTATACTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 212–213 (genitalia Fig. 917–918), bears the following seven rectangular labels (3^rd handprinted, others printed with handwritten text shown in italics), six white: [ PERU: Dept. of Loreto | Explorama Lodge, | 65 mi. E. of Iquitos | on Amazon River | 4 mar 84 | Linwood C. Dow ], [ FSCA | Florida State Collection | of Arthropods ], [ Gindanes | Brebissoni panaetius ], [ DNA sample ID: | NVG-15093G12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24127F10 | c/o Nick V. Grishin ], [ genitalia | NVG250720–29 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gindanes | brebus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Loreto Region, 65 mi east of Iquitos, Explorama Lodge on Amazon River.

Etymology.

The name is formed from the name of its relative, G. brebisson, made shorter for this more northern species and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northeastern Peru.

Quadrus (Trifa) cobus Grishin, new species

https://zoobank.org/4A9F6DE7-22B9-48AE-94D5-F9AE237A2713

(Fig. 7 part, 214–215, 919–921)

Definition and diagnosis.

Sister to Quadrus jacobus (Plötz, 1884) (type locality in Brazil: Rio de Janeiro, holotype sequenced as NVG-15033D02) and keys to it (E.13.2) in Evans (1953), but is genetically differentiated at the species level (Fig. 7); e.g., their COI barcodes differ by 2.9% (19 bp), and therefore it is a new species. This new species differs from Q. jacobus by a pale spot in the forewing cell CuA₂-1A+2A, paler forewing ventral coloration, especially around the forewing tornus, more contrasting ventral forewing pattern, pale postdiscal band separated by dark veins on the ventral forewing, and better developed brown lunules at the ventral hindwing margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly5196.6.1:T87C, aly728.20.4:C114T, aly669.9.1:T219C, aly2487.17.3:A141G, aly251.9.2:C78A, aly4305.24.1:A73A (not G), aly1019.29.2:G69G (not A), aly798.19.15:C99C (not T), aly235.7.6:T37T (not C), aly361.8.3:C126C (not T); and COI barcode: T5T, G38A, A73G, A181T, T394C, T574C.

Barcode sequence of the holotype.

Sample NVG-18018A06, GenBank PV972451, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAACTGAGTTAGGAAATCCAGGATCATTAATTGGYGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTCTTATTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCCCCTCTCTCAGCTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCTATCTTTTCTTTACATTTAGCAGGAATTTCATCAATCTTAGGAGCCATTAACTTTATTACTACAATTATTAATATACGAATTAATAATCTCTCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCTTTACTTCTTCTACTATCATTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAACTTAAATACATCTTTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 214–215 (genitalia Fig. 919–921), bears the following six rectangular printed labels, five white: [ ECUADOR: Sucumbíos, | Cerro Lumbaquí Norte, | 0° 01’70” N, 77° 19’22” W | 800–950 m, 18–22 Aug 2002 | J.P.W. Hall & M.A. Solis ], [ DNA sample ID: | NVG-18018A06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G09 | c/o Nick V. Grishin ], [ genitalia | NVG241118–45 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450924 ], and one red [ HOLOTYPE ♀ | Quadrus (Trifa) | cobus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Sucumbíos Province, Cerro Lumbaquí Norte, elevation 800–950 m, GPS 0.0283, −77.3203.

Etymology.

The name is formed from Q. jacobus and made shorter for its more northern relative. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in north-central Ecuador.

Quadrus (Quadrus) alis Grishin, new species

https://zoobank.org/8B98EF3A-7304-43BC-B36F-5A810990D87F

(Fig. 7 part, 216–217, 922–923)

Definition and diagnosis.

Genomic analysis of specimens identified as Quadrus (Quadrus) cerialis (Stoll, 1782) (type locality in Suriname) from across the range reveals that they partition into three clades with genetic differentiation at the species level (Fig. 7); e.g., the difference in COI barcodes of the northernmost clade (from Mexico to El Salvador and Honduras) and the topotypical Q. cerialis from Suriname is 4.3% (28 bp). Therefore, this clade represents a new species that keys to “Quadrus cerealis [sic]” (E.39.1) in Evans (1953) and was included by him in that taxon, but differs from it and other relatives by the combination of the following characters: usually less extensive blue areas and wider brown marginal areas on the ventral hindwing with more prominent and broader postdiscal brown spots; a more gracile harpe, but a larger expansion of the ampulla that is separated from the harpe by a deeper notch; and a larger uncus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly390.14.7:C131A, aly1656.25.1:T520C, aly151.36.3:T102C, aly151.36.3:G135A, aly3850.6.2:T127C; and not all specimens of this species can be separated from others using COI barcodes due to introgression.

Barcode sequence of the holotype.

Sample NVG-19087D06, GenBank PV972452, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCTGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCCTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCTCCCTCTCTTCTACTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGGACAGGTTGAACAGTTTATCCTCCTCTTTCCGCTAACATTGCTCATCAAGGATCATCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATCTTTCTTTAGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTACTTTTATCATTACCTGTTTTAGCTGGAGCCATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 216–217 (genitalia Fig. 922–923), bears the following six printed rectangular labels, five white: [ MEXICO: Oaxaca | Valle Nacional | 31 July 1966 | Leg. Alfred B. Lau ], [ DNA sample ID: | NVG-19087D06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G10 | c/o Nick V. Grishin ], [ genitalia | NVG241118–46 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588848 ], and one red [ HOLOTYPE ♂ | Quadrus (Quadrus) | alis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 4♀♀: Mexico: 1♀ NVG-15094D10 San Luis Potosí, Xilitla, English Castle, 18-Oct-1984, H. D. Baggett leg. [MGCL] and 1♀ NVG-18017F02, USNMENT 01450888 Hidalgo, Puerto del Caballo, 19-Jul-1981, W. H. Howe leg. [USNM]; 1♀ NVG-19087D02, USNMENT 01588844 Belize, Hummingbird Hwy, 20-Nov-1967, Vern King leg. [USNM]; 1♀ NVG-22018E12 Honduras, San Pedro Sula, old [ca. 1900], coll. Fruhstorfer [ZSMC]; and El Salvador, Mauricio Salazar leg. [USNM]: 1♂ NVG-18018A05, USNMENT 01450923 Santa Tecla, 22-Dec-1953 and 1♂ NVG-19087D03, USNMENT 01588845 Cuscatlán, El Rosario, 28-Dec-1953.

Type locality.

Mexico: Oaxaca, San Juan Bautista Valle Nacional.

Etymology.

The name is formed by removing the first half (first four letters) of the specific epithet of its congener, Q. cerialis, and is treated as a noun in apposition.

Distribution.

Mexico to Honduras.

Quadrus (Quadrus) rialis Grishin, new species

https://zoobank.org/D3C65858-D712-4AE0-8BED-4BBAF4DD5498

(Fig. 7 part, 218–219, 924–925)

Definition and diagnosis.

Genomic analysis of specimens identified as Quadrus (Quadrus) cerialis (Stoll, 1782) (type locality in Suriname) from across the range reveals that they partition into three clades with genetic differentiation at the species level (Fig. 7); e.g., the difference in COI barcodes of the clade from the middle of the range (from Guatemala to Colombia and Ecuador) and the topotypical Q. cerialis from Suriname is 1.4% (9 bp). Therefore, this clade represents a new species that keys to “Quadrus cerealis [sic]” (E.39.1) in Evans (1953) and was included by him in that taxon, but differs from it and other relatives by the combination of the following characters: usually intermediate in expression blue areas and average brown marginal areas on the ventral hindwing with less prominent and narrower postdiscal brown spots; a more gracile harpe with a smaller but broader expansion of the ampulla that is separated from the harpe by a shallower notch; and a larger uncus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.106.2:T2175C, aly536.106.2:A4089G, aly1656.2.5:T291C, aly84.45.7:C294T, aly84.45.7:T306G; and COI barcodes introgress into some specimens of the new species described above, thus not offering a reliable way to identify this species.

Barcode sequence of the holotype.

Sample NVG-19087D01, GenBank PV972453, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCATCTCTATTACTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACAGTTTATCCTCCTCTTTCTGCTAATATTGCACATCAAGGATCCTCAGTAGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAGTTAATAATCTTTCTTTAGATCAAATACCTTTATTTGTCTGAGCTGTAGGAATTACAGCATTACTTTTACTTTTATCACTACCTGTTTTAGCTGGAGCTATCACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 218–219 (genitalia Fig. 924–925), bears the following eight printed rectangular labels, seven white: [ Cayuga | Guat ], [ Aug ], [ Schaus and | Barnes | coll ], [ DNA sample ID: | NVG-19087D01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G11 | c/o Nick V. Grishin ], [ genitalia | NVG241118–47 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588843 ], and one red [ HOLOTYPE ♂ | Quadrus (Quadrus) | rialis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 2♀♀ in USNM: 1♂ NVG-19087D04, USNMENT 01588846 Honduras, Cortes, San Pedro Sula, 225 m, 17-Jun-1979, Robert D. Lehman leg. [USNM]; 1♀ NVG-18017F03, USNMENT 01450889 Panama, Herrera, Chepo, 800 m, GPS 7.7500, −80.8167, 10-Mar-1980, G. B. Small leg. [USNM]; 1♀ NVG-18017F07, USNMENT 01450892 Colombia, Choco, Cabo Marzo, 13-Sep-1970, R. E. Dietz and H. E. Moore leg. [USNM]; and 1♂ NVG-19087E06, USNMENT 01588860 Ecuador, Esmeraldas, Río Chuchuví, 12.5 km Lita-San Lorenzo Rd, 900 m, GPS 0.8835, −78.5150, Jul-2002, I. Aldas leg. [USNM].

Type locality.

Guatemala: Cayuga.

Etymology.

The name is formed by removing the first quarter (first two letters) of the specific epithet of its congener, Q. cerialis, and is treated as a noun in apposition.

Distribution.

Guatemala to Ecuador.

Quadrus (Quadrus) tee Grishin, new species

https://zoobank.org/C2803561-B6B3-40E6-AEBF-F5B080D49E37

(Fig. 7 part, 220–221)

Definition and diagnosis.

Genomic analysis of a Quadrus Lindsey, 1925 (type species Papilio cerialis Stoll, 1782) specimen from Colombia reveals that it is sister to several other species, being genetically differentiated from them at the species level (Fig. 7); e.g., its COI barcode differs from Quadrus (Quadrus) truncata (Hewitson, 1870) (type locality in Ecuador) by 3.2% (21 bp), and therefore it represents a new species. This new species keys to Q. truncata (E.39.8) in Evans (1953), but differs from it by smaller forewing semihyaline spots (e.g., the discal cell spot is broken along its posterior arm), a more prominent discal row of darker spots on the hindwing (both sides), and less extensive pale-bluish-white areas beneath. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly128.12.13:C130T, aly310.1.17:C1611T, aly525.3.4:T421C, aly7615.6.2:C111T, aly102.15.9:C105G, aly595.8.1:T324T (not C), aly1720.2.5:C60C (not T), aly1720.2.5:T96T (not A), aly904.6.2:T39T (not C), aly691.4.1:A138A (not G); and COI barcode: T91T, A100G, A238A, T463C, T542C, T574A, T646C.

Barcode sequence of the holotype.

Sample NVG-22013B12, GenBank PV972454, 658 base pairs:

AACCTTATATTTTCTTTTCGGAATTTGAGCTGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAACTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCATCTCTTTTATTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTACCCTCCTCTCTCTGCTAATATTGCTCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAACATACGAATTAATAATCTTTCAATAGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTACTTCTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Naturalis Biodiversity Center, Leiden, Netherlands (RMNH), illustrated in Fig. 220–221, bears the following three printed (text in italics handwritten) rectangular labels, two white: [ Museum Leiden | COLUMBIA | Medellin | 14-IX-1973 ], [ DNA sample ID: | NVG-22013B12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Quadrus (Quadrus) | tee Grishin ].

Type locality.

Colombia: Antioquia Province, Medellín.

Etymology.

The name refers to the T-shaped discal forewing spot and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the western Andes in Colombia.

Quadrus (Quadrus) truncatoides Grishin, new species

https://zoobank.org/F15542F7-1942-46B6-B621-EEF41A58B72E

(Fig. 7 part, 222–223, 926–927)

Definition and diagnosis.

Genomic analysis of Quadrus Lindsey, 1925 (type species Papilio cerialis Stoll, 1782) reveals a clade of specimens from southern Peru and Bolivia that is sister to several other species, being genetically differentiated from them at the species level (Fig. 7); e.g., their COI barcode differs from Quadrus (Quadrus) truncata (Hewitson, 1870) (type locality in Ecuador) by 4.1% (27 bp), and therefore it represents a new species. This new species keys to Q. truncata (E.39.8) in Evans (1953), but differs from it by yellower semihyaline spots, a spot in the forewing cell R₅-M₁ that is either missing or small, a reduced pale area around the semihyaline spots in the cell CuA₂-1A+2A of the ventral forewing, a wider brown margin on the ventral hindwing, and a narrower harpe. Due to possibly cryptic nature of this species, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly221.7.14:T1503C, aly1042.30.1:G378A, aly366.4.1:T4948A, aly188.9.2:C83T, aly188.9.2:A173C; and COI barcode: A23G, T133C, G353A, A376T, A565G.

Barcode sequence of the holotype.

Sample NVG-23075C11, GenBank PV972455, 658 base pairs:

AACCTTATATTTTATTTTCGGAGTTTGAGCTGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCTCCATCTCTTTTATTATTAATTTCAAGAAGTATTGTAGAAAATGGGGCAGGAACAGGTTGAACAGTTTACCCACCTCTCTCTACTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATCTTTCAATAGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTACTTTTATCCTTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 222–223, bears the following five rectangular labels (3^rd handwritten, others printed), four white: [ Marcapata | Peru ], [ Coll. | Staudinger ], [ 75:4. ], [ DNA sample ID: | NVG-23075C11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Quadrus (Quadrus) | truncatoides Grishin ]. Paratypes: 6♂♂: Peru, Cuzco: 1♂ NVG-18018A04, USNMENT 01450922 Quitacalzone, Cosñipata Road, el. 1050 m, 12-May-2012, S. Kinyon leg. [USNM] and 1♂ NVG-23075D03 Callanga, 1500 m, 1898, O. Garlepp leg. [MFNB] and Bolivia: 1♂ NVG-22018F04 no other data, old specimen [ZSMC]; 1♂ NVG-22018F05 (leg, DNA sequenced), NVG-23084F04 (abdomen, DNA stored) Yungas de Palmar, el. 1250 m, 17-Oct-1953, W. Forster leg., genitalia NVG241118–48 (Fig. 926–927) [ZSMC]; and 2♂♂ O. Garlepp leg. [MFNB]: NVG-23075C12 La Paz, Río Tanampaya, 1894 and NVG-23075D02 Bueyes.

Type locality.

Peru: Cuzco Region, Quispicanchi Province, Marcapata.

Etymology.

The name is formed from its close more northern relative, Q. truncata, made longer, and is an adjective.

Distribution.

Southern Peru and Bolivia.

Lectotype designation for Gindanes truncata var. obscurascens Mabille and Boullet, 1917

Gindanes truncata var. obscurascens Mabille and Boullet, 1917 was described from two specimens from Mexico and Venezuela (Mabille and Boullet 1917). In MNHP, we located and sequenced a syntype from Mérida, Venezuela (NVG-18078D08), which bears a red “type” label and is labeled with this taxon name. A possible syntype from Mexico lacks detailed locality data and an abdomen, and is not curated as a type specimen. Because of the possibly polytypic type series, to define the taxonomic identity of the name G. truncata var. obscurascens objectively, N.V.G. hereby designates the syntype in the MNHP collection, the male with the following five rectangular labels (1^st red, 3^rd green, others white; 3^rd and 4^th handwritten, others printed with handwritten text shown in italics): [ TYPE ], [ Merida | Venezuela | 1901 | m. Boursey | MUSEUM DE PARIS ], [ G. Truncata | var. Obscurascens | Mab. et Boull. ], [ Gindanes | truncata var. | obscurascens | Mab.-Boull. | Bull. Soc. entom. Fr., | 1917, p. 101 ], and [ DNA sample ID: | NVG-18078D08 | c/o Nick V. Grishin ] as the lectotype of Gindanes truncata var. obscurascens Mabille and Boullet, 1917. The lectotype is a nearly perfect specimen with well-preserved fringes, forewings only partly pulled forward, and the head tilted to the right. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). As a result, the type locality of G. truncata var. obscurascens becomes Venezuela: Mérida. The COI barcode sequence of the lectotype, sample NVG-18078D08, GenBank PV972456, 658 base pairs is:

AACCTTATATTTTATTTTCGGAATTTGAGCTGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATGGTTATGCCAATTATAATTGGAGGATTTGGAAACTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCTCCATCTCTTCTGTTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTTTATCTGCTAATATTGCTCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATCAATTTTATTACTACAATTATTAACATACGAATTAATAATCTTTCAATAGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTACTTTTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Gindanes truncata var. obscurascens Mabille and Boullet, 1917 is a junior subjective synonym of Quadrus (Quadrus) ophia (Butler, 1870) and not of Quadrus (Quadrus) lugubris (R. Felder, 1869)

Genomic analysis of the lectotype of Gindanes truncata var. obscurascens Mabille and Boullet, 1917 (type locality Venezuela: Mérida, sequenced as NVG-18078D08), a taxon currently treated as a junior subjective synonym of Quadrus lugubris (R. Felder, 1869) (type locality Mexico: Veracruz, Orizaba), reveals that it is not monophyletic with that species and instead is placed within specimens of Quadrus ophia (Butler, 1870) (type locality in Venezuela), which agrees with their phenotypes and localities. Therefore, we propose a new placement of Gindanes truncata var. obscurascens Mabille and Boullet, 1917 as a junior subjective synonym of Quadrus ophia (Butler, 1870) and not of Quadrus lugubris (R. Felder, 1869).

Quadrus (Quadrus) lugubroides Grishin, new species

https://zoobank.org/5FE33CFD-0A9C-4B0E-BD66-097B63328FD8

(Fig. 7 part, 224–225, 928–931)

Definition and diagnosis.

Genomic analysis of specimens from Oaxaca, Mexico, identified as Quadrus lugubris (R. Felder, 1869) (type locality Mexico: Veracruz, Orizaba), reveals that they are genetically differentiated from it at the species level (Fig. 7); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore they represent a new species. This new species keys to “Quadrus lugubris lugubris” (E.39.7(a)) in Evans (1953), but differs from it and other relatives by a typically paler coloration, less well-defined and framed doublet of hyaline spots by the forewing mid-costa, and a broader valva and harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.40.15:G24A, aly525.40.15:G33A, aly2627.8.2:C285T, aly2612.8.2:A70C, aly2612.8.2:G105A, aly10825.2.3:A102A (not G), aly2874.8.9:C33C (not T), aly3535.1.4:G63G (not A), aly390.8.4:A48A (not T), aly1405.11.9:T52T (not C); and COI barcode: C4T, C235T, A268G, T427C, T562A.

Barcode sequence of the holotype.

Sample NVG-22056C07, GenBank PV972457, 658 base pairs:

AACTTTATATTTTCTTTTCGGAATTTGAGCTGGAATAATTGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTGCCCCCATCCCTTTTATTATTAATTTCAAGAAGTATTGTAGAAAATGGGGCAGGAACAGGTTGAACAGTTTATCCACCTCTCTCTGCTAATATTGCTCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCAATCTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAACCTCTCAATAGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTACTCTTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 224–225 (genitalia Fig. 928–929), bears the following seven rectangular labels (3^rd handwritten, others printed, 2^nd and the last red, others white): [ Mexico: Oaxaca | 2 mi N Candelaria | 22,23,25.x.1988 | J. Kemner leg. #059 ], [ Texas Memorial | Museum –UTexas | JKemner Spec. | 402 ], [ 059 ], [ DNA sample ID: | NVG-22056C07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24016C04 | c/o Nick V. Grishin ], [ genitalia | NVG241220–08 | c/o Nick V. Grishin ], [ HOLOTYPE ♀ | Quadrus (Quadrus) | lugubroides Grishin ]. The numbers 402 and 059 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2^nd and 3^rd labels were original labels on the holotype. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ NVG-23113D09 (genitalia NVG241118–49, Fig. 930–931) and NVG-23113D10 from Mexico, Oaxaca, Pluma Hidalgo, 29-Jan-1989, John Kemner leg. [CMNH].

Type locality.

Mexico: Oaxaca, 2 mi N of Candelaria Loxicha.

Etymology.

The name is formed from the name of its sister species, Q. lugubris, and is an adjective.

Distribution.

Currently known only from Oaxaca, Mexico.

Lectotype designation for Pythonides praxis Plötz, 1884

Pythonides praxis Plötz, 1884 (Maassen in litt.) was described from an unstated number of specimens from “Cayenne” (likely French Guiana or nearby) (Plötz 1884b). To define the taxonomic identity of the name P. praxis objectively, N.V.G. hereby designates the syntype in the MFNB collection, a female with the following five rectangular labels (1^st red, others white; 2^nd and 3^rd handwritten, others printed): [ Typus ], [ praxis | Msn. i.l. | Pl. | (Cayenne) ], [ Pythonides | Praxis | M. | Cay. ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 940bbb ], and [ DNA sample ID: | NVG-15032G04 | c/o Nick V. Grishin ] as the lectotype of Pythonides praxis Plötz, 1884. The 3^rd label is typical for specimens from the Maassen collection and is likely in his handwriting, with “M.” possibly standing for Maassen, thus giving additional evidence that this specimen is from the type series. The lectotype is missing the left antenna and half of the right antenna, and has a right hindwing tear near the middle of the costal margin, which is folded over. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032G04, GenBank PV972458, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCTGATATAGCCTTCCCACGAATAAATAACATAAGTTTTTGATTACTACCTCCTTCTCTTTTATTATTAATCTCAAGTAGAGTAGTAGAAAGTGGAGCTGGAACAGGATGAACAGTTTACCCACCTTTATCTGCTAATATCGCTCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACTACTATTATTAATATACGAATTAATAAATTTTCATTAGATCAAATATCTTTATTTGTATGGTCAGTTGGTATTACAGCATTACTTTTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Pythonides praxis Plötz, 1884 is a junior subjective synonym of Quadrus (Tuberna) deyrollei deyrollei (Mabille, 1877) and not of Quadrus (Tuberna) contubernalis (Mabille, 1883)

Genomic analysis of the lectotype of Pythonides praxis Plötz, 1884 (type locality French Guiana: Cayenna, sequenced as NVG-15032G04), a taxon currently treated as a junior subjective synonym of Quadrus contubernalis contubernalis (Mabille, 1883) (type locality in Brazil and “Guyana”), reveals that it is not monophyletic with it, and instead is placed within specimens of Quadrus deyrollei deyrollei (Mabille, 1877) (type locality French Guiana: Cayenna) (Fig. 7), which agrees with their phenotypes. Therefore, we propose a new placement of Pythonides praxis Plötz, 1884 as a junior subjective synonym of Quadrus deyrollei deyrollei (Mabille, 1877) and not of Quadrus contubernalis contubernalis (Mabille, 1883).

Quadrus (Tuberna) syntrophos Grishin, new species

https://zoobank.org/3D73DF84-FB6D-48F2-A65A-6BCCCFF5490D

(Fig. 7 part, 226–227, 932–933)

Definition and diagnosis.

Genomic analysis of specimens identified as Quadrus contubernalis contubernalis (Mabille, 1883) (type locality in Brazil and “Guyana”) reveals that they partition into two nuclear genome clades at the species level (Fig. 7a); however, their COI barcodes do not differ strongly, 0.6% (4 bp). One clade with specimens from Brazil and Guyana corresponds to Quadrus contubernalis, while the other, with specimens from Ecuador, Venezuela, and southern Peru, represents a new species. This new species keys to “Quadrus contubernalis contubernalis” (E.39.4(b)) in Evans (1953), but differs from it and other relatives by purplish blue (instead of bright blue) bands; a submarginal dorsal hindwing band that does not fuse with the marginal band around the vein CuA₂, not leaving a brown oval within blue; a longer uncus; and a more rounded, less extended harpe with a dorsal hump closer to its distal end. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly86.14.3:T60C, aly86.14.3:T72G, aly1603.74.5:T60A, aly259.6.22:C84T, aly259.6.22:A99T; and COI barcode: T232T, A238A, A328A, T379T, A430T, G508G, T589C, A625A, however, not all specimens may be identifiable by the barcode due to possible introgression.

Barcode sequence of the holotype.

Sample NVG-18017G10, GenBank PV972459, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCATCTCTTTTATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCTCCTTTATCTGCTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATCTTTCATTAGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCAATTACTATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 226–227 (genitalia Fig. 932–933), bears the following six printed rectangular labels, five white: [ ECUADOR: Orellana, | Tiputini Biodiversity Station, | Lower Río Tiputini, | 0 37’55” S, 76 08’ 39” W | 200 m, 10–15 Aug 2002 | J.P.W. Hall & M.A. Solis ], [ DNA sample ID: | NVG-18017G10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119G12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–50 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450905 ], and one red [ HOLOTYPE ♂ | Quadrus (Tuberna) | syntrophos Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ in USNM: 1♂ NVG-18017G09, USNMENT 01450904 Venezuela, Barinas, Río Caparo Research Station, 32 km E of El Canton, 3–5-Feb-1978, J. B. Heppner leg., genitalia X-1658 J. M. Burns 1982 and 1♂ NVG-18017G11, USNMENT 01450906 Peru, Madre de Dios, Amazonia Lodge, Atalaya, el. 491 m, 2-Oct-2011, S. Kinyon leg.

Type locality.

Ecuador: Orellana Province, Lower Río Tiputini, Tiputini Biodiversity Station, elevation 200 m, GPS −0.6319, −76.1442.

Etymology.

The word contubernalis is a Latin term that typically refers to a military comrade, companion, or tent-mate. In a military context, it often denotes a close associate or fellow soldier who shares living quarters, such as a tent, during campaigns or military service. The term is formed from “con-” (with) and “taberna” (tent), emphasizing the idea of individuals sharing a tent or living space. It is commonly found in historical and military writings. In Greek, the equivalent concept of the Latin contubernalis would be “σύντροφος” (syntrophos). It generally means companion or comrade and can be used in various contexts, including military or social settings. The name is a noun in apposition.

Distribution.

Broadly distributed in South America, recorded from Ecuador, Venezuela, and southern Peru.

Lectotype designation for Achlyodes bubaris Godman and Salvin, 1895

Achlyodes bubaris Godman and Salvin, 1895 was described from two specimens stated to be from Cueste de Misantla, [Veracruz], Mexico (Godman and Salvin 1895). One of these specimens, curated as “Type” in BMNH, was illustrated in the original description according to its label, but is from “Zapote, Guatemala,” not Mexico. This specimen matches the illustration and agrees with the original description, except that it was stated to be a male but is a female. Males of this species lack white spots, but the description mentions a semihyaline white spot near the costa on the forewing, also shown in the illustration and characteristic of females. Moreover, the illustrated type specimen bears a label “Wrongly stated to be ♂”, likely in Godman’s handwriting. Considering this mistake in the original description and having no reason to doubt the Guatemalan locality of the illustrated syntype as given on its label, we suggest that other mistakes in the description were also possible, and the “Guatemala” locality was erroneously omitted from the original description. In a later publication, Godman (1901b) stated for A. bubaris “To the localities given, add:—Guatemala, Zapote” in agreement with this hypothesis. We argue that this added locality was for the original specimen (syntype) and not for some specimens discovered after the original description. This is because two specimens were mentioned in the original description, but Godman-Salvin collection holdings in BMNH have only one specimen from Mexico, and the second specimen is from Guatemala: two specimens in total labeled by Godman and Salvin as “Achlyodes bubaris”. Furthermore, the Guatemalan specimen agrees with the original illustration better than the Mexican specimen: the former has paler submarginal area on the dorsal hindwing. Considering all this evidence, we conclude that the Guatemalan specimen is a syntype of A. bubaris that was illustrated on plate 86 in Figs. 13, 14, and thus better represents the authors’ concept of this species.

Figure 13.

Phylogenetic trees of selected Hesperiina inferred from protein-coding regions in a) the Z chromosome, based on 303,033 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Figure 14.

Phylogenetic trees of selected Moncina (part 1) inferred from protein-coding regions in a) the Z chromosome, based on 410,313 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

To stabilize nomenclature, clarify the type locality, and define the name A. bubaris objectively, N.V.G. hereby designates the syntype in the BMNH collection, the male that, according to its label, was illustrated by Godman and Salvin (1895), and bears the following ten labels (first two and the last round, others rectangular; first two with a red circle on one side, last yellow, others white; 5^th and 10^th handwritten, others printed): ( Type ), ( Type ) and on the other side of this label handwritten ( H | 743 ), [ Zapote, | Guatemala. | Champion. ], [ ♀ ], [ Wrongly | stated to | be ♂ ], [ Type. | Sp. figured. ], [ B.C.A.Lep.Rhop. | Achlyodes | bubaris, | G.&S. ], [ Godman-Salvin | Coll. 1912.—23. ], [ BMNH(E) 1236532 ], ( 551 ) as the lectotype of Achlyodes bubaris Godman and Salvin, 1895. The lectotype has a tear on its left forewing from the middle of the costal margin and is missing the right antenna. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of A. bubaris becomes Guatemala: Escuintla Department, El Zapote, elevation ~2000 ft, approx. GPS 14.383, −90.867 (Selander and Vaurie 1962). Presently, A. bubaris is treated as a valid species of Quadrus (Cyrna) Grishin, 2023.

Lectotype designation for Achlyodes calavius Godman and Salvin, 1895

Achlyodes calavius Godman and Salvin, 1895 was described from four specimens from Guatemala, Nicaragua, and Panama (Godman and Salvin 1895). To stabilize nomenclature, clarify the type locality, and define the name A. calavius objectively, N.V.G. hereby designates the syntype in the BMNH collection, the male that, according to its label, was illustrated by Godman and Salvin (1895), and bears the following ten labels (first two and the last round, others rectangular; first two with a red circle on one side, last yellow, others white; 8^th and last handwritten, others printed): ( Type ), ( Type ) and on the other side of this label handwritten ( H | 740 ), [ Bugaba, | Panama. | Champion. ], [ ♂ ], [ Type. | Sp. figured. ], [ B.C.A.Lep.Rhop. | Achlyodes | calavius, | G.&S. ], [ Godman-Salvin | Coll. 1912.—23. ], [ B13 | ], genitalia are glued to this label, [ BMNH(E) 1236531 ], ( 549 ) as the lectotype of Achlyodes calavius Godman and Salvin, 1895. The lectotype has the left forewing pulled forward more than the right forewing, and the right antenna is less parallel to the costal margin of the forewing. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of A. calavius becomes Panama: Chiriquí Province, Bugaba, elevation ~1000 ft, approx. GPS 8.467, −82.633 (Selander and Vaurie 1962). Presently, A. calavius is treated as a valid species of Quadrus (Cyrna) Grishin, 2023.

Lectotype designation for Achlyodes colotes Godman and Salvin, 1895

Achlyodes colotes Godman and Salvin, 1895 was described from two females from Nicaragua and Panama (Godman and Salvin 1895). To stabilize nomenclature, clarify the type locality, and define the name A. colotes objectively, N.V.G. hereby designates the syntype in the BMNH collection, the female that, according to its label, was illustrated by Godman and Salvin (1895), and bears the following eight printed labels (first three round, others rectangular; first three with a red circle, others white): ( Type ), ( Type ) and on the other side of this label handwritten ( H | 742 ), [ Bugaba, | 800–1,500 ft. | Champion. ], [ ♀ ], [ Type. | Sp. figured. ], [ B.C.A.Lep.Rhop. | Achlyodes | colotes, | G.&S. ], [ Godman-Salvin | Coll. 1912.—23. ], [ BMNH(E) 1236533 ] as the lectotype of Achlyodes colotes Godman and Salvin, 1895. The lectotype has a damaged fringe in the middle of the left forewing outer margin, and the base of the right hindwing above is covered with glue. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of A. colotes becomes Panama: Chiriquí Province, Bugaba, elevation ~1000 ft, approx. GPS 8.467, −82.633 (Selander and Vaurie 1962). Presently, A. colotes is treated as a junior subjective synonym of Quadrus (Cyrna) calavius (Godman and Salvin, 1895), and we agree with this treatment. It is most likely that A. colotes is a female conspecific with a male described as Achlyodes calavius.

Quadrus (Cyrna) baris Grishin, new species

https://zoobank.org/807C7339-FA23-4925-8599-A4D834D7D071

(Fig. 7 part, 228–229, 934–935)

Definition and diagnosis.

Genomic analysis of specimens initially identified as Quadrus (Cyrna) bubaris (Godman and Salvin, 1895) (type locality Guatemala: El Zapote) reveals that they are partitioned into two clades at the species level (Fig. 7); e.g., their COI barcodes differ by 3.2% (21 bp). The clade with specimens from Guatemala and Mexico: Veracruz corresponds to Quadrus (Cyrna) bubaris, while the second clade, with specimens from northeastern Mexico, does not have a name and therefore represents a new species. This new species keys to “Ouleus calavius bubaris” (E.37.2(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters in males: distinctly smaller than Q. bubaris and of a size of Q. calavius, from which it differs by better developed submarginal paler (but still dark-brown) areas on all wings above and the forewing beneath (the wings are more uniformly colored black-brown in Q. calavius); and the ventral hindwing paler submarginal area typically better separated from the darker rest of the wing than even in Q. bubaris. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly727.31.2:A39T, aly1772.7.1:G388A, aly2284.1.4:A765G, aly2284.1.4:T789C, aly171.6.1:G1086A; and COI barcode: A100G, T263T, T319C, T460C, T514T, T529C.

Barcode sequence of the holotype.

Sample NVG-21014H09, GenBank PV972460, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCCGGAATAATTGGAACCTCATTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCACCTTCTTTATTACTATTAATTTCAAGTAGTATTGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTACCCACCTCTTTCTTCTAACATTGCTCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCCGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATCAATATACGAATTAATAATCTTTCTTTAGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACTGCCTTACTTTTATTATTATCTTTACCTGTCTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 228–229, bears the following three printed (text in italics handwritten) rectangular labels, two white: [ Mex:S.L.P. Xilitla | 13 July 1990 - el.2000’ | John Kemner ], [ DNA sample ID: | NVG-21014H09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Quadrus (Cyrna) | baris Grishin ]. Genitalia vial of the holotype has not been located. Paratypes: 3♂♂ from Mexico [MGCL]: 1♂ NVG-23053F10, LEP-79308 from the type locality, 18-Oct-1984, C. F. Zeiger leg. and Tamaulipas, 0–3-NW of Gomez Farias, 11-Sep-1967: 1♂ NVG-23053F08 genitalia SRS-2029 (Fig. 934–935) and 1♂ NVG-23053F11 genitalia SRS-2742.

Type locality.

Mexico: San Luis Potosí, Xilitla, elevation 2000’.

Etymology.

The name is formed from the name of its sister species, Q. bubaris, made shorter for this more northern, and smaller in size, relative. The name is treated as a noun in apposition.

Distribution.

Northeastern Mexico.

Quadrus (Cyrna) pacuvius Grishin, new species

https://zoobank.org/36A3C20B-2071-412C-8FB9-8679C8A52976

(Fig. 7 part, 230–231, 936–937)

Definition and diagnosis.

Genomic analysis of a male from Pastaza Province in Ecuador places it as sister to several species of Quadrus (Cyrna) Grishin, 2023, genetically differentiated from them at the species level (Fig. 7); e.g., its COI barcode differs from Quadrus (Cyrna) calavius (Godman and Salvin, 1895) (type locality Panama: Chiriqui Province, Bugaba) by 1.5% (10 bp), and therefore represents a new species. This new species keys to “Ouleus calavius calavius” (E.37.2(b)) in Evans (1953), but differs from it and other relatives by the following combination of characters in males: a more rounded forewing dorsally paler towards the outer margin; a broader harpe with a more convex ventral margin and a longer process of the ampulla more parallel to the costa of the valva. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly798.30.12:C175T, aly1651.51.1:A147G, aly1651.51.1:C90T, aly1042.8.3:A60G, aly1838.7.1:A286C, aly133.8.1:C45C (not T), aly133.8.1:C271C (not A), aly349.41.4:C210C (not T), aly577.8.15:G99G (not A), aly767.7.2:T453T (not A); and COI barcode: T40C, T124T, C220C, T542C, 451T.

Barcode sequence of the holotype.

Sample NVG-19076D05, GenBank PV972461, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCCGGAATAATCGGAACCTCATTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCACCTTCTTTATTACTATTAATTTCAAGTAGTATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCACCTCTTTCTTCTAACATTGCTCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATCTTTCCTTAGATCAAATACCATTATTTGTATGAGCCGTAGGAATTACTGCTTTACTTTTATTACTATCTTTACCTGTCTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 230–231 (genitalia Fig. 936–937), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Puyo, Pastaza | ECUADOR 1,000m | 7 Dec. ‘72 | S.S. Nicolay ], [ genitalia | ♂ /vial # | H566 | Prep. S.S. Nicolay ], [ Ouleus ♂ | calavius | Det. G&S. | S.S. Nicolay ], [ DNA sample ID: | NVG-19076D05 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588670 ], and one red [ HOLOTYPE ♂ | Quadrus (Cyrna) | pacuvius Grishin ].

Type locality.

Ecuador: Pastaza Province, Puyo, elevation 1000 m.

Etymology.

Pacuvius Calavius was the chief magistrate of Capua during the Second Punic War (218–201 BC), and his first name is taken as the name of this new species, which is sister to the species with his second name (Q. calavius). The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected to the east of the Andes in central Ecuador.

Quadrus (Cyrna) rahus Grishin, new species

https://zoobank.org/2FC91FD4-498C-4AB4-96B4-3202B3BAC04D

(Fig. 7 part, 232–233, 938–940)

Definition and diagnosis.

Genomic analysis of a female from Tungurahua Province in Ecuador places it as sister to several species of Quadrus (Cyrna) Grishin, 2023, genetically differentiated from them at the species level (Fig. 7); e.g., its COI barcode differs from Quadrus (Cyrna) calavius (Godman and Salvin, 1895) (type locality Panama: Chiriqui Province, Bugaba) by 2.1% (14 bp), and therefore represents a new species. This new species keys to “Ouleus calavius” (E.37.2) in Evans (1953) (but not to any of its two subspecies due to the lack of apical hyaline spots), differing from it and other relatives by the following combination of characters in females: completely dark-brown wings above, slightly paler in the submarginal area and the forewing at the end of the discal cell; the lack of subapical hyaline spots; monotone brown ventral side of wings with slightly darker veins but without any pattern; and white cheeks. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1651.10.4:A201T, aly1651.10.4:T233C, aly525.128.1:A510G, aly1838.7.1:A879G, aly1838.7.1:T141C, aly2487.17.2:T60T (not C), aly528.14.9:C147C (not T), aly528.14.9:C150C (not T), aly1407.8.9:T57T (not C), aly800.2.1:A1136A (not G); and COI barcode: T40C, T136C, C220T, A415G, G554A.

Barcode sequence of the holotype.

Sample NVG-19076F10, GenBank PV972462, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCCGGAATAATCGGAACCTCATTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACTGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCACCTTCTTTATTACTACTAATTTCAAGTAGTATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCACCTCTTTCTTCTAACATTGCTCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGGATTTCTTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAACATACGAATTAATAATCTTTCCTTAGATCAAATACCATTATTCGTATGAGCCGTAGGAATTACTGCTTTACTTTTATTATTATCTTTACCTATCTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 232–233 (genitalia Fig. 938–940), bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [ Rio Topo 1500 m | Tungurahua, ECUADOR | 29 Sept. ‘73 | S.S.Nicolay ], [ Ouleus ♀ | fatinitza | Det. Plötz | S.S. Nicolay ], [ Allyn Museum photo | No. 0225 76–9,10 ], [ DNA sample ID: | NVG-19076F10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032D09 | c/o Nick V. Grishin ], [ genitalia | NVG241118–51 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588699 ], and one red [ HOLOTYPE ♀ | Quadrus (Cyrna) | rahus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Tungurahua Province, Río Topo, elevation 1500 m.

Etymology.

The name is derived from the type locality, [Tunga]rahu[a]+s, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of central Ecuador.

Quadrus (Ebona) fuscus Grishin, new species

https://zoobank.org/F389D919-E368-45CF-808E-DCE4A7DE2750

(Fig. 7 part, 234–235, 941–942)

Definition and diagnosis.

Genomic analysis of a female from central Panama places it within a rapid radiation of several Quadrus (Ebona) Grishin, 2023 species, genetically differentiated from them at the species level (Fig. 7); e.g., its COI barcode differs from Quadrus (Ebona) negrus (Nicolay, 1980) (type locality in west-central Panama) by 2.6% (17 bp), and therefore this female represents a new species. This new species keys (incompletely) to “Zera eboneus” (E.38.7) in Evans (1953) (a species not recognized by Evans in BMNH, and probably misidentified by him because he incorrectly placed it in Zera Evans, 1953), but differs from it and other relatives by four subapical pale or semihyaline spots on the forewing and a pale posterior half of the ventral hindwing similar to that (but with a brown tinge, not purely white) in Quadrus (Ebona) cristatus (Steinhauser, 1989) (type locality in Colombia) and Quadrus (Ebona) pescada (E. Bell, 1956) (type locality in Ecuador), which are more distant relatives of this species than Quadrus (Ebona) eboneus E. Bell, 1947 (type locality in Mexico: Veracruz) and Q. (Ebona) negrus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2095.2.2:G97A, aly1979.5.1:C162T, aly4778.1.2:A165G, aly1260.1.1:A48G, aly1341.12.62:C36T, aly997.8.3:T55T (not A), aly3109.8.11:C554C (not A), aly1531.13.3:C34C (not T), aly423.7.4:C79C (not T), aly522.9.5:C96C (not G); and COI barcode: T277C, T281T, T421C, A466G, C478A.

Barcode sequence of the holotype.

Sample NVG-19076F09, GenBank PV972463, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCCTTATTACTATTAATTTCAAGTAGTTTAGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCTTTATCTGCTAATATTGCACATCAAGGCTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCCTCAATCTTAGGAGCTATTAACTTTATTACTACAATTATTAATATGCGAATTAATAAATTATCATTAGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCATTACTTTTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 234–235 (genitalia Fig. 941–942), bears the following six rectangular labels (1^st handwritten, others printed), five white: [ Altos de Pacora 2200’ | Pma., Panama | 14 March 75 | GBSmall ], [ DNA sample ID: | NVG-19076F09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032D08 | c/o Nick V. Grishin ], [ genitalia | NVG241118–52 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588698 ], and one red [ HOLOTYPE ♀ | Quadrus (Ebona) | fuscus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Panamá Province, Altos de Pacora, elevation 2200’.

Etymology.

As with the names of its close relatives, Q. eboneus and Q. negrus, the name of the new species refers to its dark colors. In Latin, fuscus means dark or dusky and describes a less intense black, often with a brownish tinge, like that in the holotype of this species. The name is a masculine adjective.

Distribution.

Currently known only from the holotype collected in central Panama.

Quadrus (Ebona) atrus Grishin, new species

https://zoobank.org/EC7BC005-34C3-4AB1-80B4-EBCB345B213E

(Fig. 7 part, 236–237)

Definition and diagnosis.

A relative of other nearly black species from Central America, such as Quadrus (Ebona) eboneus E. Bell, 1947 (type locality in Mexico: Veracruz) and Quadrus (Ebona) negrus (Nicolay, 1980) (type locality in Panama), this new species from Panama is genetically differentiated from them (Fig. 7), and differs by about 4% (26 bp) in the COI barcode. However, in the mitochondrial DNA, it is closer to white-venter species Quadrus (Ebona) cristatus (Steinhauser, 1989) (type locality in Colombia) and Quadrus (Ebona) pescada (E. Bell, 1956) (type locality in Ecuador), differing from them by 2.4% (16 bp) in the barcode. This new species keys to “Zera eboneus” (E.38.7) in Evans (1953) (a species not recognized by Evans in BMNH, and probably misidentified by him as he placed it in Zera Evans, 1953), but differs from it and other relatives by the following combination of characters: the wings are nearly black above with traces of slightly paler submarginal bands and discal cell spots, dark brown beneath with a paler inner marginal third of the forewing and the postdiscal area (more restricted towards the outer margin than in Q. negrus), the end of the discal cell, and the postbasal areas of the hindwing with its anal section more extensively overscaled with yellowish scales, giving it a paler appearance with an olive tint, the palpi brownish-gray beneath, and the forewings are slightly rounder than in relatives. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly570.8.5:C201T, aly536.224.1:T162A, aly1149.2.2:A153G, aly636.1.2:G54A, aly274.7.1:G403A, aly251.13.2:A39A (not G), aly7236.1.5:C64C (not T), aly686.19.2:C74C (not T), aly2997.2.3:C42C (not T), aly1018.4.3:C2958C (not T); and COI barcode: A166A, A184G, T287C, T379C, A544G.

Barcode sequence of the holotype.

Sample NVG-23093F09, GenBank PV972464, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCATTATTACTGCTAATTTCAAGTAGTTTAGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTATCCGCCTTTATCTGCTAATATTGCACATCAAGGTTCTTCCGTAGATTTAGCCATTTTTTCATTGCATTTAGCTGGAATTTCATCAATCTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGAATTAATAACTTATCACTAGATCAAATACCTTTATTCATTTGAGCTGTAGGAATTACAGCATTACTTTTACTATTGTCATTACCTGTTTTAGCTGGAGCTATTACAATATTACTAACAGATCGAAACTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 236–237, bears the following three printed rectangular labels, two white: [ Lino Panama | 800 m | Coll.Fassl ], [ DNA sample ID: | NVG-23093F09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Quadrus (Ebona) | atrus Grishin ].

Type locality.

Panama: Chiriquí Province, Alto Lino.

Etymology.

The name for this nearly black species is formed from the Latin word ater which means black and is an adjective.

Distribution.

Currently known only from the holotype collected in western Panama.

Quadrus (Ebona) dampa (Evans, 1953) is a species distinct from Quadrus (Ebona) juxta (E. Bell, 1934)

Ouleus matria dampa Evans, 1953 (type locality in French Guiana) is currently treated as a subspecies of Pythonides juxta Bell, 1934 (type locality in Peru: San Antonio) in the subgenus Ebona Grishin, 2023 (type species Quadrus eboneus E. Bell, 1947) of the genus Quadrus Lindsey, 1925 (type species Papilio cerialis Stoll, 1782). Genomic comparison reveals that Q. juxta dampa is genetically differentiated from Q. juxta juxta at the species level (Fig. 7); e.g., their COI barcodes differ by 4.0% (26 bp). Therefore, we propose that Quadrus (Ebona) dampa (Evans, 1953), new status, is a species distinct from Quadrus (Ebona) juxta (E. Bell, 1934).

Lectotype designation for Achlyodes fatinitza Plötz, 1884

Achlyodes fatinitza Plötz, 1884 was described from an unstated number of specimens from Colombia (Plötz 1884b) and is currently treated as a valid species of Quadrus (Ebona Grishin, 2023) (type species Quadrus eboneus E. Bell, 1947) (Evans 1953; Mielke 2005; Zhang et al. 2023d). The original description, assembled from the key given by Plötz (1884b), can be translated from German as follows: “Forewing without hyaline spots. Outer margin of all wings smooth and rounded. Hindwing beneath plain brown with a very faint gray spot at and some beyond the middle. Upperside dark brown, forewings with two slightly duller bands at the margin. [forewing length] 16 mm. Colombia.”

Our inspection of the Hesperiidae collection in the MFNB, where many Hesperiidae types of Plötz are preserved, revealed a specimen from the Möschler collection labeled as “Fatinitza Plötz” collected in Colombia in 1877 (prior to the original description) that matches the original description perfectly, better than Godman’s copy of Plötz’s unpublished drawing t[afel]. 1558 in the BMNH library (Godman 1907). The drawing shows a completely brown ventral hindwing, but the specimen has a faint paler dash in the middle and a row of paler dots past the middle. Therefore, we believe that this Möschler’s specimen is a syntype of A. fatinitza. Although it is likely that many of Plötz’s descriptions were written from his drawings because many drawings agree with the descriptions better than type specimens, in this case, the description was probably drafted from the specimen, and the drawing was made later. The original description does not list the drawing number after the name but states “Hesp. Nachtr.” meaning “Hesperiidae Supplement,” which was probably not completed yet at the time of the description.

To define the taxonomic identity of the name A. fatinitza objectively, N.V.G. hereby designates the syntype in the MFNB collection, the female illustrated in Fig. 238–239 and bearing the following five rectangular labels (1^st green with a black frame around the text, others white; 1^st and 2^nd handwritten, others printed): [ Columb. | Str. 77. ], [ Fatinitza | Plötz ], [ Coll. Möschl. ], [ Coll. | Staudinger ], and [ DNA sample ID: | NVG-21116C11 | c/o Nick V. Grishin ] as the lectotype of Achlyodes fatinitza Plötz, 1884. The lectotype lacks its abdomen and is spread asymmetrically with the right forewing covering part of the hindwing. The COI barcode sequence of the lectotype, sample NVG-21116C11, GenBank PV972465, 658 base pairs is:

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGTTCAGAATTAGGTATTCCTGGATTTTTAATAGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGACTTCTACCCCCTTCTCTTACTTTACTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACAGGTTGAACTGTTTACCCTCCTTTATCTGCTAATATTGCTCATCAAGGTTCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACAACCATTATTAACATACGAATTAATAATTTATCTTTCGACCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCTTTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGTAATTTGAATACATCTTTTTTTGATCCTGCAGGAGGTGGTGATCCAATTTTATATCAACATTTATTT

Viola egra Evans, 1953 is a junior subjective synonym of Viola fatinitza (Plötz, 1884), new combination

Genomic analysis of the lectotype of Achlyodes fatinitza Plötz, 1884 (type locality in Colombia) places it among specimens identified as Viola egra Evans, 1953 (type locality in Colombia: Cesar) (Fig. 7), and the phenotypic similarity supports this placement. Therefore, we propose that Viola egra Evans, 1953 is a junior subjective synonym of Viola fatinitza (Plötz, 1884), new combination.

Quadrus (Ebona) evanitza Grishin, new species

https://zoobank.org/CA89968A-3E52-462A-9CFB-E3463FF2A78D

(Fig. 7 part, 240–241, 943–944)

Definition and diagnosis.

The discovery of a primary type specimen of Achlyodes fatinitza Plötz, 1884 (type locality in Colombia) designated as the lectotype above, reveals that it is a valid species of Viola Evans, 1953 (type species Staphylus alicus Schaus, 1902) and is not the species of Quadrus (Ebona Grishin, 2023) (type species Quadrus eboneus E. Bell, 1947) that Evans (1953) identified as “Ouleus fatinitza.” This misidentified species does not have a name and is therefore new. Genomic analysis of specimens identified as “Ouleus fatinitza” of Evans, a misidentification, reveals that they are sister to Quadrus (Ebona) dampa (Evans, 1953), new status (type locality in French Guiana) and are genetically differentiated from it at the species level (Fig. 7); e.g., their COI barcodes differ by 4.0% (26 bp). This new species keys to “Ouleus fatinitza” (E.37.4) in Evans (1953) and represents this species misidentified by Evans. In brief, it differs from its relatives by males with forewings lacking hyaline spots, dark brown with a paler area at the end of the discal cell and a submarginal pale-brown band; ventral side of wings brown with ochreous-brown spots, bands, and areas; and hindwings generally paler toward the outer margin and tornus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly770.43.2:C84T, aly37338.43.4:A188G, aly2349.3.1:C123T, aly3816.5.3:T85C, aly252.17.2:T148C; and COI barcode: T10C, T91C, A334T, T367C, T451C.

Barcode sequence of the holotype.

Sample NVG-15093H09, GenBank PV972466, 658 base pairs:

TACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCCTTAATCGGAGATGATCAAATTTATAATACTATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTTTATTATTATTAATTTCAAGTAGTTTAGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCACCTTTATCTGCTAATATTGCTCACCAAGGATCCTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAATAATCTTTCTTTAGATCAAATACCCTTATTTGTTTGAGCTGTAGGAATTACAGCTTTACTTCTTTTATTATCATTGCCAGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGTAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 240–241, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ BRASIL: Rondônia | 62 km S Ariquemes | linha C-20, 7 km E | B-65, Fazenda | Rancho Grande | 15 July 1994 | leg. G. T. Austin | (at paper lures, | 1600–1630) ], [ G.T. Austin colln. | MGCL Accession | # 2004–5 ], [ DNA sample ID: | NVG-15093H09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Quadrus (Ebona) | evanitza | Grishin ]. Paratypes: 2♂♂ from Brazil [MGCL]: 1♂ NVG-15093H06 Amazonas, Manicore, 18-Aug-1976, C. Callaghan leg. and 1♂ NVG-23053C06 Rondônia, 65 km S of Ariquemes, linea C-20, 7 km E B-65, Fazenda Rancho Grande, 19-Nov-1992, G. T. Austin leg., genitalia GTA-2647 (Fig. 943–944).

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande.

Etymology.

The name is formed from the name of the species that Evans misidentified: eva[ns] + [fati]nitza, and is treated as a noun in apposition.

Distribution.

Amazonian region.

Zera teresa Steinhauser, 1989 is a junior subjective synonym of Quadrus (Zera) latreilliana (Mabille, 1876), which is a valid species

Pterygospidea latreilliana Mabille, 1876 was described from an unstated number of syntypes from Brazil (Mabille 1876). To stabilize nomenclature and define the name P. latreilliana objectively, N.V.G. hereby designates the syntype in the BMNH collection that bears the following six labels (1^st round, others rectangular; 1^st with a red circle, others white; 2^nd and 3^rd handwritten, others printed): ( Type ) and on the other side of this label handwritten ( latreilliana | Mabille | 1876 ), [ dufresne ], [ latreillana | Type Mab ], [ R. Oberthür Coll. | Brit. Mus. 1931–136 ], [ Ex musæo | P. Mabille | 1923 ], [ BMNH(E) 1236538 ] as the lectotype of Pterygospidea latreilliana Mabille, 1876. The lectotype is missing its abdomen and the left antenna, its left hindwing has a deep tear in the tornal area, and the right hindwing is torn in the middle of the outer margin. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024).

Currently, P. latreilliana is treated as a junior subjective synonym of Quadrus (Zera) zera (A. Butler, 1870) (type locality in Venezuela). Phenotypic inspection of the P. latreilliana lectotype labeled as dufresnii (a name Latreille in litt., listed in synonymy, thus unavailable), reveals smaller size, a larger and nearly square hyaline patch in the forewing cell CuA₁-CuA₂, weaker dark coloration at the outer margin of the cell M₃-CuA₁ above, and more developed brown spotting within the yellow areas on the forewing beneath (e.g., a trace of a brown band in the cell CuA₂-1A+2A by the hyaline spot) together with a more extensive yellowish area along the outer margin by the apex and suggests that it is not conspecific with Q. zera from Venezuela, but instead is in excellent agreement with another Brazilian species, Zera teresa Steinhauser, 1989 (type locality in Brazil: Espírito Santo). Therefore, we propose that Quadrus (Zera) latreilliana (Mabille, 1876), reinstated status, is a valid species and Zera teresa Steinhauser, 1989, is its new junior subjective synonym.

Quadrus (Zera) panamia Grishin, new species

https://zoobank.org/09B137EF-DE63-48FB-9DA9-C335B752CFE2

(Fig. 7 part, 242–243, 945–946)

Definition and diagnosis.

This new species is similar to Quadrus (Zera) zera (A. Butler, 1870) (type locality in Venezuela), keys to it (“Zera zera zera”, E.38.2(a)) in Evans (1953), and was included by him in this species, but is genetically differentiated from it (Fig. 7); e.g., the COI barcode difference from the topotypical Venezuelan specimen is 1.8% (12 bp). This new species differs from its relatives by the following combination of characters: bluish-white distal half of the ventral hindwing, the discal cell only half white, and the cell M₂-M₃ is mostly brown with some white overscaling; dark spots are not prominent within the white areas (the spots are better developed in Q. zera); a larger forewing subapical hyaline spot than in Q. zera; a longer, slightly broader, and more curved harpe than in Q. zera; and a shorter and thicker process of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1432.27.1:C139A, aly1249.14.7:C60T, aly1249.14.7:C1959T, aly1097.12.1:A59G, aly1051.3.8:C153T; and COI barcode: T97T, A268G, T287C, T562C, A628G, T646C.

Barcode sequence of the holotype.

Sample NVG-19086F06, GenBank PV972467, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCTGGATTAATTGGAACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTGCCCCCCTCTCTTATATTACTAATCTCAAGTAGTGTAGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAGCTAATATTGCTCATCAAGGTTCATCTGTAGATTTAGCGATTTTTTCCTTACATTTAGCTGGAATCTCTTCAATTTTAGGAGCCATTAATTTTATTACTACAATCATTAATATACGAGTTAATAATCTTTCCTTAGATCAAATACCCCTATTTGTTTGAGCTGTTGGAATTACTGCATTACTCTTATTATTATCTTTACCTGTTTTAGCCGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 242–243 (genitalia Fig. 945–946), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA:CHIRIQUI | Santa Clara 1500 m | 8°49’N 82°50’W | 6.VII.1982 | leg. G.B.Small ], [ DNA sample ID: | NVG-19086F06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H01 | c/o Nick V. Grishin ], [ genitalia | NVG241118–53 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588783 ], and one red [ HOLOTYPE ♂ | Quadrus (Zera) | panamia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-20054A12 Panama, Chiriqui, Amistad National Park, Río Candela, ca. 1670 m, GPS 8.89925, −82.73836, 4-Jul-2013, J. R. MacDonald leg. [MEM].

Type locality.

Panama: Chiriquí Province, Santa Clara, elevation 1500 m, GPS 8.8167, −82.8333.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known from western Panama.

Quadrus (Zera) chinchia Grishin, new species

https://zoobank.org/39C562F9-FB0A-435E-B58D-FD95549C0871

(Fig. 7 part, 244–245, 947–948)

Definition and diagnosis

This new species is similar to Quadrus (Zera) zera (A. Butler, 1870) (type locality in Venezuela), keys to it (“Zera zera zera”, E.38.2(a)) in Evans (1953), and was included by him in this species, but is genetically differentiated from it (Fig. 7); e.g., the COI barcode difference from the topotypical Venezuelan specimen is 2.7% (18 bp). This new species differs from its relatives by the following combination of characters: bluish-white distal half of the ventral hindwing: the discal cell is nearly all white and the cell M₂-M₃ is mostly white with some brown overscaling; dark spots are not developed within the white areas (the spots are rather prominent in Q. zera); a forewing subapical hyaline spot larger than in Q. zera; a longer, broader, and more curved harpe than in Q. zera and the new species described above, with a more prominently serrated ventral margin prior to its middle; and a longer and thinner (similar to Q. zera) process of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2012.67.8:C66T, aly8478.8.2:A51G, aly8478.8.2:T270C, aly420.42.7:C153T, aly640.4.8:A48G, aly767.2.5:C33C (not T), aly767.2.5:G48G (not A), aly1468.20.5:T201T (not C), aly1379.13.5:C82C (not T), aly2178.9.11:G123G (not T); and COI barcode: A23G, T59C, T97C, T373C, T406C, C484T.

Barcode sequence of the holotype.

Sample NVG-19086F09, GenBank PV972468, 658 base pairs:

AACTTTATATTTTATCTTTGGAGTTTGAGCTGGATTAATTGGAACTTCTTTAAGATTACTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATCGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGGTTATTACCCCCCTCTCTTATATTATTAATCTCAAGTAGCGTAGTAGAAAATGGTGCTGGTACAGGCTGAACAGTTTATCCCCCTCTTTCAGCTAATATTGCTCATCAAGGCTCATCCGTAGATTTAGCGATTTTTTCCTTACACTTAGCTGGAATCTCTTCAATTTTAGGAGCCATTAATTTTATTACTACAATCATTAATATACGAGTTAATAATCTTTCTTTAGATCAAATACCCCTATTTGTTTGAGCTGTTGGAATTACTGCATTACTCTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 244–245 (genitalia Fig. 947–948), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR Pichincha | Tandapi 1500m | 16 Sept. ‘90 | S. S. Nicolay ], [ DNA sample ID: | NVG-19086F09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H02 | c/o Nick V. Grishin ], [ genitalia | NVG241118–54 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588786 ], and one red [ HOLOTYPE ♂ | Quadrus (Zera) | chinchia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Pichincha Province, Tandapi, elevation 1500 m.

Etymology.

The name is derived from the type locality in [Pi]chinch{i}a and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northern Ecuador.

Quadrus (Zera) cinthinus Grishin, new species

https://zoobank.org/37709E5E-461F-4691-9CF5-E57668ABD41D

(Fig. 7 part, 246–249, 949–950)

Definition and diagnosis.

This new species is similar to Quadrus (Zera) hyacinthinus (Mabille, 1877) (type locality not given) and keys to “Zera hyacinthinus hyacinthinus” (E.37.5(a)) in Evans (1953) and was included by him in that taxon, but is genetically differentiated from it (Fig. 7); e.g., their COI barcodes differ by 1.7% (11 bp). This new species differs from Q. hyacinthinus by the darker ventral forewing without the prominent orangish tornal areas of Q. hyacinthinus; and a less extensive bluish-white area on the ventral hindwing with larger, blotchier, and more diffuse brown spots. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2.1.6:C63A, aly2.1.6:C66T, aly1468.7.6:T42C, aly1468.7.6:C45T, aly1830.2.2:A57T; and COI barcode: A262A, T385C, T472C, T542C, T646C.

Barcode sequence of the holotype.

Sample NVG-19086G06, GenBank PV972469, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCTTTAATATTATTAATCTCAAGTAGTATTGTAGAAAATGGAGCTGGTACAGGTTGAACAGTTTACCCACCTCTTTCAGCTAATATTGCCCATCAAGGATCATCTGTAGACTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATCACTACAATTATTAATATACGAGTCAATAATCTTTCCTTAGATCAAATACCCCTTTTTGTTTGATCCGTAGGAATTACAGCATTACTTTTATTACTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 246–247 (genitalia Fig. 949–950), bears the following eight rectangular labels (2^nd handwritten and others printed), seven white: [ Jalapa, | Mex. ], [ Pythonides | scybis | G. S. ], [ Collection | W.Schaus ], [ DNA sample ID: | NVG-19086G06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H03 | c/o Nick V. Grishin ], [ genitalia | NVG241118–55 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588795 ], and one red [ HOLOTYPE ♂ | Quadrus (Zera) | cinthinus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-19014E01 Mexico, San Luis Potosí, Sierra Madre Oriental, EI Salto Falls, 16-Dec-1974, Roy O. Kendall and C. A. Kendall leg. [TAMU] (Fig. 248–249).

Type locality.

Mexico: Veracruz, Xalapa.

Etymology.

The name is formed from the name of its sister species Q. hyacinthinus made shorter for this more northern species and is treated as a noun in apposition.

Distribution.

Currently known from eastern Mexico.

Milanion (Milanion) chelatus Grishin, new species

https://zoobank.org/F9BCD4AB-79F9-4DB2-BCA7-FA78426418DD

(Fig. 7 part, 250–251, 951–952)

Definition and diagnosis.

A specimen identified as Milanion (Milanion) cramba Evans, 1953 (type locality in Peru: Junín, Río Colorado) due to its unshaded white costal margin of the ventral hindwing is sister to Milanion (Milanion) hemes (Cramer, 1777) (type locality in Suriname) and genetically differentiated from it at the species level (Fig. 7); e.g., their COI barcodes differ by 1.7% (11 bp), and therefore represents a new species. This new species keys (incompletely) to Milanion hemes hemes (E.46.1(a)) in Evans (1953), but differs from it by the white area on the ventral hindwing extending to the costal margin, which is not overscaled with brown as in M. hemes, similarly to M. cramba, from which it differs by the turned-inward tips of uncus arms, and from all other species in addition by the thin and long harpe narrowing to a point and turning slightly inward, and by gnathos arms farther apart than uncus arms. This species is not cryptic, however, due to unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly318.39.1:T168C, aly594.10.2:T33C, aly275215.2.9:A916C, aly536.79.1:A266G, aly2394.2.1:G156C, aly2631.9.9:G33G (not A), aly1937.10.4:G139G (not A), aly1937.10.4:G156G (not A), aly383.32.15:T45T (not A), aly104.3.10:T93T (not G); and COI barcode: T50C, T124C, C271T, T304C, A433G.

Barcode sequence of the holotype.

Sample NVG-24084C09, GenBank PV972470, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCCCTAAGCTTACTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGATTAGTACCATTAATATTAGGAGCCCCCGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTCTTATATTATTAATTTCAAGCAGTATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTCTTTCAGCTAATATTGCCCATCAAGGCTCATCAGTAGATTTAGCAATCTTCTCCTTACATTTAGCTGGAATTTCTTCAATTTTAGGGGCTATTAATTTTATCACCACTATTATTAATATACGAGTAAATAATTTATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGTATTACTGCTTTACTTTTATTATTATCTTTACCAGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 250–251 (genitalia Fig. 951–952), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU: HUANUCO | Tingo Maria | 19.ix.1962 | ex coll. Jae ], [ A. C. Allyn | Acc. 1969–20 ], [ DNA sample ID: | NVG-15094B06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24084C09 | c/o Nick V. Grishin ], [ genitalia | NVG241220–29 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Milanion (Milanion) | chelatus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Huánuco Region, Tingo María.

Etymology.

In Latin, chelatus means resembling or having chelae, i.e., pincer-like claws. The name refers to the pincers-like appearance of valvae and uncus in dorsal view and is an adjective.

Distribution.

Currently known only from the holotype collected on the eastern slopes of the Andes in central Peru.

Milanion (Milanion) guianensis Grishin, new species

https://zoobank.org/31A7CEA8-099F-46F8-9E96-F23169DA7196

(Fig. 7 part, 252–255, 953–954)

Definition and diagnosis.

Genomic analysis of Milanion Godman and Salvin, 1895 (type species Papilio hemes Cramer, 1777) specimens from the Guianas places them as sister to Milanion (Milanion) laricus Grishin. 2023 (type locality in Ecuador: Napo) with nuclear genetic differentiation at the species level (COI barcodes have at least two haplotypes, one of which does not differ from M. laricus) (Fig. 7), and therefore they represent a new species. This new species keys (incompletely) to M. alaricus (E.46.6) in Evans (1953), but genitalia suggest that the new species and M. laricus are likely related to Milanion (Milanion) cramba Evans, 1953 (type locality in Peru: Junín, Río Colorado), which we have not sequenced, and differ from it by the tip of the harpe that is longer and narrower, nearly straight, and slightly bent inward instead of outward (per Evans (1953)); a darker (but not as dark as the submarginal area) costal margin of the ventral hindwing, which is the same whitish color as the rest of the wing in M. cramba. The new species differs from its sister, M. laricus, by a broader and darker area near the ventral hindwing costal margin; a broader ventral hindwing submarginal brown area with a more S-shaped margin; and a reduced dorsoventrally flattened area along the base of the harpe near the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1200.2.1:C237T, aly686.41.8:C491T, aly1020.5.4:G15A, aly2258.3.1:G141A, aly2284.25.15:C127T; and COI barcode: T301C, A541A, A577G, A592A, T646C, but barcodes may not discriminate all specimens due to genetic similarity and possible introgression.

Barcode sequence of the holotype.

Sample 11-BOA-13382C07, GenBank PV972471, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTCTTATATTGTTAATTTCAAGAAGCATTGTGGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCAGCCAATATTGCCCACCAAGGTTCATCAGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATCACCACTATTATTAACATACGAGTAAATAACTTATCATTTGATCAAATACCATTATTTGTATGAGCAGTAGGAATTACTGCACTACTTTTATTATTATCTTTACCTGTATTAGCGGGTGCTATTACTATGTTATTGACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGTGGAGATCCAATTTTATACCAACATCTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 252–253 (genitalia Fig. 953–954), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ GUYANA: Acarai Mts./ridge | Sipu R. 2500–3000’ | 31.X.-10.XI.2000 | 1°22.2’N 58°57.9’W | Leg. S.Fratello et al ], [ DNA sample ID: | 11-BOA-13382C07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032E08 | c/o Nick V. Grishin ], [ genitalia | NVG241118–56 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00179610 ], and one red [ HOLOTYPE ♂ | Milanion (Milanion) | guianensis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-15094B02 French Guiana, upriver from Saut Athanase, 800’, 13-Mar-1998, D. J. Lindsley leg. [MGCL] (Fig. 254–255).

Type locality.

Guyana: Acarai Mts., Sipu River, elevation 2500’–3000’, GPS 1.370, −58.950.

Etymology.

The name is derived from the distribution of this species in the Guianas and is an adjective.

Distribution.

The Guianas.

Subtribe Achlyodina Burmeister, 1878

Eantis (Minna) willa Grishin, new species

https://zoobank.org/B6EBC3E5-02B6-41A7-BBFC-04090F3469A5

(Fig. 8 part, 256–259, 955–956)

Figure 8.

Phylogenetic trees of Achlyodina inferred from protein-coding regions in a) the Z chromosome, based on 328,884 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of specimens identified as Eantis (Minna) minna (Evans, 1953) (type locality in Brazil: Bahia) reveals that they partition into two clades that are genetically differentiated at the species level (Fig. 8); e.g., their COI barcodes differ by 7.1% (47 bp). One clade corresponds to E. minna, while the other represents a new species. This new species keys to “Achlyodes minna” (F.2.3) in Evans (1953), but differs from it by a stout, thorn-like, and sharp process of the ampulla rather than extended, thumb-like, and rounded with serrated margins in E. minna; and by the harpe with a more prominent tooth directed dorsad, instead of a dorsal serrated ridge with a tooth directed anterodorsad, closer to the ampulla in E. minna. This species is not cryptic and is confidently diagnosed by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1475.3.2:G916T, aly443.6.3:C33T, aly1060.5.18:C102G, aly430.6.1:G111A, aly430.6.1:C126T; and COI barcode: T59C, T223C, T274C, A277C, A283T.

Barcode sequence of the holotype.

Sample NVG-15091E08, GenBank PV972472, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACCTCATTAAGTTTACTAATTCGTACTGAATTAGGTAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTAATATTAGGGGCCCCCGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGATTGCTTCCCCCCTCCTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACTGTCTATCCCCCCCTTTCCTCTAATATTGCCCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTATAAATCTTTCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTACTCCTACTATCTTTACCTGTATTAGCGGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 256–257 (genitalia Fig. 955–956), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ BRASIL: Rondônia | 62 km S Ariquemes | linea C-20, 7 km E | B-65, Fazenda | Rancho Grande | 17 June 1993 | leg. G. T. Austin ], [ Genetalic Vial | GTA-8891 ], [ DNA sample ID: | NVG-15091E08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Eantis (Minna) | willa Grishin ]. Paratypes: 2♂♂ in MGCL: 1♂ NVG-15091C12 Peru, Huánuco, Tingo Maria, 2000’, 1-Apr-1971, T. Taylor leg., genitalia SRS-2010 (Fig. 258–259) and 1♂ NVG-15091E09 Brazil, Rondônia, ca 70 km S of Ariquemes, B-80 between lineas C-10 and 15, 20-Nov-1992, T. Schmitz leg., genitalia GTA-3063.

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande.

Etymology.

Willa and Minna are shortened and affectionate forms of Wilhelmina, and the first is used as the name of the new species, sister to E. minna, but with a more western distribution. The name is a noun in apposition.

Distribution.

Currently known from central Peru and western Brazil.

Aethilla coracina Butler, 1870 is a species distinct from Aethilla echina Hewitson, 1870

Genomic analysis reveals that Aethilla echina echina Hewitson, 1870 (type locality in Ecuador) and Aethilla echina coracina Butler, 1870 (type locality in Brazil: São Paulo) are genetically differentiated from each other at the species level (Fig. 8); e.g., their COI barcodes differ by 2.3% (15 bp). Therefore, we propose that Aethilla coracina Butler, 1870, reinstated status, is a species distinct from Aethilla echina Hewitson, 1870. As a result, A. echina becomes monotypic.

Lectotype designation for Aethilla melas Plötz, 1882

Aethilla melas Plötz, 1882 was described from an unstated number of specimens from Brazil: Rio de Janeiro (Plötz 1882b). The original description, assembled from the identification key, can be translated from German as: “Margin of the hindwings not yellow. Forewings unmarked. Violet-black, only beneath with faint markings. Hind tibiae in the male frontally with a hairbrush.” Our inspection of the Hesperiidae collection in the MFNB reveals a syntype (NVG-21115B11) and a likely syntype (NVG-21115C01) of A. melas, both males. According to their labels, both are from Weymer’s collection, collected in Brazil (no other details about locality), and both have “Melas Plötz i.l.” on at least one of their labels, indicating that they were collected and labeled before the original description (“i. l.” is for in litteris); in addition, the syntype was identified as “Melas” by Plötz himself. Both specimens agree with the original description, and genomic analysis places them among specimens from Southeast or Southern Brazil. Thus, although “Rio” (the type locality of A. melas) is not indicated on their labels, it is likely that they were collected there. To define the taxonomic identity of the name A. melas objectively, N.V.G. hereby designates the syntype in the MFNB collection, the male illustrated in Fig. 260–261, bearing the following five rectangular white labels (1^st, 2^nd, and 4^th handwritten, others printed): [ Brasil ], [ Melas Plötz i.l. | No 5 best. v. Plötz. ], [ Coll. Weymer ], [ 28:8. ], and [ DNA sample ID: | NVG-21115B11 | c/o Nick V. Grishin ] as the lectotype of Aethilla melas Plötz, 1882. According to the 2^nd label, this specimen was identified by Plötz (“best[immt]. v[on]. Plötz”) as “Melas”, and this label with the name was added to the specimen prior to publication (“i[n].l[itteris]”). The 4^th label was likely added during subsequent curation of the collection, and 28:8 is the number for “Æ. melas” in the Mabille catalog used to arrange the Hesperiidae collection in Berlin (Mabille 1903). The lectotype is missing both antennae and a triangular piece of the left hindwing near the tornus, and its head is turned to the right. The COI barcode sequence of the lectotype, sample NVG-21115B11, GenBank PV972473, 658 base pairs is:

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACATCTTTAAGTATATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATATTATTAATTTCAAGAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCACCATTATCATCTAATATTGCCCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATCTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTATAAATCTTTCTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCATTACTTCTTTTATTATCACTACCAGTTTTAGCTGGAGCTATTACTATATTATT AACAGATCGAAATTTAAATACATCATTCTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATCTATTT

Lectotype designation for Aethilla primus Plötz, 1882

Aethilla primus Plötz, 1882 was described from an unstated number of specimens from Brazil (Plötz 1882b). The original description, assembled from the identification key, can be translated from German as: “Margin of the hindwings not yellow. Forewings unmarked. Body and wing bases are brown above. Brown, with darker markings, underside dusted with gray. Hindwings beneath with a white transverse streak at the end of the discal cell. Hind tibiae in the male frontally with a brush.” Our inspection of the Hesperiidae holdings in the MFNB revealed a syntype of A. primus. To define the taxonomic identity of the name A. primus objectively, and to narrow down the type locality, N.V.G. hereby designates this syntype in the MFNB collection, the male illustrated in Fig. 262–263, bearing the following four rectangular white labels (1^st and 2^nd handwritten, others printed): [ auf Plötz taf 214 | Primus Plötz i. l. | nicht Coracina. ], [ Primus Plötz il | | | Ipaunema ], [ Coll. Weymer ], and [ DNA sample ID: | NVG-21115C05 | c/o Nick V. Grishin ] as the lectotype of Aethilla primus Plötz, 1882. According to the 1^st label, this specimen was illustrated by Plötz on his unpublished (and considered lost) plate “taf[el]” 214, referenced in the original description as “217” (an error judging from the sequence of numbers, and the actual 217 is the second instance of this number, given for “Aethilla janira”) (Plötz 1882b) and as “214” in Godman (1907), confirming its identity as a syntype. The label also states that this specimen is not “A. coracina”.

The 2^nd label gives a detailed locality “Ipaunema” for Ipanema in São Paulo, Brazil. The original description only listed “Brazil” as the locality, and “Ipanema” was listed by Plötz (1882b) as a locality for the next species in the key, “Aethilla coracina”, which is indeed its type locality. Curiously, both the lectotype of A. primus and a syntype of Aethilla coracina Butler, 1870, reinstated status, from “Ipaunema” have a white dash at the end of the discal cell on the ventral hindwing. Thus, both specimens would key to A. primus in Plötz’s identification key, suggesting that Plötz either misidentified A. coracina, or simply went by its illustration in Butler (1872), which does not show the white streak. Moreover, Butler’s illustration depicts some hairlike scales on the back of the hindtibia, possibly explaining Plötz’s description of the differences between the position of the brush in A. primus, which he inspected, and A. coracina, which he might have misread from the illustration. All species of Aethilla Hewitson, 1868 (type species Aethilla eleusinia Hewitson, 1868) have the hindtibial brush at the same place: at the base and in front. Finally, it is unclear why the locality “Ipanema” of the specimen Plötz illustrated and described was left out from the original description, and it may be simply because he had several syntypes from different localities, all in Brazil, some not more detailed than “Brasil” only.

The lectotype is missing a small piece of the left forewing from the outer margin near the tornus, and has scales rubbed off a couple of major veins on the dorsal hindwings. As a result of the lectotype designation, the type locality of A. primus becomes Brazil: São Paulo, Ipanema. Currently, A. primus is regarded as a junior subjective synonym of Aethilla coracina Butler, 1870, reinstated status, and our genomic analysis confirms this treatment (Fig. 8). The COI barcode sequence of the lectotype, sample NVG-21115C05, GenBank PV972474, 658 base pairs is:

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACATCTTTAAGTATATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCACCATTATCATCTAATATTGCCCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATCTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTATAAATCTTTCTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCATTACTTCTTTTATTATCACTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTCTTTGACCCTGCAGGGGGGGGAGATCCAATTTTATATCAACATCTATTT

Aethilla melas Plötz, 1882 is a new junior subjective synonym of Aethilla coracina A. Butler, 1870

Genomic sequencing of the lectotype of Aethilla melas Plötz, 1882 (type locality in Brazil: Rio de Janeiro, sequenced as NVG-21115B11) reveals that it is not the species that Evans (1953) identified as “A. melas” and instead is placed within specimens of Aethilla coracina Butler, 1870, reinstated status, (type locality in Brazil: São Paulo) (Fig. 8). Therefore, we propose that Aethilla melas Plötz, 1882 is a new junior subjective synonym of Aethilla coracina A. Butler, 1870, reinstated status.

Eantis (Thilla) maurus Grishin, new species

https://zoobank.org/9AD110A1-E885-47A9-9FE5-C296C1FB02F0

(Fig. 8 part, 264–265, 957–958)

Definition and diagnosis.

This is the species that Evans (1953) misidentified as Aethilla melas Plötz, 1882 (type locality in Brazil: Rio de Janeiro) and is new because no available name applies to it. It is sister to Eantis (Thilla) haber (Mabille, 1891) (type locality given as possibly in Peru, but likely in Southeast Brazil) and is genetically differentiated from it at the species level (Fig. 8); e.g., their COI barcodes differ by 4.9% (32 bp). This new species keys to “Aethilla melas” (F.1.7) in Evans (1953), which he misidentified, and is diagnosed by dark wings without obvious bands (only a very faint one, more noticeable on the ventral side) with strong purple gloss beneath; the ampulla has a robust process only slightly shorter than the harpe; and the harpe has a smaller process at its base by the ampulla. This species is not cryptic and is reliably diagnosed by phenotype. In DNA a combination of the following base pairs is diagnostic in the nuclear genome: aly378.14.2:G237T, aly378.14.2:A289C, aly83.18.9:G51A, aly83.18.9:G90C, aly1838.59.7:C141T, aly798.33.75:C76C (not T), aly2178.10.6:G81G (not T), aly1478.9.10:A246A (not G), aly1478.9.10:C258C (not T), aly1675.5.1:C180C (not T); and COI barcode: A40G, T103C, T124C, A298T, T412G.

Barcode sequence of the holotype.

Sample NVG-15032B03, GenBank PV972475, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTTTAAGTTTATTAATCCGAACAGAATTAGGAAATCCCGGATCTTTAATTGGAGACGATCAAATTTATAATACTATCGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCTGATATAGCCTTCCCCCGAATAAATAACATAAGATTTTGACTATTACCTCCCTCATTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACCGTTTACCCTCCCCTCTCAGCTAATATTGCCCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCCCTACATTTAGCGGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTATAAACCTTTCATTTGATCAAATACCTCTATTTGTTTGAGCTGTTGGTATTACAGCTTTACTCTTATTACTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAACACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 264–265 (genitalia Fig. 957–958), bears the following ten labels (1^st round, others rectangular; first five handwritten, others printed), nine white: ( Pará ), [ Para | 86 Donc ], [ Obscurus Hübn ? | Samlg. II 150,1–2. ], [ cf. 27:∞ ?! ], [ 32:1 A?! ], [ Coll. Weymer ], [ DNA sample ID: | NVG-15032B03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23078F05 | c/o Nick V. Grishin ], [ genitalia | NVG240912–07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Eantis (Thilla) | maurus Grishin ]. According to its label, the holotype was collected in 1886 by Donckier. In the Mabille catalog (Mabille 1903), the number 27 (on the 4^th label) corresponds to the genus Murgaria Watson, 1893, and the number 32:1 (on the 5^th label) corresponds to Ephyriades otreus (Cramer, 1782 [recte Stoll, 1780]), currently a junior subjective synonym of Ephyriades arcas philemon (Fabricius, 1775). The question marks on the two labels with the Mabille numbers stand for a word or abbreviation, likely the same on both labels, that we were not able to decipher, might be related to fraglich (i.e., German for doubtful, questionable). The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂ from Brazil, Pará [BMNH].

Type locality.

Brazil: Pará.

Etymology.

In Greek, “μαύρος” (mauros) means black or dark. The name suits this dark nearly nonpatterned species that Evans referred to as “A. melas” and is treated as a noun in apposition.

Distribution.

Currently known only from the lower Amazonian region.

Aethilla mexina Grishin, new species

https://zoobank.org/46FC1D3E-F65B-422E-A151-C24B23BCD979

(Fig. 8 part, 266–267, 959–965)

Definition and diagnosis.

Genomic analysis of Aethilla echina Hewitson, 1870 (type locality in Ecuador) reveals that specimens from Mexico formed a clade sister to both A. echina and Aethilla coracina Butler, 1870, reinstated status, (type locality in Brazil: São Paulo) and are genetically differentiated from them at the species level (Fig. 8); e.g., their COI barcodes differ by 4.3%–4.4% (28–29 bp), and therefore they represent a new species. This new species keys to “Aethilla echina echina” (F.1.4(a)) in Evans (1953) and was included by him in that taxon, but differs from it and other relatives by males with more extensive white overscaling in the submarginal area of the ventral hindwing, a smaller process from the ampulla, and a longer, rounder harpe with smoother margins, serrated on the dorsal expansion but without larger teeth. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly636.3.5:G1260A, aly21.6.6:A66G, aly1931.7.6:T66C, aly1931.7.6:C67T, aly991.2.3:C174T; and COI barcode: T16C, T106C, A127C, T212C, A376C, T574A.

Barcode sequence of the holotype.

Sample NVG-19075H09, GenBank PV972476, 658 base pairs:

AACATTATATTTTATCTTTGGAATTTGAGCAGGTATAGTTGGAACATCTTTAAGTATATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTCACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTAATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGGACAGGATGAACTGTATACCCACCATTATCATCTAATATTGCCCATCAAGGATCCTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATCTCATCAATTCTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTATAAATCTTTCTTTTGACCAAATACCTTTATTTGTGTGAGCAGTAGGAATTACTGCCTTACTTCTTTTATTATCATTACCAGTTTTAGCTGGAGCTATTACAATATTACTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTC

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 266–267, bears the following eight printed rectangular labels (4^th handwritten, others printed with text in italics handwritten), seven white: [ Mozorongo | Mex ], [ Jan. | ‘09 ], [ RMuller | Collector ], [ 1942 ], [ genitalia NO. | X-1817 | J.M.Burns 1983 ], [ DNA sample ID: | NVG-19075H09 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588626 ], and one red [ HOLOTYPE ♂ | Aethilla mexina | Grishin ]. Paratypes: 4♂♂ from Mexico: 1♂ NVG-19045B01, AMNH_IZC 00338049 Veracruz, Catemaco, Jan1953, T. Escalante leg. [AMNH] and Chiapas: 1♂ NVG-19045B02, AMNH_IZC 00338050 Muste, 7-Oct-1968, E. C. Welling leg. [AMNH]; 1♂ NVG-23053H09, MGCL/FLMNH Specimen no. 24591, Santa Rosa Comitán, Jul1968, T. Escalante leg., genitalia SRS-4080 (Fig. 959–965) [MGCL]; and 1♂ NVG-14112G05 Ejido Las Delicias, 6-Aug-1975 [TLS, now in MGCL].

Type locality.

Mexico: Veracruz, Motzorongo.

Etymology.

The name derived from the Mexican distribution of this species and to sound similar to its relative A. echina, and is treated as a noun in apposition.

Distribution.

Currently known only from Southern Mexico.

Achlyodes centralis Grishin, new species

https://zoobank.org/7BFB7C75-CC4E-4BAC-B313-59D7F8C4D447

(Fig. 8 part, 268–269, 966–968)

Definition and diagnosis.

Genomic analysis reveals that specimens identified as Achlyodes busirus heros Ehrmann, 1909 (type locality in Venezuela) partition into two clades genetically differentiated at the species level (Fig. 8); e.g., their COI barcodes differ by 2.4% (16 bp). One clade, together with the holotype of A. busirus heros (NVG15095C04), contains specimens of other Achlyodes busirus (Cramer, 1779) (type locality in Suriname) subspecies. The other clade does not have a name and represents a new species. This new species keys to Achlyodes busirus heros (F.2.1(a)) in Evans (1953), and was included by him in this species, but differs from it and other relatives by the extensive yellow tornal area on the ventral hindwing, typically without a strongly developed brown spot near the tornus in females; and a rounder and less elongated harpe without a sharp tooth at the dorsal margin, where it is only serrated. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly127.64.1:C625A, aly1651.16.2:G312A, aly1651.16.2:A537G, aly1405.22.7:C147A, aly330.21.3:C90T; and COI barcode: A91T, C250C, T367T, T460C, T499T, A541G.

Barcode sequence of the holotype.

Sample NVG-19076A05, GenBank PV972477, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAATTGGAACTTCACTAAGTATATTAATTCGAACTGAACTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAACATAAGATTTTGATTATTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTCTTTCATCTAATATTGCTCATCAAGGATCATCTGTAGATTTAGCTATTTTTTCCCTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATCATAAATCTTTCTTTTGATCAAATACCTCTTTTTGTATGAGCTGTAGGAATTACAGCTTTACTTTTATTGCTTTCTTTACCAGTACTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 268–269, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PANAMA:DARIEN | Cana (Cerro Pirre) | 600 m | 7°56’N 77°34’W | 26 VI 1981 | leg. G.B.Small | ON FECES ], [ DNA sample ID: | NVG-19076A05 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588634 ], and one red [ HOLOTYPE ♂ | Achlyodes | centralis Grishin ]. Paratypes: 6♂♂ and 1♀: Mexico [TMMC]: 1♂ NVG-23068C02 San Luis Potosí, 17 km SSE of Naranjo, 1000’, 16-Jan-1969; 2♂♂ from Veracruz: NVG-19125D06 (leg, DNA sequenced), NVG-24016C02 (abdomen, DNA stored) Los Tuxtlas, San Andrés Tuxtla, 21-Jul-1978, L. E. Gilbert leg., genitalia NVG241220–09 (Fig. 966–968) and NVG-23068C03 Rd. to Uxpanapa, Poblado Agustín Melgar, 10-May-1990, J. Kemner leg.; and 1♀ NVG-23068C04 Oaxaca, 2 mi N of Candelaria Loxicha, ~300 m, 22, 23, 25-Oct-1988, J. Kemner leg.; 1♂ NVG-19076A04, USNMENT 01588633 Honduras, 18 km W La Ceiba, 30-Jul-1978, Robert D. Lehman, leg. [USNM]; 1♂ NVG-19076A06, USNMENT 01588635 Colombia, Caldas, Victoria, 1-Jan-1969, E. Schmit-Mumm leg. [USNM]; and 1♂ NVG-19076A07, USNMENT 01588636 Ecuador, Esmeraldas, Río Chuchuví, 12.5 km Lita-San Lorenzo Rd, 800–900 m, GPS 0.8835, −78.5150, Jun-2003, I. and R. Aldas leg. [USNM].

Type locality.

Panama: Darién Province, Cana, Cerro Pirre, elevation 600 m, approx. GPS 7.9333, −77.5667.

Etymology.

The name is given for mostly Central American distribution of this species and is an adjective.

Distribution.

Mexico to Ecuador.

Achlyodes cacaus Grishin, new species

https://zoobank.org/AFB8A450-9681-4D2E-B401-E6D9414AF261

(Fig. 8 part, 270–271, 969–971)

Definition and diagnosis.

Genomic analysis of Achlyodes Hübner, [1819] (type species Papilio busirus Cramer, 1779) specimens from Rondônia, Brazil, reveals that they partition into two clades, consistently with their phenotypes (Fig. 8). Specimens of the first clade have a paler brownish tornal area of the ventral hindwing and are in the same clade as Achlyodes busirus busirus (Cramer, 1779) (type locality in Suriname). Specimens of the second clade have a darker ventral hindwing and look more similar to Achlyodes busirus negro (Kaye, 1921) (type locality in Trinidad), but are not monophyletic with this taxon (Fig. 8). Due to genetic differentiation that correlates with phenotype and sympatry, these specimens belong to two distinct species. The darker specimens forming their own clade represent a new species. This new species keys to Achlyodes busirus negro (F.2.1(c)) in Evans (1953), but differs from it and other relatives by a dark ventral side without the yellow or pale-brown tornal area, while the dorsal side has paler brown bands and areas; the harpe is even more rounded than in the previous new species, shorter and broader than in A. busirus negro, more strongly upturned and without a sharp dorsal tooth, but with smaller serrations. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6286.10.6:G237A, aly173.61.1:A1752G, aly6841.75.4:G154A, aly1249.6.3:A1101G, aly2165.21.3:A1392T; and COI barcode: C401T, A412G, T499C, C557T, T589C.

Barcode sequence of the holotype.

Sample NVG-19076B02, GenBank PV972478, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCATTAAGTATATTAATTCGAACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAACATAAGATTTTGATTATTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCTCCTCTTTCATCTAATATTGCTCATCAAGGATCATCTGTAGATTTAGCTATTTTTTCCTTACATTTAGCGGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTATAAATCTCTCTTTTGATCAAATACCCCTTTTTGTATGAGCTGTAGGAATTACAGCTTTACTTTTATTACTTTCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGACCGAAATTTAAATACATCATTTTTTGATCCCGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 270–271 (genitalia Fig. 969–971), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRAZIL: Rondônia | 8 km N of Cacaulândia | 10° 30’S, 62° 52’W | 11 Nov 1989 190m | leg DH Ahrenholz | SS Nicolay curator ], [ DNA sample ID: | NVG-19076B02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H04 | c/o Nick V. Grishin ], [ genitalia | NVG241118–57 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588643 ], and one red [ HOLOTYPE ♂ | Achlyodes | cacaus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-15091D02 Brazil, Rondônia, 62 km S Ariquemes, linea C-20, 7 km E B-65, Fazenda Rancho Grande, 14-Nov-1991, G. T. Austin leg. [MGCL].

Type locality.

Brazil: Rondônia, 8 km north of Cacaulândia, elevation 190 m, approx. GPS −10.500, −62.867.

Etymology.

The name is derived from the type locality near cacau[landia]+ s and it reflects darker, cocoa-colored (rather than yellow) posterior part of ventral hindwing. The name is treated as a noun in apposition.

Distribution.

Currently known only from Rondônia in Brazil.

Comment.

GPS coordinates given on the label point to a locality approximately 17.5 km south of Cacaulândia, thus being inconsistent with the locality stated in words.

Spioniades abbreviatissima Grishin, new species

https://zoobank.org/64691259-6C3D-4DC2-85A0-143FC7CD06F4

(Fig. 8 part, 272–273, 972–974)

Definition and diagnosis.

Genomic analysis of specimens identified as Spioniades abbreviata (Mabille, 1888) (type locality in Panama: Chiriqui, holotype sequenced as NVG-15033E09) reveals that they partition into two clades genetically differentiated at the species level (Fig. 8); e.g., their COI barcodes differ by 4.9% (32 bp). The first clade contains the holotype of S. abbreviata, and the second clade corresponds to a new species. This new species keys to “Spioniades abbreviata abbreviata” (E.14.1(a)) in Evans (1953) and was included by him in that taxon, but differs from it and other relatives by the following combination of characters: the forewing is less angled at the outer margin, the hindwing margin is nearly straight and more rounded towards the tornus, the hindwing is more elongated, the white tornal area on the ventral hindwing lacks brown marginal triangles, and the brown tornal spot on the dorsal hindwing is typically larger. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly393.2.2:G112T, aly1038.8.1:G1377A, aly1038.8.1:A1401G, aly1838.35.4:A162G, aly1282.12.2:C152T; and COI barcode: T139C, T151C, T337C, T394C, T550C, A625G.

Barcode sequence of the holotype.

Sample NVG-19088A12, GenBank PV972479, 658 base pairs:

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCCTTAAGTTTAATCATCCGAACAGAATTAGGAAATCCTGGAACTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCCTTTATTATAATCTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCTTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATATTATTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTCTACCCCCCTCTTTCTGCAAATATTGCTCACCAAGGATCTTCTGTAGATTTAGCTATCTTTTCCCTTCATCTTGCCGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTTCAACAATTATTAATATACGAATTAGAAATCTTTCCTTTGATCAAATACCTTTATTCATTTGAGCTGTTGGAATTACAGCTTTACTTTTATTATTATCCCTCCCAGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCCGCTGGGGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 272–273 (genitalia Fig. 972–974), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ COLOMBIA–Meta | Rio Negro–800m | 7–15 Jan 1971 | leg..S.S. Nicolay ], [ DNA sample ID: | NVG-19088A12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H05 | c/o Nick V. Grishin ], [ genitalia | NVG241118–58 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588913 ], and one red [ HOLOTYPE ♂ | Spioniades | abbreviatissima Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂: Ecuador: 1♂ NVG-18092C04 Morona-Santiago, San Isidro, Macas, 1250 m, GPS −2.12, −78.10, 30-Nov-2011, J.-C. Petit leg. [EBC] and 1♂ NVG-20087A02 Napo, Llaucana, 483 m, GPS −1.0947, −77.7768, 12-Apr-2017, K. Maruyama leg. [KMC] and 1♂ NVG-23076G05 Bolivia, Locotal, O. Garlepp leg. [MFNB].

Type locality.

Colombia: Meta Department, Río Negro, elevation 800 m.

Etymology.

The name is formed from the name of its sister species but made longer for its more southern relative. The name is treated as a noun in apposition.

Distribution.

Currently known from Colombia, Ecuador, and Bolivia.

Spioniades ana Grishin, new species

https://zoobank.org/1C217552-5946-46CC-841C-EB0C09CB347E

(Fig. 8 part, 274–275, 975–977)

Definition and diagnosis.

Genomic analysis of a specimen from Ecuador reveals that it is sister to Spioniades anta Evans, 1953 (type locality in Bolivia) but is genetically differentiated from it at the species level (Fig. 8); e.g., their COI barcodes differ by 1.5% (10 bp), and therefore this specimen represents a new species. This new species keys to “Spioniades abbreviata anta” (E.14.1(b)) in Evans (1953) and was included by him in that taxon, but differs from it and other relatives by the following combination of characters: the forewing is more angled at the outer margin, the hindwing margin is slightly angled at the vein M₃, the hindwing is less elongated, and the white tornal area on the ventral hindwing lacks brown marginal triangles and does not penetrate into the dark anterior area as white overscaling, forming weak bands and spots. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4893.5.2:G198A, aly4893.5.2:G250A, aly264.4.27:A57G, aly2874.11.7:T147A, aly728.6.2:A237T, aly2116.8.1:C39C (not T), aly5294.26.1:C87C (not T), aly84.84.6:C267C (not T), aly481.18.1:A474A (not T), aly3011.7.4:T1086T (not C); and COI barcode: G38A, T82C, G101A, T118C, T508C, T557T.

Barcode sequence of the holotype.

Sample NVG-19088B01, GenBank PV972480, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATAGGAACTTCTTTAAGTTTAATTATCCGAACAGAATTAGGAAACCCTGGAACTTTAATCAGAAATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATACTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATATTATTAATCTCTAGTAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCTGCAAATATTGCCCACCAAGGATCTTCTGTAGATATAGCTATTTTTTCTCTTCATCTTGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATCTCAACAATTATTAATATACGAATTAGAAATCTTTCTTTTGATCAAATACCTTTATTTATCTGAGCTGTTGGAATTACAGCTTTACTTTTATTATTATCTCTTCCAGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 274–275 (genitalia Fig. 975–977), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR Tungurahua | Rio San Francisco | 1600m | 25 Oct ‘89 | S. S. Nicolay ], [ DNA sample ID: | NVG-19088B01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H06 | c/o Nick V. Grishin ], [ genitalia | NVG241118–59 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588914 ], and one red [ HOLOTYPE ♂ | Spioniades | ana Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Tungurahua Province, Río San Francisco, elevation 1600 m.

Etymology.

The name is formed from the name of its sister species S. anta made shorter for a more northern species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of Ecuador.

Mimia engana Grishin, new species

https://zoobank.org/72EF2FD6-E79D-43B4-B230-F1523454F657

(Fig. 8 part, 276–277, 978–980)

Definition and diagnosis.

Genomic analysis of Mimia Evans, 1953 (type species Cyclosaemia phidyle Godman and Salvin, 1894) reveals that a specimen from Ecuador represents a species-level taxon sister to both Mimia chiapaensis H. Freeman, 1969 (type locality in Mexico: Chiapas) and Mimia phidyle (Godman and Salvin, 1894) (type locality in Panama) (Fig. 8). Its COI barcode differs from them by 2.4% (16 bp). The new species keys to “Mimia phidyle phidyle” (E.8(a)) in Evans (1953), but differs from it and other relatives by a slightly paler brown (not yellow) coloration of the distal half of the ventral hindwing, the three apical hyaline spots being not in a straight line and the lower spot being moderately (not as strongly as in M. chiapaensis) offset distad and slightly larger than the other two, and a narrower dark postdiscal band on the forewing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly767.7.3:C114T, aly2487.47.1:A27C, aly666.19.2:C123T, aly2165.8.16:T25C, aly1838.58.9:C130T, aly3277.18.2:C37C (not T), aly276882.14.1:T183T (not G), aly276882.14.1:C201C (not T), aly536.163.5:T64T (not C), aly46405.15.2:G171G (not C); and COI barcode: A28G, T91C, T187C, A280G, A532T.

Barcode sequence of the holotype.

Sample NVG-15026D10, GenBank PV972481, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCCTTAATTGGAAATGATCAAATTTATAATACTATCGTCACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCACTAATATTAGGAACCCCTGATATAGCATTCCCACGTATAAATAATATAAGATTTTGACTTCTTCCTCCTTCTTTGATATTATTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCTAGTAATATTGCCCACCAAGGATCATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATCTTTCATTTGATCAAATACCCTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTATTACTCTTATCTTTACCAGTACTTGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 276–277 (genitalia Fig. 978–980), bears the following six labels (1^st handprinted, others printed with handwritten text in italics; 4^th triangular, others rectangular), five white: [ ECUADOR: ORIENTE | Rio Engaño 1300 m. | 12-iii-1968 | R. de Lafebre ], [ A. C. ALLYN| ACC. NO. 1968-8 ], [ Genit. Vial | SRS-2754 ], [ > no text, a leg is glued to this label, [ DNA sample ID: | NVG-15026D10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Mimia engana | Grishin ].

Type locality.

Ecuador: El Oriente Region, Río Engaño, elevation 1300 m.

Etymology.

The name is derived from the type locality, Río Engaño, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Ecuador.

Xispia superquadrata Grishin, new species

https://zoobank.org/711C5C6A-1423-44D1-BD85-2A79B971AF66

(Fig. 8 part, 278–279, 981–982)

Definition and diagnosis.

Identified as Xispia quadrata (Mabille, 1889) (type locality Brazil: Amazonas, Massauary), a specimen from Rondônia, Brazil, is not its sister and is most strongly differentiated from it genetically (Fig. 8); e.g., their COI barcodes differ by 8.8% (58 bp), and therefore this specimen represents a new species. This new species keys to Xispia quadrata (E.25.1) in Evans (1953), but differs from it by males with a better-defined lobe in the middle of the hindwing outer margin (only a kink in X. quadrata); only the lower black basal spot on the forewing is present; a reduced to nearly absent and bar-shaped (not triangular) black spot in the forewing cell CuA₂-1A+2A, with its basal margin strongly offset distad from the basal margin of the spot in the cell CuA_1-CuA₂ (the two margins are aligned in X. quadrata); and a defined paler-brown bar at the forewing discocellular vein bordering the black spot in the discal cell. This species is not cryptic compared to X. quadrata, but due to the possibility of cryptic species similar to it, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2096.2.15:A73C, aly925.27.5:T2895C, aly876.13.7:C105A, aly1260.9.2:T1293C, aly383.15.3:A2319G; and COI barcode: A31G, T127T, T172C, T247C, A550G, T568C.

Barcode sequence of the holotype.

Sample NVG-24083E02, GenBank PV972482, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCGGGAATAGTGGGAACTTCCCTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATCGGAGGATTTGGAAATTGATTGGTTCCTCTAATATTAGGAGCCCCCGATATAGCTTTCCCCCGAATAAACAATATAAGTTTTTGATTATTACCCCCATCTTTAATATTATTAATCTCAAGAAGTATTGTAGAAAATGGAGCAGGTACTGGATGAACTGTTTACCCCCCTCTTTCTGCTAATATTGCCCACCAAGGATCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAATAATCTTTCTTTTGATCAAATACCTTTATTCGTTTGAGCTGTAGGTATTACAGCTTTATTATTATTATTATCATTGCCAGTATTAGCTGGAGCCATTACTATACTTTTAACAGACCGAAATCTTAATACATCCTTTTTTGACCCTGCAGGAGGGGGGGACCCTATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 278–279 (genitalia Fig. 981–982), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ BRASIL: Rondônia | 62 km S Ariquemes | linha C-20, 7 km E | B-65, Fazenda | Rancho Grande | 17 July 1996 | leg. G. T. Austin | (at paper lures, | 1130–1200) ] [ genitalia Vial | GTA-7545 ], [ G T Austin colln | MGCL Acc. | 2004–5 ], [ DNA sample ID: | NVG-24083E02 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Xispia superquadrata | Grishin ].

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande.

Etymology.

The name is formed from the name of its relative X. quadrata to indicate more quadrate hindwing of this species and its more southern distribution by making the name longer. The name is a feminine adjective.

Distribution.

Currently known only from the holotype collected in western Brazil.

Xispia equadra Grishin, new species

https://zoobank.org/7DD0A9C8-E257-4030-989D-DE8F8E44D196

(Fig. 8 part, 280–281, 983–986)

Definition and diagnosis.

Identified as Xispia quadrata (Mabille, 1889) (type locality Brazil: Amazonas, Massauary), a specimen from Ecuador is not its sister and is most strongly genetically differentiated from it (Fig. 8); e.g., their COI barcodes differ by 8.8% (58 bp), and is more similar to Xispia superquadrata, new species (type locality in Brazil: Rondônia) differing from it by 1.4% (9 bp) in the COI barcode. Although the COI barcode difference is not large, the Ecuadorian specimen differs in genitalia from Xispia superquadrata, new species and therefore represents a new species. This new species keys to Xispia quadrata (E.25.1) in Evans (1953), but differs from it by males with a better-defined lobe in the middle of the hindwing outer margin (only a kink in X. quadrata); only the lower black basal spot on the forewing is present; a reduced to nearly absent and bar-shaped (not triangular) black spot in the forewing cell CuA₂-1A+2A, with its basal margin strongly offset distad from the basal margin of the spot in the cell CuA₁-CuA₂ (the two margins are aligned in X. quadrata); and a defined paler-brown bar at the forewing discocellular vein bordering the black spot in the discal cell. Differs from Xispia superquadrata, new species by males with more pronounced tornal lobe on the hindwing that has more contrasting pattern of darker marginal and submarginal bands and discal cell spot; a lobe in the middle of the forewing outer margin; a smaller process of the ampulla; and a terminally broader, expanded both dorsally and ventrally, harpe. Due to unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly6377.1.1:G411A, aly6377.1.1:A992G, aly876.13.7:C105A, aly1260.9.2:T1293C, aly230.4.9:C42T; and COI barcode: T127C, T212C, T481G, A550A, T568C.

Barcode sequence of the holotype.

Sample NVG-24045E04, GenBank PV972483, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCCCTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTGGTTCCTCTAATACTAGGAGCCCCCGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCATCTTTAATATTATTAATCTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCTCTTTCTGCTAATATTGCCCACCAAGGATCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAATAATCTGTCTTTTGATCAAATACCTTTATTCGTTTGAGCTGTAGGTATTACAGCTTTATTATTATTATTATCATTACCAGTATTAGCTGGAGCCATTACTATACTTTTAACAGACCGAAATCTTAATACATCCTTTTTTGACCCTGCAGGAGGGGGGGACCCTATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Nature Education Centre of the Jagiellonian University, Kraków, Poland (CEPUJ), illustrated in Fig. 280–281 (genitalia Fig. 983–986), bears the following six printed rectangular labels (2^nd blue, 3^rd green, 6^th red, others white: [ ECUADOR | Pimpilala | 5-IX-1997 | leg.As.Jasiński ], [ ex coll. | A. Jasiński | 01/2008 ], [ CEP-DNA | 7338 | tissue | sample ], [ DNA sample ID: | NVG-24045E04 | c/o Nick V. Grishin ], [ genitalia | NVG241114–32 | c/o Nick V. Grishin ], and [ HOLOTYPE ♂ | Xispia equadra | Grishin ]. Paratype: 1♂ NVG-23116B01 Ecuador, Napo, Jct. Río Napo and Misahualli, 366 m, −1.034, −77.664, 6–18-Sep-1998, Ron Leuschner leg., genitalia X-6613 J. M. Burns [USNM].

Type locality.

Ecuador: Napo, Pimpilala.

Etymology.

The name is formed from the name of its relative X. quadrata to indicate Ecuadorian origin and made shorter for this more northern species. The name is treated as a feminine noun in apposition.

Distribution.

Currently known only from the eastern Andes of central Ecuador.

Myrinia distincta Grishin, new species

https://zoobank.org/7F4528D1-A8C0-40AE-9D6B-8A2837FF2544

(Fig. 8 part, 282–283, 987–989)

Definition and diagnosis.

Genomic analysis of Myrinia Evans, 1953 (type species Cyclosemia myris Mabille, 1898) reveals that specimens from Ecuador and northern Peru form a clade sister to several other species of the genus including Myrinia binoculus (Möschler, 1876) (type locality in Surinam), from which it differs by 1.8% (12 bp) in the COI barcode, and therefore these specimens represent a new species (Fig. 8). This new species keys to M. binoculus (E.24.1) in Evans (1953), but differs from it and other relatives by the following combination of characters: the presence of a discal eyespot on the ventral forewing, wider and darker submarginal bands above, a less distinct tornal spot on the ventral hindwing, the discal spot on the hindwing in cell Sc+R₁-Rs aligned with the spot in the discal cell, and a unique shape of the right harpe, which is shorter, with a rounded distal margin, and expanded dorsad into a rounded process reaching farther than the triangular process of the ampulla. This species is not cryptic but due to poorly explored individual variation and possible existence of cryptic species similar to it, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4472.4.2:A58T, aly2165.8.22:T67C, aly6034.2.2:T406C, aly1222.14.26:A1551G, aly1656.25.1:G373C; and COI barcode: T59C, T154C, T376A, T481C, A517T.

Barcode sequence of the holotype.

Sample NVG-17105G01, GenBank PV972484, 658 base pairs:

TACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCTTAAGTTTACTAATTCGTACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTGTTCCATTAATATTAGGTGCTCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCATCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGCCCATCAAGGATCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAATAATCTCTCATTTGATCAAATACCTTTATTTGTATGAGCAGTTGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGAGCAATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGTGGAGGAGATCCCATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 282–283 (genitalia Fig. 987–989), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU: Amazonas | Quebrada Chingaza | 05° 21.7’S, 78° 27.1’W | 22 September 1999, 500m | Ahrenholz, Robbins, Lamas ], [ DNA sample ID: | NVG-17105G01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H09 | c/o Nick V. Grishin ], [ genitalia | NVG241118–60 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894927 ], and one red [ HOLOTYPE ♂ | Myrinia distincta | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ from Ecuador, Sucumbíos, Lumbaqui, 300 m, M. Simon leg. [MGCL]: 1♂ NVG-23055F01, LEP-79258, Aug-2010 and 1♂ NVG-23055F02 (leg, DNA sequenced), NVG-24066A12 (abdomen, DNA stored), Aug-2009, genitalia NVG241111–26.

Type locality.

Peru: Amazonas Region, Quebrada Chinganza, elevation 500 m, GPS −5.36167, −78.45167.

Etymology.

The name refers to the strong genetic distinction of this species from its relatives in the nuclear genome and is an adjective.

Distribution.

Currently known from in the Andes in Ecuador and northern Peru.

Morvina pelarge (Godman and Salvin, 1894) is a species distinct from Morvina fissimacula (Mabille, 1878) with Morvina fissimacula lenia Evans, 1953 as its subspecies

Genomic analysis of the Morvina fissimacula (Mabille, 1878) (type locality in Brazil) subspecies reveals that Morvina fissimacula pelarge (Godman and Salvin, 1894) (type locality in Nicaragua) is genetically differentiated from Morvina fissimacula rema Evans, 1953 (type locality Brazil: Pará) and M. fissimacula fissimacula at the species level (Fig. 8); e.g., their COI barcodes differ by 4.6%–5% (30–33 bp). Therefore, we propose that Morvina pelarge (Godman and Salvin, 1894), reinstated status, is a species distinct from Morvina fissimacula (Mabille, 1878). Moreover, while we have not sequenced Morvina fissimacula lenia Evans, 1953 (type locality in Colombia), this subspecies is more similar to M. pelarge than to M. fissimacula in having bluish-white rather than yellow-brown distal part of the ventral hindwing. Therefore, we tentatively place M. fissimacula lenia as a subspecies of M. pelarge rather than M. fissimacula: Morvina pelarge lenia Evans, 1953, new species-subspecies combination.

Morvina jana Grishin, new species

https://zoobank.org/6824BF87-7DE4-4556-8551-596B49CD6413

(Fig. 8 part, 284–287, 990–994)

Definition and diagnosis.

Specimens from Rio de Janeiro, Brazil, form a clade originating in the deep radiation of Morvina Evans, 1953 (type species Tagiades morvus Plötz, 1884) and are not closely related to any known species (Fig. 8). Therefore, they represent a new species. This new species keys to Morvina fissimacula fissimacula (Mabille, 1878) (type locality in Brazil) (E.23.2(d)) in Evans (1953), but differs from it and other relatives by the following combination of characters: the forewing discal cell spot is separated into two black spots, some may be singlepupilled with white, the ventral side is pale-brown, with duller and yellowish-brown paler areas, no tornal dark spot on the ventral hindwing; in male genitalia, it is more similar to Morvina morvus (Plötz, 1884) (type locality in Brazil) in having a broader and straighter harpe, but the process of the ampulla is long, not shorter than the harpe. This species is not cryptic and is confidently diagnosed by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly208.17.28:C123T, aly1146.52.1:T147C, aly1146.52.1:G168A, aly281.19.1:A858G, aly281.19.1:A1066C; and COI barcode: T74C, T232A, A328C, A403G, A526T.

Barcode sequence of the holotype.

Sample NVG-21049H05, GenBank PV972485, 658 base pairs:

AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGAACTGAACTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAATTTTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACTGGCTGAACTGTATATCCCCCTTTATCAGCTAATATTGCACACCAAGGAGCCTCAGTAGATTTAGCAATTTTTTCATTGCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTATTTGGGCTGTTGGAATCACTGCTTTACTTTTATTATTATCTCTTCCTGTTTTAGCTGGAGCTATTACAATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 284–285 (genitalia Fig. 990–994), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ BRASIL: R. de JANEIRO | Teresopolis 1500m | 9.ii.1974 | C. Callaghan ], [ A. C. Allyn | Acc. 1974–5 ], [ Genit. Vial | SRS-3561 ], [ DNA sample ID: | NVG-21049H05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Morvina jana | Grishin ]. Paratypes: 2♀♀ NVG-23093F07 (Fig. 286–287) and NVG-23093F08 from Brazil, Rio de Janeiro, vic. Rio de Janeiro, 20-Nov-1925, R. Spitz leg. [ZfBS]

Type locality.

Brazil: Rio de Janeiro, Teresópolis, elevation 1500 m.

Etymology.

The name is derived from the type locality in Rio de Janeiro and is treated as a noun in apposition.

Distribution.

Currently known only from Southeast Brazil.

Morvina caura Grishin, new species

https://zoobank.org/7997E068-66F2-4B64-9C14-738223FA7299

(Fig. 8 part, 288–289, 995–997)

Definition and diagnosis.

A specimen from Venezuela is placed in the deep radiation of Morvina Evans, 1953 (type species Tagiades morvus Plötz, 1884) and is not closely related to any known species (Fig. 8), and therefore it represents a new species. This new species keys to Morvina fissimacula rema Evans, 1953 (type locality Brazil: Pará) (E.23.2(c)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a single prominent black spot in the forewing discal cell, pupilled with white in the upper part; the forewing only has three hyaline subapical spots and no postdiscal spots; the ventral side is pale-brown, with paler yellowish-brown areas and a prominent dark tornal spot on the ventral hindwing; in male genitalia, it is more similar to Morvina fissimacula (Mabille, 1878) (type locality in Brazil) in having a longer and thicker process of the ampulla, but the harpe is smaller and straighter in lateral view; both the process and the harpe curve inward (arc-shaped in dorsal view); the harpe is serrated at the distal margin. This species is not cryptic and is confidently diagnosed by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly770.37.2:T240C, aly770.37.2:T244A, aly770.37.2:A249G, aly770.37.2:T267G, aly84.80.2:A13G, aly2487.18.2:A246A (not G), aly2487.18.2:G249G (not T), aly2588.1.3:C72C (not T), aly2314.3.4:C387C (not T), aly12063.14.5:A21A (not C); and COI barcode: T205C, A241G, A295C, T412C, T508A.

Barcode sequence of the holotype.

Sample NVG-22046G01, GenBank PV972486, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTCTACTTATTCGAACTGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAATTCCCCTTATATTAGGAGCCCCTGACATAGCTTTCCCCCGGATAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAATTTTATTAATTTCCAGAAGAGTTGTAGAAAATGGTGCTGGTACTGGATGAACTGTATACCCCCCTTTATCAGCTAATATTGCCCATCAAGGAGCTTCTGTAGATTTAGCAATTTTCTCATTACATTTAGCCGGAATTTCCTCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTACTTCTATCTCTTCCTGTTTTAGCAGGAGCTATTACAATACTTTTAACAGATCGAAATCTTAATACATCTTTTTTTGACCCTGCTGGAGGGGGTGATCCCATTCTTTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Cornell University Insect Collection, Ithaca, New York, USA (CUIC), illustrated in Fig. 288–289 (genitalia Fig. 995–997), bears the following eight rectangular labels (1^st handwritten, others printed with text in italics handwritten), seven white: [ 2/16/99 ], [ Suapure VENEZ. | Caura River | 16 II ‘99 | E.A.Klages ], [ Morvina ♂ | fissimacula | (Mabille) | Det. H.A. Freeman ], [ DNA sample ID: | NVG-22046G01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015E08 | c/o Nick V. Grishin ], [ genitalia | NVG241114–14 | c/o Nick V. Grishin ], [ {QR Code} CUIC | 000099978 ], and one red [ HOLOTYPE ♂ | Morvina caura | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Venezuela: Suapure, Caura River.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in central Venezuela.

Morvina cola Grishin, new species

https://zoobank.org/76477669-8436-45EA-AB9B-0D598643BC50

(Fig. 8 part, 290–291, 998)

Definition and diagnosis.

Sister to Morvina morvus morvus (Plötz, 1884) (type locality in Brazil) but is genetically differentiated from it at the species level (Fig. 8); e.g., their COI barcodes differ by 5.3% (35 bp), and therefore represents a new species. This new species keys to M. morvus morvus (E.23.1(c)) in Evans (1953), but differs from it and other relatives by the following combination of characters: the dorsal hindwing submarginal area is not much paler than the rest of the wing; white on the ventral side is more defined and less overscaled with brown in the middle of the wing; the border is sharper, less diffuse; the process of the ampulla is shorter and thicker, and the harpe is ventrally rounder. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly322.26.9:A145G, aly322.26.9:G156A, aly138.6.13:G51A, aly2258.2.4:C32T, aly822.15.1:G400A; and COI barcode: A37G, T154C, T355C, A373G, A625T.

Barcode sequence of the holotype.

Sample NVG-18019H03, GenBank PV972487, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGGTAGGAACATCTTTAAGCTTACTTATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGACATAGCTTTTCCTCGAATAAACAATATAAGATTTTGATTATTACCCCCTTCTCTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCATTATCAGCCAATATTGCCCACCAAGGGGCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCTTCTATCTTAGGAGCTATTAACTTTATCACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCACTACTTTTATTACTATCTCTTCCTGTTTTAGCAGGAGCTATTACAATACTTTTAACAGATCGAAATCTAAATACATCTTTTTTTGATCCTGCAGGTGGAGGTGATCCTATTCTTTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 290–291 (genitalia Fig. 998), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Rio Opon region | N.ofTunja,Boyaca, | Colombia 6°15’N. ], [ LaSoledad | 650–1500m. | XII 9 1945 ], [ L.Richter coll. | FrankJohnson | Donor ], [ G1787 ], [ DNA sample ID: | NVG-18019H03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Morvina cola | Grishin ]. Paratype: 1♀ NVG-18019H04 Colombia, Boyacá, Río Opon region N of Tunja, La Lechera, 750–1000 m, 2-Dec-1945, L. Richter leg. [AMNH].

Type locality.

Colombia: Boyacá Department, Río Opon region north of Tunja, La Soledad, elevation 650–1500m.

Etymology.

The name is derived from the type locality in Col[ombi]a and is treated as a noun in apposition.

Distribution.

Currently known only from the eastern Andes in Colombia.

Tribe Carcharodini Verity, 1940 Subtribe Cyclosemiina Grishin, 2023

Cyclosemia hebes Grishin, new species

https://zoobank.org/BB9C569F-14B5-434D-A0D1-FD40379E68F0

(Fig. 9 part, 292–293, 999–1001)

Figure 9.

Phylogenetic trees of selected Carcharodini (except Pholisorina) inferred from protein-coding regions in a) the Z chromosome, based on 337,839 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that a specimen from “Amazons” is sister to Cyclosemia earina (Hewitson, 1878) (type locality in Brazil: Pará; genitalia of a syntype examined) but is genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 4.9% (32 bp), and therefore this specimen represents a new species. This new species keys to C. earina (E.27.4) in Evans (1953), but differs from it and other relatives by the harpe terminally rounder than in C. earina, and a narrower process of the ampulla; and the lack of blue on the ventral hindwing characteristic of Cyclosemia anastomosis Mabille, 1878 (type locality in “Brazil”, but likely syntypes are from Panama and Colombia; genitalia of a syntype examined); this area is yellowish-brown in the new species. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2096.13.10:G72A, aly216.66.1:T972G, aly216.66.1:A1491G, aly767.17.3:C387T, aly767.17.3:T405C, aly23605.7.6:T213T (not C), aly1838.39.2:T1731T (not G), aly276378.19.2:A45A (not G), aly1698.2.3:T35T (not C), aly1698.2.3:A84A (not G); and COI barcode: A22A, A40C, A130T, T184C, T418C.

Barcode sequence of the holotype.

Sample NVG-21012D12, GenBank PV972488, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGAACCTCTTTAAGCTTACTAATTCGTTCTGAATTAGGAACTCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGCTTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCCTTAACACTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCTCCTTTATCTTCTAATATTGCCCACCAAGGATCTTCTGTAGATTTAGCTATTTTTTCCCTTCACTTAGCTGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCATTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGACCGTAATCTTAATACATCATTTTTTGACCCTACTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 292–293 (genitalia Fig. 999–1001), bears the following six rectangular labels (1^st handwritten, others printed with text in italics handwritten, five white: [ 777. ], [ 777 | Achlyodes | anastomosis, | Mab. | ♂ Amazons. | Ex. Coll. O. Staudinger. ], [ Holland Collection ], [ DNA sample ID: | NVG-21012D12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–61 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cyclosemia hebes | Grishin ].

Type locality.

“Amazons”, which may refer to Brazil: Pará.

Etymology.

In Latin, hebes means dull or blunt and refers to the terminally rounded harpe and the process of the ampulla. The name is a feminine adjective.

Distribution.

Currently known only from the holotype collected in the Amazonian region.

Cyclosemia alatha Grishin, new species

https://zoobank.org/73876423-D38A-4569-AC7F-23921000F286

(Fig. 9 part, 294–295)

Definition and diagnosis.

This new species is superficially similar to Cyclosemia lathaea (Hewitson, 1878) (type locality in Bolivia) and keys to it (E.27.1) in Evans (1953), but is in a different clade and is more closely related to yellow-, rather than blue-patterned species, such as Cyclosemia earina (Hewitson, 1878) (type locality in Brazil: Pará) (Fig. 9). This new species differs from its relatives by a pale-blue ventral hindwing, which has a brown margin (more extensive blue overscaling within this margin in C. lathaea) and pale-brown areas along the costal margin (blue in C. lathaea) and a weakly developed (weakening towards the inner margin) brownish postdiscal band (postdiscal and submarginal darker bands in C. lathaea are weaker towards the costal margin and stronger around the cell CuA₁-CuA₂). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly4966.13.2:A138G, aly4966.13.2:G141A, aly1315.2.2:A234T, aly536.94.1:T955G, aly3268.9.3:T120C, aly525.25.9:C81C (not T), aly330.13.1:C45C (not T), aly489.2.2:C57C (not T), aly489.2.2:A63A (not G), aly927.1.8:C150C (not T); and COI barcode: T112C, T115C, A169G, A307G, T574G.

Barcode sequence of the holotype.

Sample NVG-24022A05, GenBank PV972489, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTGGGAACCTCTTTAAGTTTATTAATTCGCTCTGAATTAGGTACTCCCGGTTCATTAATTGGAGATGATCAAATCTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCGATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCATTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAACACTTTTAATTTCGAGAAGTGTTGTGGAAAATGGGGCAGGAACTGGATGAACAGTTTACCCCCCTTTATCCTCTAATATTGCTCATCAGGGATCTTCTGTAGACTTAGCTATTTTTTCTCTGCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATACGAATTAATAATATATCGTTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTACTTTTATTACTATCTTTACCAGTATTAGCTGGAGCTATTACGATACTTTTAACTGATCGTAATCTTAATACATCATTTTTTGATCCCACAGGTGGGGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Senckenberg Natural History Museum, Frankfurt, Germany (SMF), illustrated in Fig. 294–295, bears the following four rectangular labels (2^nd handwritten, others printed), three white: [ Rio Songo | Bolivia | 750 m | Coll.Fassl ], [ lathaea U ], [ DNA sample ID: | NVG-24022A05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cyclosemia | alatha Grishin ]. According to its 2^nd label, ventral side (“U”) of this specimen is illustrated as Cyclosaemia [sic] lathaea in Draudt (1921–1924); see plate 174, row i, 1^st image.

Type locality.

Bolivia: Río Zongo.

Etymology.

The name is formed from the name of its similar-looking but more distant relative by adding a negating a- and shortening the word: a + latha[ea]. The name is treated as a feminine noun in apposition.

Distribution.

Currently known only from the holotype collected in Bolivia.

Cyclosemia trichroma Grishin, new species

https://zoobank.org/B5B8AE49-4415-49BB-B93E-BFB53EF899FF

(Fig. 9 part, 296–297)

Definition and diagnosis.

This new species is sister to Cyclosemia earina (Hewitson, 1878) (type locality in Brazil: Pará) (Fig. 9, COI barcode difference 3.3% (22 bp), but differs from it by a pale-bluish (not yellowish) area along the inner margin of the ventral hindwing, and therefore keys to Cyclosemia anastomosis Mabille, 1878 (type locality in “Brazil”, but likely syntypes are from Panama and Colombia) (E.27.3) in Evans (1953), but differs from it by a three-toned (rather than two-toned) ventral hindwing: brown third from the costa, yellowish third in the middle, and pale-bluish third along the inner margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly173.15.2:T78C, aly2041.14.6:T253C, aly2232.1.10:G51A, aly1917.6.2:C231T, aly331.15.5:T897C, aly1585.15.2:T954T (not C), aly2672.7.9:G75G (not T); and COI barcode: T25C, A37G, T325C, T472C, T508C.

Barcode sequence of the holotype.

Sample NVG-23075F08, GenBank PV972490, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGATCAGGAATGGTTGGAACCTCATTAAGTTTACTAATTCGATCCGAACTAGGTACTCCTGGCTCATTAATTGGCGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCCCTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCTTTAACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACCGGATGAACAGTTTACCCTCCTTTATCTTCCAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCCCTTCACTTAGCTGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATCAATAATATATCATTTGATCAAATACCTTTATTTGTCTGAGCTGTTGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACCATACTTTTAACTGACCGTAATCTTAATACATCATTTTTTGACCCTACTGGTGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 296–297, bears the following four rectangular labels (2^nd handwritten and green, others printed: last red and others write): [ 5918 ], [ Rio. v.Lgsdf ], [ DNA sample ID: | NVG-23075F08 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Cyclosemia | trichroma Grishin ]. The number on the first label is the specimen lot number in the ancient collection catalog in Berlin. This entry 5918 in the catalog lists two specimens from “Rio” collected by “v. Langsdf”, referring to German naturalist and explorer Georg Heinrich von Langsdorff (1774–1852), who was a Russian consul in Rio de Janeiro from 1813 and lived in Brazil until 1830 (Ossenbach 2018). It is most likely that the holotype was collected during these years.

Type locality.

Brazil: Rio de Janeiro.

Etymology.

In Greek, τρίχρωμος (tríchromos), derived from τρι- (tri-, meaning three) and χρώμα (chroma, meaning color), means three-colored and refers to a unique pattern of the ventral hindwing in this species. The name is treated as a feminine noun in apposition.

Distribution.

Currently known only from the holotype collected in Southeast Brazil.

Cyclosemia andeania Grishin, new species

https://zoobank.org/851F633C-7788-4CA0-92AB-8083FD8198A8

(Fig. 9 part, 298–299, 1002–1004)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that a specimen from the Andes of northern Peru is closest to Cyclosemia anastomosis Mabille, 1878 (type locality in “Brazil”, but likely syntypes are from Panama and Colombia; genitalia of a syntype examined) but is genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 7.1% (47 bp), and therefore this specimen represents a new species. This new species keys to C. anastomosis (E.27.3) in Evans (1953), but differs from it and other relatives by a broader harpe, a broader process of the ampulla that is serrated along the distal rounded end, with a tooth at its ventral margin, and with a straight dorsal margin; and a pale yellowish-brown ground color of the ventral hindwing, which bears brown stripes divided into spots by veins and a pale whitish-blue area restricted to just near the anal margin instead of occupying a larger part of the hindwing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1146.51.1:C1258A, aly904.8.3:C118A, aly171.14.3:C99T, aly216.8.1:G336A, aly50.17.5:T228C, aly839.10.1:C432C (not T), aly1898.2.4:T726T (not C), aly1405.20.13:A1125A (not T), aly528.30.2:A666A (not G), aly3721.1.20:C942C (not T); and COI barcode: A31G, T82A, T220G, T337C, T463C.

Barcode sequence of the holotype.

Sample NVG-17105G08, GenBank PV972491, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCGGGAATAGTAGGAACTTCTTTAAGTTTACTAATTCGTTCAGAATTAGGTACACCTGGCTCATTAATTGGGGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCGCCCGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACATTATTAATTTCAAGAAGTATCGTAGAAAATGGGGCAGGAACAGGATGAACAGTCTATCCCCCTTTATCTTCTAATATTGCCCATCAAGGATCTTCTGTAGATTTAGCTATCTTCTCTCTTCATTTAGCTGGTATTTCTTCAATTCTAGGAGCTATCAACTTTATTACAACAATTATCAACATACGAATTAATAATATGTCATTTGACCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCACTACTTTTATTGCTATCTTTACCGGTATTGGCTGGAGCTATTACTATACTCTTAACTGATCGTAATCTTAATACATCTTTCTTTGACCCTACTGGGGGAGGAGATCCAATTTTATATCAACATCTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 298–299 (genitalia Fig. 1002–1004), bears the following six printed rectangular labels, five white: [ PERU: Amazomas | Quebrada Chingaza | 05° 22’ S, 78° 27’ W | 24 Sept. 1999, 500m. | D.H. Ahrenholz leg. ], [ DNA sample ID: | NVG-17105G08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22034H03 | c/o Nick V. Grishin ], [ genitalia | NVG241118–62 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894764 ], and one red [ HOLOTYPE ♂ | Cyclosemia | andeania Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Amazonas Region, Quebrada Chinganza, elevation 500 m, approx. GPS −5.367, −78.450.

Etymology.

The name refers to the Andean origin of this species and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of northern Peru.

Cyclosemia mexicania Grishin, new species

https://zoobank.org/EAF0BB32-DAB7-452E-93CC-83941DDD5E0E

(Fig. 9 part, 300–301, 1005–1006)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that specimens from Veracruz, Mexico form a clade sister to Cyclosemia anastomosis Mabille, 1878 (type locality in “Brazil”, but likely syntypes are from Panama and Colombia; genitalia of a syntype examined) but are genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 4.7% (31 bp), and therefore these specimens represent a new species. This new species keys to C. anastomosis (E.27.3) in Evans (1953), but differs from it and other relatives by a shorter and slightly broader harpe that is terminally more rounded, a shorter process of the ampulla that is narrower than in Cyclosemia andeania new species (type locality in Peru: Amazonas), and is serrated along the distal rounded end, but with a tooth at its ventral margin and a less straight dorsal margin; and a pale yellowish-brown ground color of the ventral hindwing, which bears brown stripes undivided by veins into spots and a pale whitish-blue area occupying a posterior third of the hindwing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1222.14.26:C432T, aly2874.15.13:C111T, aly1838.7.1:G2137A, aly1450.14.1:C82T, aly1450.14.1:G117A; and COI barcode: T50C, T106C, T178C, A268G, T592C.

Barcode sequence of the holotype.

Sample NVG-17105D03, GenBank PV972492, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCTCTAAGCTTATTAATTCGATCTGAATTAGGTACCCCTGGCTCATTAATTGGGGATGACCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTCATGGTTATACCAATTATAATCGGAGGATTCGGAAATTGACTAGTACCTTTAATATTAGGAGCACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTGCCCCCTTCTTTAACATTATTAATTTCAAGAAGTATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTTCTAACATTGCTCACCAAGGATCTTCTGTAGATTTAGCCATTTTCTCTCTTCATTTAGCTGGTATTTCTTCAATCCTAGGGGCTATTAATTTTATCACAACAATTATCAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTGGGAATTACAGCTCTACTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTCTTAACTGACCGCAATCTTAATACATCTTTTTTTGATCCTACTGGTGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 300–301 (genitalia Fig. 1005–1006), bears the following eight rectangular labels (2^nd handwritten, others printed), seven white: [ Jalapa, | Mex. ], [ Cyclosaemia | Anastomosis | Mab ], [ Collection | W.Schaus ], [ DNA sample ID: | NVG-17105D03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H10 | c/o Nick V. Grishin ], [ genitalia | NVG241118–63 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913949 ], and one red [ HOLOTYPE ♂ | Cyclosemia | mexicania Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 3♀♀ from Mexico, Veracruz: Catemaco, T. Escalante leg. [MGCL]: 1♂ NVG-23055F08 Sep-1956 and 1♀ NVG-23055F09 Aug-1960; and 2♀♀ NVG-20062E12 and NVG-20062F01 Rd. to Uxpanapa, Poblado Agustín Melgar, 300’, 10-May-1990, J. Kemner leg. [TMMC].

Type locality.

Mexico: Veracruz, Xalapa.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Veracruz, Mexico.

Cyclosemia decorata Grishin, new species

https://zoobank.org/09E25247-66BC-4D2A-951C-E237529FC971

(Fig. 9 part, 302–303, 1007–1009)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that specimens from southern Ecuador form a clade in the nuclear genome tree that is sister to several species, such as Cyclosemia leppa Evans, 1953 (type locality in Bolivia) and Cyclosemia lyrcaea (Hewitson, 1878) (type locality not specified), and are genetically differentiated from them at the species level (Fig. 9); e.g., their COI barcodes differ by 7.0%–9.4% (46–62 bp), and therefore represent a new species. This new species keys to Cyclosemia lathaea (Hewitson, 1878) (type locality in Bolivia) (E.27.1) in Evans (1953), but is not closely related to it and differs by a more extensive blue coloration on the ventral side compared to its relatives (in particular, on the ventral forewing) and a strongly defined arrowhead pattern of bands on the ventral side. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly3277.16.1:A991G, aly3277.16.1:T1083C, aly1259.4.3:G30A, aly1259.4.3:C42T, aly1222.14.14:A3960G, aly6841.31.3:T192T (not C), aly4893.3.3:A90A (not G), aly490.1.2:G619G (not T), aly188.25.1:T1563T (not C), aly536.8.1:T255T (not C); and COI barcode: A100C, T112C, A202G, T562A, T586C.

Barcode sequence of the holotype.

Sample NVG-21054A10, GenBank PV972493, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGTTCTGAATTAGGTACTCCAGGTTCATTAATTGGCGATGATCAAATCTACAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTGCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACACTCTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGGTGAACTGTTTACCCCCCTTTATCTTCTAACATTGCCCACCAGGGCTCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACCGATCGTAATCTTAACACATCTTTCTTTGATCCTACTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 302–303 (genitalia Fig. 1007–1009), bears the following six rectangular labels (1^sthandwritten, others printed), five white: [ Ecuador-ZAM | Zamora 1900 M | IX-08 ], [ M. Simon colln. | MGCL Accession | #2009–38 ], [ DNA sample ID: | NVG-21054A10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24111A03 | c/o Nick V. Grishin ], [ genitalia | NVG250720–12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Cyclosemia | decorata Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Zamora-Chinchipe Province, Zamora, elevation 1900 m.

Etymology.

In Latin, decoratus means adorned, decorated, or embellished. The name refers to the decorative pattern of brown inverted arrowheads on blue background on the ventral side of wings and is an adjective.

Distribution.

Currently known from the holotype collected in southern Ecuador.

Cyclosemia supercaerulea Grishin, new species

https://zoobank.org/0B3A0E94-BD81-4967-9E55-9D7A66F8231C

(Fig. 9 part, 304–305)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that specimens from northern Ecuador form a clade close to Cyclosemia subcaerulea Schaus, 1913 (type locality in Costa Rica), but are genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore represent a new species. This new species keys to C. herennius subcaerulea (E.27.7(a)) in Evans (1953) and was likely included by him in this species, but differs from it and other relatives by males having a paler-blue ventral hindwing with a more extensive brown area near its apex along the outer margin up to the vein M₃ and only a trace of a brown spot in the middle of the cell Sc+R₁-RS and a more extensive pale beige area along the inner margin of the ventral forewing from its base to the outer margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1603.68.2:C101G, aly499.57.1:A769T, aly499.57.1:C935T, aly103.9.2:T507C, aly103.9.2:G514A; and COI barcode: A34G, A58A, A160G, A181G, A592G.

Barcode sequence of the holotype.

Sample NVG-17105F05, GenBank PV972494, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCTGGGATAGTTGGAACTTCTTTAAGTTTACTTATTCGTTCTGAACTTGGTACACCTGGTTCTTTAATTGGTGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCATTCCCACGTATAAATAATATAAGATTTTGATTATTACCACCCTCATTAACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACTGTTTACCCTCCTTTATCTTCTAATATCGCTCATCAAGGTTCCTCAGTAGATCTTGCTATTTTCTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATCATCAATATACGAATTAACACTATATCTTTTGATCAAATACCCTTGTTTGTTTGAGCAGTAGGAATTACTGCTTTACTTTTACTTTTATCATTACCTGTACTAGCTGGTGCTATTACTATATTATTAACTGATCGGAATCTTAATACATCTTTCTTTGATCCTACTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 304–305, bears the following four printed rectangular labels, three white: [ ECUADOR: Esmeraldas, | El Durango, km. 40, | Lita-San Lorenzo rd., | 1° 02’45” N, 78°38’06” W | 300 m, 25, 27 Aug 2002 | J.P.W. Hall & M.A. Solis ], [ DNA sample ID: | NVG-17105F05 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894979 ], and one red [ HOLOTYPE ♂ | Cyclosemia | supercaerulea Grishin ]. Paratype: 1♂ NVG-17105G12, USNMENT 00913282 the same data as the holotype but collected by R. Aldas in Aug-2002.

Type locality.

Ecuador: Esmeraldas Province, El Durango, km 40 of Lita-San Lorenzo Road, elevation 300 m, GPS 1.04583, −78.6350.

Etymology.

The name is formed from the name of its relative, C. caerulea, made longer to indicate more southern distribution and is an adjective.

Distribution.

Currently known only from northern Ecuador.

Cyclosemia bolivia Grishin, new species

https://zoobank.org/4F429AB1-3A49-4510-851D-1AFC0F95656E

(Fig. 9 part, 306–307, 1010–1012)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that a specimen from Bolivia is sister to Cyclosemia herennius (Stoll, 1782) (type locality in Suriname), but is genetically differentiated at the species level (Fig. 9); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore this specimen represents a new species. This new species keys to C. herennius herennius (E.27.7(b)) in Evans (1953), but differs from it and other relatives by the rounder wings, less extensive blue coloration on the ventral hindwing restricted to the areas between well-developed and larger brown spots, wider dark-brown bands on the dorsal hindwing, only a vestigial darker brown (not black) spot in the discal cell of the ventral forewing; a terminally wider harpe, and a longer, terminally broader and more strongly upturned process of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly17.16.2:C75T, aly17.16.2:C121T, aly1656.25.1:T1328A, aly1407.7.8:T444A, aly2154.11.12:A108G, aly727.7.2:A137A (not G), aly1018.13.1:C894C (not T), aly536.136.1:A1911A (not G); and COI barcode: T212C, T505T, A477C, G506A, T547C, T646C.

Barcode sequence of the holotype.

Sample NVG-21012D08, GenBank PV972495, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACTTCTTTAAGTTTAATTATTCGTTCTGAACTTGGTACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCTCCTGATATAGCATTCCCACGTATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACTCTTCTAATTTCAAGAAGTATCGTAGAAAATGGGGCTGGAACAGGTTGAACTGTATACCCTCCTTTATCTTCTAATATTGCCCATCAAGGTTCTTCTGTAGATCTTGCTATTTTTTCACTACACTTAGCAGGTATTTCTTCAATTTTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAATACTATATCTTTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACAGCTTTACTTTTACTTTTATCCTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATCTTAATACATCTTTCTTTGATCCTACTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 306–307 (genitalia Fig. 1010–1012), bears the following five printed rectangular labels, four white: [ Sta. Cruz de | la Sierra, Bol. | 450 m. | J. Steinbach ], [ Lindsay Collection | C. M. Acc. No. 8584 ], [ DNA sample ID: | NVG-21012D08 | c/o Nick V. Grishin ], [ genitalia | NVG241118–64 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cyclosemia | bolivia Grishin ].

Type locality.

Bolivia: Santa Cruz Department, Santa Cruz de la Sierra, elevation 450 m.

Etymology.

The name is derived from the country of the type locality and is a noun in apposition.

Distribution.

Currently known only from the holotype collected in central Bolivia.

Cyclosemia rondonnius Grishin, new species

https://zoobank.org/125CBFAF-2C72-4356-BFF8-DB819FB97702

(Fig. 9 part, 308–309, 1013–1018)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that specimens from Rondônia, Brazil, form a clade sister to Cyclosemia bolivia new species (type locality in Bolivia) and close to Cyclosemia herennius (Stoll, 1782) (type locality in Suriname), but are genetically differentiated from them at the species level (Fig. 9); e.g., their COI barcodes differ by 2.9% (19 bp) from C. bolivia and by 4.0% (26 bp) from C. herennius, and therefore these specimens represent a new species. This new species keys to C. herennius herennius (E.27.7(b)) in Evans (1953), but differs from it and other relatives by rounder wings (similar to C. bolivia); less extensive blue coloration on the ventral hindwing but, as in C. herennius, still overscaling brown spots, which are larger than in C. herennius; wider dark-brown bands on the dorsal hindwing; a better developed dark discal cell spot (typically with two pale pupils) on the ventral forewing; a terminally wider harpe; and a longer, terminally broader and slightly upturned process of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly731.8.1:T669A, aly731.8.1:A675G, aly272.10.10:A180G, aly2012.63.11:G133A, aly216.18.5:G790A; and COI barcode: T250C, T283C, T505C, T547C, T607C.

Barcode sequence of the holotype.

Sample NVG-21054C05, GenBank PV972496, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACTTCTTTAAGTTTAATTATTCGTTCTGAACTTGGTACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCATTCCCACGTATAAACAACATAAGATTTTGATTATTACCACCTTCATTAACCCTTCTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACTGTATATCCTCCTTTATCCTCTAATATTGCTCATCAAGGTTCTTCTGTAGATCTTGCTATTTTTTCACTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTCATTTGATCTGTAGGAATTACAGCTTTACTTTTACTTTTATCCTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATCTTAATACATCCTTTTTTGATCCTACTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 308–309 (genitalia Fig. 1013–1018), bears the following six printed (text in italics handwritten) rectangular labels (3^rd yellow, 6^th red, others white): [ BRASIL: Rondonia | 62 km S Ariquemes | linea C-20, 7 km E | B-65, Fazenda | Rancho Grande | 17 Nov. 1990 | leg. G. T. Austin ], [ Cyclosemia herennius | herennius (Stoll) | det. GT Austin 1991 ], [ photographed | G.T. Austin & | J. P. Brock | March 1992 ], [ Genetalic Vial | GTA-10024 ], [ DNA sample ID: | NVG-21054C05 | c/o Nick V. Grishin ], and [ HOLOTYPE ♂ | Cyclosemia | rondonnius Grishin ]. Paratype: 1♂ NVG-23055G10 the same data as the holotype but collected by Jim P. Brock on 12-Nov-1990.

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande.

Etymology.

The name is formed from the name of its sister species, C. herennius, to indicate its type locality in Rondônia and is treated as a noun in apposition.

Distribution.

Currently known only from Rondônia, Brazil.

Cyclosemia ecuadoria Grishin, new species

https://zoobank.org/E441B1E3-8B5B-458F-9947-C7A0668DCEB8

(Fig. 9 part, 310–311, 1019–1021)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that a specimen from central Ecuador is sister to Cyclosemia elelea (Hewitson, 1878) (type locality given as “Cayenne” [possibly French Guiana], but the appearance of the only known syntype prompted Evans (1953) to suggest its Peruvian origin), but is genetically differentiated at the species level (Fig. 9); e.g., their COI barcodes differ by 5.6% (37 bp), and therefore this specimen represents a new species. This new species keys to C. herennius herennius (E.27.7(b)) in Evans (1953), but differs from it and other relatives by females with less extensive blue coloration on the ventral hindwing restricted to areas between well-developed and larger brown spots; broader brown marginal area devoid of blue overscaling; a nearly complete lack of blue overscaling on the ventral forewing (vestigial at the base); more convex lobes of the lamella postvaginalis on the sides of a deeper central notch, and larger rounded extensions (that ventrally merge with each other) of the lateral sclerotized plates in female genitalia. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly188.10.1:G1723C, aly113.11.1:C123T, aly1603.64.5:C149G, aly536.78.1:A2136G, aly6654.6.4:A387G, aly60.27.1:A102A (not G), aly6654.6.4:A431A (not C), aly6841.47.2:C33C (not T), aly1019.31.5:C115C (not A), aly6841.79.5:T234T (not A); and COI barcode: T13C, A34A, A214G, A268G, C401T, T530C.

Barcode sequence of the holotype.

Sample NVG-17105G09, GenBank PV972497, 658 base pairs:

AACTTTATATTTCATTTTTGGAATTTGATCTGGAATAGTTGGAACCTCTTTAAGTTTACTCATTCGCTCTGAACTTGGTACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTGGGGGCCCCTGATATAGCATTTCCACGTATAAATAATATAAGATTTTGACTATTGCCACCCTCTTTAACTCTTTTAATTTCGAGAAGTATTGTAGAAAATGGGGCTGGAACAGGTTGAACTGTTTACCCTCCTTTATCTTCTAATATTGCTCATCAAGGTTCCTCAGTAGATCTTGCTATTTTTTCCTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCCTTATTTGTTTGAGCAGTTGGAATTACAGCTCTACTTCTACTTTTATCATTACCTGTATTAGCTGGTGCTATTACCATGTTATTAACTGATCGAAATCTTAACACATCTTTTTTTGACCCCACTGGAGGGGGGGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 310–311 (genitalia Fig. 1019–1021), bears the following six printed rectangular labels, five white: [ ECUADOR: Napo Pr | Jatun Sacha Biol Sta | 01° 04’ S, 77° 36’ W | 4 Oct1991, 450 m | S S Nicolay leg ], [ DNA sample ID: | NVG-17105G09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H11 | c/o Nick V. Grishin ], [ genitalia | NVG241118–65 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894974 ], and one red [ HOLOTYPE ♀ | Cyclosemia | ecuadoria Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Napo Province, Jatun Sacha Biological Station, elevation 450 m, approx. GPS −1.0667, −77.600.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected east of the Andes in central Ecuador.

Cyclosemia peruvia Grishin, new species

https://zoobank.org/BB78F365-E06A-44F8-9E53-AE7B9D29E765

(Fig. 9 part, 312–313, 1022–1024)

Definition and diagnosis.

Genomic analysis of Cyclosemia Mabille, 1878 (type species Papilio herennius Stoll, 1782) reveals that a specimen from southern Peru is sister to Cyclosemia elelea (Hewitson, 1878) (type locality given as “Cayenne” [possibly in French Guiana], but the appearance of the only known syntype prompted Evans (1953) to suggest its Peruvian origin), but is genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 4.3% (28 bp), and therefore this specimen represents a new species. This new species keys to C. herennius elelea (E.27.7(c)) in Evans (1953), but differs from it and other relatives by females with more extensive blue coloration on the ventral side, including the hindwing that is nearly entirely blue and with a less prominent brown apex of C. elelea, and more extensive blue overscaling in the discal cell of the ventral forewing; narrower brown bands on the dorsal hindwing; straighter lobes of the lamella postvaginalis on the sides of a weakly developed central notch; and smaller rounded extensions (that ventrally merge with each other) of the lateral sclerotized plates in female genitalia. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly60.27.1:A102G, aly6654.6.4:A431C, aly6841.47.2:C33T, aly251.7.4:T41G, aly251.7.4:T45C, aly1264.7.1:C884C (not G), aly1294.8.4:T54T (not C), aly529.23.5:A557A (not T), aly529.23.5:T676T (not G), aly3881.2.3:G898G (not A); and COI barcode: T13C, A34G, A199G, T407C, A377G, T607C.

Barcode sequence of the holotype.

Sample NVG-17105F12, GenBank PV972498, 658 base pairs:

AACTTTATATTTCATTTTTGGAATTTGATCTGGGATAGTTGGAACCTCTTTAAGTTTACTCATTCGCTCTGAACTTGGTACACCTAGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTGGTACCATTAATATTAGGGGCCCCTGATATAGCATTTCCACGTATAAATAATATAAGATTTTGACTATTACCACCCTCTTTAACCCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACTGTTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGTTCCTCAGTAGATCTTGCTATTTTTTCCCTACATCTAGCAGGTATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCCTTATTTGTTTGAGCAGTGGGGATTACAGCTTTACTTCTACTTTTATCATTACCTGTATTGGCTGGTGCTATTACTATATTATTAACTGATCGAAATCTTAATACATCCTTCTTTGACCCCACTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 312–313 (genitalia Fig. 1022–1024), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU:Cuzco, 1050m | Quitacalzón | Cosnipata Valley 4372 | 24-IV-2015 Kinyon ], [ DNA sample ID: | NVG-17105F12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119H12 | c/o Nick V. Grishin ], [ genitalia | NVG241118–66 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00894976 ], and one red [ HOLOTYPE ♀ | Cyclosemia | peruvia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Cuzco Department, Cosñipata Valley, Quebrada Quitacalzón, elevation 1050 m, approx. GPS −13.0167, −71.4833.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the eastern base of the Andes in southern Peru.

Subtribe Ilianina Grishin, 2023

Iliana amazona Grishin, new species

https://zoobank.org/04C21B81-37E3-46F8-9ABF-EBFAA81C33D7

(Fig. 9 part, 314–315)

Definition and diagnosis.

Genomic analysis of a female from northwestern Brazil curated in the MFNB collection within Anastrus obscurus Hübner, [1824] (type locality not specified) reveals that it is not closely related to Anastrus Hübner, [1824] (type species Anastrus obscurus Hübner, [1824]), in Erynnini Brues and F. Carpenter, 1932, but is sister to Iliana Bell, 1937 (type species Iliana romulus Bell, 1937), in Carcharodini Verity, 1940 (Fig. 9). Therefore, this specimen represents an unusual new species that we place in Iliana due to genetic and phenotypic similarities. This new species keys (incompletely) to Iliana remus E. Bell, 1937 (type locality in Peru: Putumayo River) (E.16.3) in Evans (1953), but differs from it and other relatives by females with short antennae that are less than half of the forewing costa length, whitish-gray palpi beneath, maroon-colored wings above, darker at the bases and pale-violaceous on two-thirds of the hindwing and an area by the forewing tornus up to vein M₂, the ventral hindwing colored by a gradient from maroon (at the costa) to dull beige yellow (at the inner margin), and both wings ventrally with an indistinct band of darker spots along their margins. This species is not cryptic and is identifiable by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly527.13.6:G174A, aly527.13.6:T199A, aly527.13.6:C200G, aly188.25.1:T450A, aly188.25.1:A1521G, aly4339.8.3:C281C (not G), aly2548.21.7:A141A (not T), aly533.1.1:A141A (not G), aly533.1.1:A147A (not G), aly2680.1.7:C140C (not A); and COI barcode: T88T, A100T, T379A, T505C, T641C.

Barcode sequence of the holotype.

Sample NVG-23075E08, GenBank PV972499, 658 base pairs:

AACTTTATACTTTATTTTCGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGATCTGAATTAGGAATTTCAGGTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTTTACCTCCTTCTCTTACTTTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCAAATATTGCTCATCAGGGATCTTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCATTATTCGTTTGAGCTGTTGGAATTACAGCATTACTTTTATTATTATCACTTCCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 314–315, bears the following three rectangular labels (1^st handwritten others printed), two white: [ Thomár | rio negro | 86 Hhl ], [ DNA sample ID: | NVG-23075E08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Iliana (Nastrus) | amazona Grishin ]. According to its label, the holotype was collected in 1886 by Paul Hahnel (1843–1887).

Type locality.

Brazil: Amazonas, Río Negro, Tomar.

Etymology.

The name is derived from the state of the type locality, Amazona[s], and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Amazonian Brazil.

Nastrus Grishin, new subgenus

https://zoobank.org/A74A309C-BC0F-4F5A-A29D-D08ACE055044

Type species.

Iliana amazona Grishin, new species.

Definition.

Genomic phylogeny of Carcharodini Verity, 1940 reveals that Iliana amazona Grishin, new species (type locality in Brazil: Amazonas) is sister to all other species of Iliana Bell, 1937 (type species Iliana romulus Bell, 1937), which currently consists of two subgenera: the nominate and Torgus Grishin, 2023 (type species Ouleus gorgus E. Bell, 1937), and therefore represents a new subgenus (Fig. 9). This new subgenus differs from its relatives by a combination of the following characters in females: a slightly lobed hindwing tornus, short palpi, very short antennae about 2/5 the length of the forewing costa, and unspotted dorsal hindwing with pale-violaceous on the outer two-thirds and maroon at the base. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly527.13.6:G174A, aly527.13.6:T199A, aly527.13.6:C200G, aly188.25.1:T450A, aly188.25.1:A1521G, aly4339.8.3:C281C (not G), aly2548.21.7:A141A (not T), aly533.1.1:A141A (not G), aly533.1.1:A147A (not G), aly2680.1.7:C140C (not A); and COI barcode: T88T, A100T, T379A, T505C, T641C.

Etymology.

The name is formed from the name of a similar-in-appearance genus Anastrus by removing of the “negating” prefix a- and is a masculine noun in the nominative singular.

Species included.

Only the type species (i.e., I. amazona, new species).

Parent taxon.

Genus Iliana Bell, 1937.

Tiana ater Grishin, new species

https://zoobank.org/7963601C-E0F6-4CE4-A307-05EAC6805445

(Fig. 9 part, 316–319, 1025–1026)

Definition and diagnosis.

Genomic analysis reveals that a pair from Panama forms a nuclear genome clade sister to Tiana niger (R. Williams and E. Bell, 1940) (type locality in Colombia) that is genetically differentiated from it at the species level (Fig. 9); e.g., the COI barcode of one Panamanian specimen differs from that of the T. niger holotype by 1.7% (11 bp), and therefore these specimens represent a new species. This new species keys to “Tosta niger” (F.7.4) in Evans (1953), but differs from it and other relatives by males with a longer ampulla, a narrower harpe with a notch along the dorsoposterior margin, and a weakly developed costal fold on the forewing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1042.10.3:A48G, aly3850.3.7:C93A, aly3850.3.7:G120A, aly666.25.7:A91C, aly529.12.4:T117G. This species cannot be identified with confidence by the COI barcodes due to introgression.

Barcode sequence of the holotype.

Sample NVG-15022A03, GenBank PV972500, 658 base pairs:

AACTTTATATTTTATCTTCGGAATTTGATCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGATCAGAGTTAGGAACTCCAAATTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGGTTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCTTCTATCACCTTACTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGTACAGGTTGAACAGTCTATCCCCCTCTCTCAGCAAATATTGCTCATCAAGGATCATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCCATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACAGATCGAAATCTTAATACATCCTTTTTTGATCCAGCAGGTGGGGGAGATCCAATCTTATATCAACATTTATTT

Barcode sequence of the paratype.

Sample NVG-23053F05, GenBank PV972501, 658 base pairs:

AACTTTATATTTTATCTTCGGAATTTGATCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGATCAGAATTAGGAACTCCAAATTCATTGATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGGTTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCTTCTATTACTTTACTAATTTCAAGAAGTATTGTAGAAAATGGGGCTGGTACAGGTTGGACAGTCTATCCACCTCTTTCAGCAAATATTGCTCATCAAGGATCATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATCAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCCTTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACAGATCGAAATCTTAATACATCCTTTTTTGATCCAGCAGGTGGAGGAGATCCAATCTTATATCAACACTTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 316–317, bears the following six rectangular labels (3^rd handwritten others printed, 1^st and 2^nd labels are identical), five white: [ PANAMA, COCLE PROVINCE | EL VALLE DE ANTON | 7-VIII-2010, 700 m. elv. | DR. THOMAS W. KLEIN leg ], [ PANAMA, COCLE PROVINCE | EL VALLE DE ANTON | 7-VIII-2010, 700 m. elv. | DR. THOMAS W. KLEIN leg ], [ Hesperiidae | species unk. ], [ T. Klein coll. | MGCL Accession |# 2010–37 ], [ DNA sample ID: | NVG-15022A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Tiana ater | Grishin ]. Paratype: 1♂ NVG-23053F05 (leg, DNA sequenced), NVG-24064F07 (abdomen, DNA stored) Panama, Canal Zone, Piña, 1-May-1971, H. L. King leg., genitalia NVG241111–12 (Fig. 1025–1026) [MGCL] (Fig. 318–319).

Type locality.

Panama: Coclé Province, El Valle de Anton, elevation 700 m.

Etymology.

In Latin, ater means black, dark, or gloomy. The name refers to the dark color of this close relative of T. niger. The name is treated as a noun in apposition to agree with the original spelling niger given to its relative.

Distribution.

Currently known only from the holotype collected in central Panama.

Comment.

The COI barcode sequence of the paratype (male) differs from that of the holotype (female) by 2% (13 bp). The paratype sequence differs from the T. niger holotype by only 0.3% (2 bp), thus indicating its origin in T. niger. Therefore, we selected the female specimen, which has a strongly different barcode, as the holotype of the new species. Mitochondrial introgression between the two species would explain the difference between the barcodes of the holotype and the paratype of the new species.

Tiana nigerrima Grishin, new species

https://zoobank.org/2CF0DB87-EB95-4052-915D-B5306BBC635B

(Fig. 9 part, 320–321, 1027–1028)

Definition and diagnosis.

Genomic analysis reveals that a specimen from central Ecuador is sister to Tiana niger (R. Williams and E. Bell, 1940) (type locality in Colombia) in the nuclear genome and is genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore this specimen represents a new species. This new species keys to “Tosta niger” (F.7.4) in Evans (1953), but differs from it and other relatives by males with a more robust and longer harpe, a less terminally narrowing uncus with more convex sides in dorsal view, and without the costal fold on the forewing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly349.23.9:T93A, aly272.2.17:A678G, aly86.12.2:A120G, aly86.12.2:A158G, aly420.23.4:T762G, aly839.26.5:A2104A (not T), aly839.26.5:T2136T (not A), aly2165.3.3:C1741C (not A), aly577.24.36:A77A (not T), aly86.9.15:C39C (not T); and COI barcode: A31C, T115C, T121C, T139C, A214G, A565G.

Barcode sequence of the holotype.

Sample NVG-15091G04, GenBank PV972502, 658 base pairs:

AACTTTATATTTTATCTTCGGAATTTGATCCGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGATCAGAATTAGGAACTCCAAATTCATTAATTGGAGATGATCAAATTTACAATACCATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGGTTAGTACCCCTTATATTGGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCCATTACTTTACTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGCACAGGTTGAACAGTTTATCCCCCTCTTTCAGCAAATATCGCTCATCAGGGATCTTCTGTAGATCTAGCTATTTTTTCTTTACATCTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTCTGAGCTGTAGGAATTACAGCATTATTGTTATTATTATCACTACCAGTTTTAGCAGGGGCTATTACAATACTTTTAACAGATCGAAATCTTAATACATCTTTTTTTGATCCAGCTGGTGGGGGAGATCCAATCTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 320–321 (genitalia Fig. 1027–1028), bears the following six rectangular labels (1^st handwritten others printed), five white: [ ECUADOR-PAST | PUYO 1000M | IV-10 ], [ M. Simon | MGCL Accession | #2011–8 ], [ DNA sample ID: | NVG-15091G04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23053F04 | c/o Nick V. Grishin ], [ genitalia | NVG241018–07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Tiana nigerrima | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Pastaza Province, Puyo, elevation 1000 m.

Etymology.

The name refers to the dark color of this species and is made longer for this more southern relative of T. niger. The name is an adjective.

Distribution.

Currently known only from the holotype collected east of the base of the Andes in central Ecuador.

Subtribe Nisoniadina Grishin, 2023

Nisoniades (Bezus) occibessus Grishin, new species

https://zoobank.org/E9123B74-7CDF-4A99-BE91-B5D8E77A0A62

(Fig. 9 part, 322–323, 1029–1031)

Definition and diagnosis.

Genomic analysis reveals that Nisoniades bessus (Möschler, 1876) (type locality in Suriname) specimens are partitioned into two clades genetically differentiated at the species level in the nuclear genome (Fig. 9). One clade contains a syntype of N. bessus and corresponds to this species. The other clade consists of specimens from the western parts of the range and represents a new species. We note that a number of Nisoniades Hübner, 1819 (type species Papilio bromius Stoll, 1787, which is a junior subjective synonym of Papilio mimas Cramer, 1775) species do not differ substantially from each other in COI barcodes and in mitochondrial DNA in general (Fig. 9b). The new species keys to N. bessus bessus (E.19.1(g)) in Evans (1953) and was included by him in this species, but differs from it by a more strongly developed left harpe that is densely serrated along the dorsal surface and the left valva, which has a wider ampulla that overlaps the harpe. This species is not cryptic and is confidently diagnosed by male genitalia. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly240.27.4:C120T, aly525.93.2:A124G, aly537.7.1:G300A, aly102.6.2:T2047C, aly2692.4.48:C123T. This species cannot be identified by the COI barcodes due to the lack of divergence in mitogenomes in its species group.

Barcode sequence of the holotype.

Sample NVG-18059F07, GenBank PV972503, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCTGAATTAGGTGTTCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTATCACATTACTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACTGTATATCCCCCTTTATCAACTAATATTGCCCACCAAGGTTCTTCTGTCGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCATCCATTTTAGGTGCTATTAATTTTATTACTACTATCATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCTCTTCCAGTTTTAGCTGGAGCCATTACAATATTACTGACAGATCGTAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 322–323 (genitalia Fig. 1029–1031), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU 300m | 20 Km S.W. | Pto Maldonado | 15 Oct ‘83 | S. S. Nicolay ], [ genitalia | ♂ slide/vial # | H867 | Prep. S.S. Nicolay ], [ Nisoniades | bessus ♂ | Det. bessus | S.S. Nicolay ], [ DNA sample ID: | NVG-18059F07 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466825 ], and one red [ HOLOTYPE ♂ | Nisoniades (Bezus) | occibessus Grishin ]. Paratypes: 3♂♂: 1♂ NVG-18059F06, USNMENT 01466824 Ecuador, Napo, Lumbaqui, 700 m, 24-Sep-1975, S. S. Nicolay leg., genitalia H719 S. S. Nicolay [USNM]; 1♂ NVG-21054H07 Peru, Madre de Dios, 0–2 km W of Puerto Maldonado, 250 m, 19-Aug-1981, L. D. Miller leg., genitalia SRS-1541 [MGCL]; and 1♂ NVG-23053B12 Brazil, Rondônia, 62 km S of Ariquemes, off B-65, vic. Fazenda Rancho Grande, 180 m, 7-Nov-1989, G. T. Austin leg., genitalia GTA-228 [MGCL].

Type locality.

Peru: Madre de Dios Region, 20 km southwest of Puerto Maldonado, elevation 300 m.

Etymology.

In Latin, occidens means west. The name of this sister species of N. bessus is given for its more western distribution and is treated as a noun in apposition.

Distribution.

Ecuador and Peru.

Nisoniades (Nisoniades) equaphora Grishin, new species

https://zoobank.org/ADAF2004-B4FD-4C1E-AE97-ECAF4CFDA879

(Fig. 9 part, 324–325, 1032–1035)

Definition and diagnosis.

Genomic analysis reveals that a specimen from southern Ecuador is sister to Nisoniades ephora (Herrich-Schäffer, 1870) (type locality in Nicaragua and Brazil), and is genetically differentiated from it at the species level in the nuclear genome (Fig. 9a), and therefore represents a new species, which, however, does not differ from N. ephora in the COI barcode. This new species keys to N. ephora (E.19.8) in Evans (1953) and was included by him in this species, but differs from it and other relatives by the middle hyaline apical forewing spot less displaced from alignment with the other two, yellowish overscaling at the dorsal forewing apex; a narrower and more twisted right harpe, more weakly serrated along its dorsal margin, and the uncus wider in the middle in dorsal view. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly390.33.7:A39G, aly1084.7.2:C69T, aly272.25.1:T110A, aly536.76.1:C339G, aly276558.35.2:A50G, aly349.28.2:A227A (not G), aly276634.5.5:C190C (not A), aly1651.20.6:A50A (not G), aly6841.68.4:A940A (not C), aly423.5.6:G69G (not A). This species cannot be identified by the COI barcodes due to the lack of divergence in mitogenomes.

Barcode sequence of the holotype.

Sample NVG-18059G11, GenBank PV972504, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTATACTTATTCGATCTGAATTAGGCACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAACATAAGATTTTGACTTTTACCTCCTTCTATTACTTTATTAATTTCAAGTAGTATTGTAGAAAATGGAGCTGGAACAGGTTGAACTGTATACCCACCTTTATCATCTAATATTGCCCACCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCTCTACATTTAGCTGGTATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCATTACTTTTATTACTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCTTTTTTTGACCCTGCAGGAGGGGGAGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 324–325 (genitalia Fig. 1032–1035), bears the following seven rectangular labels (2^nd handwritten, others printed) six white: [ Environs de LOJA, | Equateur | 89– ], [ Pellicia | Ephora | H-S. | tiphys | G&S. ], [ DNA sample ID: | NVG-18059G11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22034H08 | c/o Nick V. Grishin ], [ genitalia | NVG241118–67 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466841 ], and one red [ HOLOTYPE ♂ | Nisoniades (Nisoniades) | equaphora Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Loja Province, vicinity of Loja.

Etymology.

The name for this relative of N. ephora is derived from the county of the type locality: Ecua[dor] + [e] phora, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of southern Ecuador.

Subtribe Pholisorina Grishin, 2023

Bolla (Bovaria) damera Grishin, new species

https://zoobank.org/299B7A03-6A5E-422A-87E4-B98F57FCCBE2

(Fig. 10 part, 326–327, 1036–1038)

Figure 10.

Phylogenetic trees of selected Pholisorina inferred from protein-coding regions in a) the Z chromosome, based on 344,436 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of specimens identified as Bolla (Bovaria) tepeca (Bell, 1942) (type locality Mexico: Mexico City, Lomas de Chapultepec) including its holotype, reveals that they partition into two clades genetically differentiated at the species level (Fig. 10); e.g., their F_st/G_min/COI barcode difference are 0.21/0.027/1.4% (9 bp). One clade with the holotype of B. tepeca includes specimens from the Valley of Mexico and thus corresponds to the true B. tepeca. The other clade corresponds to populations from around the Sierra Juárez in Oaxaca and represents a new species. See Fig. 7 in Lemes et al. (2023) for the distributional map showing the two groups of populations. The new species keys to “Staphylus tepeca” (E.32.18) in Evans (1953), but differs from it by being generally darker, with less contrasting pattern of spots due to darker reddish-brown ground color, the dorsal forewing and the hindwing being about the same color (forewing usually appears slightly grayer than the hindwing in B. tepeca, creating a slight contrast in tone between the two wings), relatively larger and blotchier dorsal dark spots (more contrasting in B. tepeca), but better defined dark spots on the ventral side; a typically broader genitalic valva, and more separated, shorter caudal prong of the harpe. The description and illustrations of B. tepeca in Lemes et al. (2023) mostly refer to this new species. Due to somewhat cryptic nature of this species and individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1019.28.2:A369G, aly291.8.6:C81T, aly72.5.9:C60T, aly72.5.9:C63T, aly46231.1.2:A132T; and COI barcode: A160A,C187T, C205T, 220G, C343A, T479C.

Barcode sequence of the holotype.

Sample NVG-18058E01, GenBank PV972505, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACTTCCTTAAGTATTCTTATTCGTTCTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCGCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTCTTATATTATTAATTTCAAGAAGTGTAGTTGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCACCACTTTCAGCTAATATTGCTCACCAAGGTTCATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATCTATCATTTGATCAAATACCATTATTTGTATGAGCAGTAGGAATTACTGCATTACTTTTACTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCGGGTGGAGGAGATCCTATTCTTTACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 326–327, bears the following five rectangular labels (first two handwritten, others printed), four white: [ Mex: Oax: Sierra Juarez | La Cumbre – El Punto | 12 Apr.1989 - John Kemner ], [ Staphylus ♂ | tepeca | (Bell) | det.H.A.Freeman ], [ DNA sample ID: | NVG-18058E01 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466711 ], and one red [ HOLOTYPE ♂ | Bolla (Bovaria) | damera Grishin ]. Paratypes: 2♂♂ with the same data as the holotype except as indicated: 1♂ NVG-17069A09 (leg, DNA sequenced), NVG-18032G01(abdomen, DNA stored) 18-May-1988, genitalia NVG241114–59 (Fig. 1036–1038) [USNM] and 1♂ NVG-20062E02 30 Apr-1988 [TMMC].

Type locality.

Mexico: Oaxaca, Sierra Juárez, La Cumbre-El Punto, elevation 7000’.

Etymology.

In Spanish, damero means checkerboard or grid. The name refers to the checkered appearance of this species and is treated as a noun in apposition.

Distribution.

Currently known only from Oaxaca, Mexico.

Bolla (Bolla) aureiceps Grishin, new species

https://zoobank.org/1646DC26-DD1B-4000-A982-20590BD36B87

(Fig. 10 part, 328–329, 1039–1040)

Definition and diagnosis.

Genomic analysis of a specimen from Ecuador identified as Bolla cupreiceps (Mabille, 1891) (type locality in Honduras) is genetically differentiated from it at the species level (Fig. 10); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore this specimen represents a new species. This new species keys to “B. cupreiceps” (E.31.7) in Evans (1953), but differs from it and other relatives by more yellowish-orange coloration of the head and palpi, a narrower valva with a smaller and terminally rounder ampulla, and a terminally broader harpe with a more strongly concave distal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly292.4.2:C150T, aly1838.52.6:T40A, aly7690.1.10:G46A, aly363.43.8:C49A, aly363.43.8:C55T, aly4778.5.1:G606G (not A), aly798.5.2:A313A (not G), aly2041.14.6:G147G (not C), aly707.13.1:G123G (not C), aly235.6.6:C126C (not T); and COI barcode: T121A, A160G, A268A, T337G, A628G, T646C.

Barcode sequence of the holotype.

Sample NVG-18049C12, GenBank PV972506, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGAATTCTTATTCGTTCAGAATTAGGAACCCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGATTATTACCTCCTTCTCTTATTTTATTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTACTGGATGAACAGTGTATCCCCCACTTTCAGCTAATATTGCTCATCAAGGTTCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCATTACTTTTATTATTATCACTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGACCGTAACTTAAATACATCATTTTTTGACCCTGCAGGTGGGGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 328–329 (genitalia Fig. 1039–1040), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ ECUADOR Pichincha | Alluriquin 700m | 26 May ‘88 | D. H. Ahrenholz ], [ Bolla ♂ | cupreiceps | Det. | S.S. Nicolay ], [ DNA sample ID: | NVG-18049C12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22034H11 | c/o Nick V. Grishin ], [ genitalia | NVG241118–68 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466614 ], and one red [ HOLOTYPE ♂ | Bolla (Bolla) | aureiceps Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Pichincha Province, Alluriquín, elevation 700 m.

Etymology.

The name is formed similarly to the name of its sister species B. cupreiceps. In Latin, cupreus means coppery or bronze-colored, and aureus means golden, referring to the color of the head. The name is an adjective.

Distribution.

Currently known only from the holotype collected in the Andes of northern Ecuador.

Bolla tornea Evans, 1953 is a species distinct from Bolla giselus (Mabille, 1883)

Genomic analysis of Bolla giselus tornea Evans, 1953 (type locality Colombia: Cauca, Torne) and Bolla giselus giselus (Mabille, 1883) (type locality Colombia: Bogotá) reveals that they are not monophyletic (the latter species is sister to Bolla boliviensis (Bell, 1937) (type locality Bolivia: Cochabamba) in the Z chromosome tree) and are genetically differentiated at the species level (Fig. 10); e.g., their COI barcodes differ by 3.3% (22 bp). Therefore, we propose that Bolla tornea Evans, 1953, new status, is a species distinct from Bolla giselus (Mabille, 1883), which becomes monotypic.

Bolla (Sebia) zuela Grishin, new species

https://zoobank.org/FEBB3B68-1DA0-42B8-84BD-95C531F20A0D

(Fig. 10 part, 330–331, 1041–1043)

Definition and diagnosis.

Genomic analysis of specimens from Venezuela initially identified as Bolla boliviensis (Bell, 1937) (type locality Bolivia: Cochabamba) reveals that they are not monophyletic with it and genetically differentiated from it and others at the species level (Fig. 10); e.g., their COI barcodes differ by 4.0% (26 bp) from B. boliviensis and by 3.0% (20 bp) from Bolla tornea Evans, 1953, new status (type locality Colombia: Cauca, Torne), and therefore these specimens represent a new species. This new species keys to “B. tetra boliviensis” (E.31.17(c)) in Evans (1953) and was included by him in this species, but differs from it and other relatives by males having a costal fold, three prominent subapical hyaline spots with the posterior being the largest; the harpe with a larger and rounder basal process separated from the middle portion by a more prominent and rounder concavity; and the harpe terminally narrower towards the inwardly turning section of the distal margin with smaller serrations. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly806.3.2:A78T, aly2012.31.18:G39A, aly2202.28.1:T657G, aly2790.2.5:A887C, aly2790.2.5:T900C; and COI barcode: A82G, T97C, A208T, A550G, A628T.

Barcode sequence of the holotype.

Sample NVG-22111G02, GenBank PV972507, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCAGGTATAATTGGAACTTCATTAAGTATTCTTATTCGTTCTGAATTAGGTATGCCAGGATCTTTAATCGGAGATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGAAATTGGTTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGATTATTACCTCCATCCCTAATACTATTAATTTCAAGTAGTATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCACCAAGGTTCATCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCTCTTTTATTACTTCTTTCTTTGCCAGTATTAGCAGGAGCTATTACAATACTCCTAACAGATCGTAATTTAAATACATCATTTTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 330–331 (genitalia Fig. 1041–1043), bears the following five rectangular labels (1^st handwritten, others printed), four white: [ Merida | Hahnel ], [ DNA sample ID: | NVG-22111G02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23078F03 | c/o Nick V. Grishin ], [ genitalia | NVG240912–05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Bolla (Sebia) | zuela Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG21015E12 Venezuela, old [ca. 1900], Holland collection, genitalia H-1612 H. A. Freeman [CMNH].

Type locality.

Venezuela: Mérida.

Etymology.

The word ‘Venezuela’ is of Spanish origin. It is a compound word derived from the Spanish words “ven” (from the verb “venir,” meaning “to come”) and “zuela” (a suffix meaning “little” or “small”). Therefore, “Venezuela” can be translated to mean “Little Venice” or “Little Come.” The name was given by the Italian explorer Amerigo Vespucci, who, upon seeing stilt houses built over the water in the Lake Maracaibo area, was reminded of the Italian city of Venice. This led him to name the region “Veneziola,” and over time, it evolved into the current form, “Venezuela.” The name of this small species refers to the country with its type locality and is treated as a feminine noun in apposition.

Distribution.

Venezuela.

Bolla (Sebia) guatemalensis Grishin, new species

https://zoobank.org/017C8E92-DC11-4912-9589-7C9211D1732D

(Fig. 10 part, 332–333, 1044–1045)

Definition and diagnosis.

Genomic analysis of specimens from Guatemala initially identified as Bolla boliviensis (Bell, 1937) (type locality Bolivia: Cochabamba) or Bolla oriza Evans, 1953, confirmed status (type locality in Mexico: Veracruz) reveals that they are not monophyletic with the former species and form a clade sister to both B. oriza and Bolla guerra Evans, 1953, confirmed status (type locality in Mexico: Guerrero) that is genetically differentiated from them at the species level (Fig. 10); e.g., their COI barcodes differ by 2.7% (18 bp) from both B. oriza and B. guerra, and therefore these specimens represent a new species. This new species keys to B. tetra boliviensis (E.31.17(c)) in Evans (1953) and was included by him in this species, but differs from it and other relatives by males having the costal fold, three prominent subapical hyaline spots, with the middle spot being the smallest; the harpe with a smaller and terminally more pointed basal process separated from the middle portion by a shallow concavity partly angled in the middle; and the harpe terminally less narrow towards the inwardly turning section of the distal margin with larger serrations: in the lateral view, the distal margin is about twice as long as the harpe width in the middle. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly315.8.1:C46A, aly315.8.1:C47A, aly1838.58.4:A1097G, aly50.2.1:G450C, aly50.2.1:C456T; and COI barcode: T25C, T346C, T373C, T460T, T557C.

Barcode sequence of the holotype.

Sample NVG-22111G03, GenBank PV972508, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGATCAGGTATAATTGGAACTTCATTAAGTATTCTTATTCGTTCTGAATTAGGTATACCCGGATCTTTAATTGGAGATGATCAAATTTACAATACAATTGTAACTGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGTGGATTCGGAAATTGGTTAGTACCCCTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGATTATTACCCCCATCCCTTATATTATTAATTTCAAGTAGTGTTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCACCAAGGCTCATCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATCACAACTATTATTAATATACGAATTAATAATCTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTCTTTTATTACTTCTTTCTTTACCAGTACTAGCAGGAGCTATTACAATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 332–333 (genitalia Fig. 1044–1045), bears the following five printed rectangular labels, four white: [ Guat. | Conr. ], [ DNA sample ID: | NVG-22111G03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23078F01 | c/o Nick V. Grishin ], [ genitalia | NVG240912–03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Bolla (Sebia) | guatemalensis Grishin ], collected in Guatemala by Leopold Conradt around the beginning of the 20^th century. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ from Guatemala: NVG-21117D01 the same data as the holotype and NVG-18049G06, USNMENT 01466656 Volcan Santa Maria, old [ca. 1900], Schaus and Barnes collection [USNM].

Type locality.

Guatemala.

Etymology.

The name is derived from the country of the type locality and is a feminine adjective.

Distribution.

Guatemala.

Staphylus incanus Bell, 1932 is a junior subjective synonym of Bolla (Stolla) chlorocephala Latreille, [1824]

Evans (1953) could not confidently identify Staphylus incanus Bell, 1932 (type locality in Brazil: São Paulo), placing it among Staphylus Godman and Salvin, 1896 (type species Helias ascalaphus Staudinger, 1875) with a statement “Identity uncertain” and thus causing a lasting confusion. Genomic analysis of the S. incanus holotype places it among specimens of Bolla (Stolla) chlorocephala Latreille, [1824] (type locality in Brazil: Rio de Janeiro) (Fig. 10). Therefore, taking into account phenotypic similarities and provenance, we propose that Staphylus incanus Bell, 1932 is a new junior subjective synonym of Bolla (Stolla) chlorocephala Latreille, [1824].

Bolla (Stolla) bolla Grishin, new species

https://zoobank.org/7B97382A-283E-48A8-8BF8-736A22E9841C

(Fig. 10 part, 334–335)

Definition and diagnosis.

Genomic analysis of a specimen from Bolivia places it as a distant sister to Bolla (Stolla) astra (R. Williams and E. Bell, 1940) (type locality in Peru: Achinamiza, holotype sequenced as NVG-15097C08) that is genetically differentiated at the species level (Fig. 10); e.g., their COI barcodes differ by 7% (46 bp), and therefore this specimen represents a new species. This new species keys to “Staphylus astra” (E.32.32) in Evans (1953) and was probably placed by him in this species, but differs from it and other relatives by the following combination of characters: green head and thorax above; differs from Bolla (Stolla) chlora (Evans, 1953) (type locality in Bolivia) and S. astra by having the costal fold and lacking white spots in the discal area of the forewing; from Bolla (Stolla) chlorocephala Latreille, [1824] (type locality in Brazil: Rio de Janeiro) by the lack of whitish overscaling at the hindwing tornus beneath (but some yellowish overscaling there); and from B. chlorocephala, Bolla (Stolla) esmeraldus (L. Miller, 1966) (type locality in Costa Rica), Bolla (Stolla) tridentis (Steinhauser, 1989) (type locality in Colombia), and Bolla (Stolla) balsa (E. Bell, 1937) (type locality Peru: Balsapuerto) by the presence of 2–3 subapical white spots. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly103.42.1:A123G, aly159.7.2:T112A, aly159.7.2:T121C, aly4265.7.1:A940G, aly4265.7.1:A950G, aly1060.6.1:C450C (not T), aly1060.6.1:T1092T (not C), aly4893.5.10:T102T (not C), aly216.30.2:T133T (not G), aly577.18.1:G36G (not T); and COI barcode: T10T, A88T, T346A, T361C, T490C, A559G.

Barcode sequence of the holotype.

Sample NVG-22018E03, GenBank PV972509, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCAGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCTCTTATACTTTTAATCTCAAGAAGTATCGTAGAAAATGGGGCAGGTACTGGATGAACTGTTTATCCCCCACTTTCAGCTAATATCGCTCATCAAGGTTCATCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTCTAGGGGCAATTAATTTCATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGACCAAATACCTTTATTTGTATGAGCTGTAGGAATTACTGCATTACTTTTACTATTATCTTTACCTGTATTGGCAGGAGCTATTACTATACTTTTAACTGATCGAAACCTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGTGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 334–335, bears the following three printed (text in italics handwritten) rectangular labels, two white: [ Staatssamml. | München | BOLIVIA | Yungas de Palmar | 1250 m | 19.X.1953. | leg.W.Forster ] (the first two lines are placed along the left margin of the label and read from bottom to top), [ DNA sample ID: | NVG-22018E03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Bolla (Stolla) | bolla Grishin ].

Type locality.

Bolivia: Cochabamba Department, Carrasco Province, Yungas de Palmar, elevation 1250 m.

Etymology.

The name is derived from the country of the type locality, Bol[ivia]+la, to echo the genus name. The name is treated as a feminine noun in apposition.

Distribution.

Currently known only from the holotype collected on the eastern slopes of the Andes of central Bolivia.

Bolla (Stolla) manu Grishin, new species

https://zoobank.org/AD10C24A-8A17-4C1E-8EB2-78F76C4F2046

(Fig. 10 part, 336–337, 1046–1047)

Definition and diagnosis.

Genomic analysis of a specimen from Peru places it as a relative of Bolla (Stolla) chlorocephala Latreille, [1824] (type locality in Brazil: Rio de Janeiro) that is genetically differentiated from others at the species level (Fig. 10); e.g., their COI barcodes differ by 4.6% (30 bp) from B. chlorocephala, 4.7% (31 bp) from Bolla (Stolla) tridentis (type locality in Colombia: Tolima), and 5.2% (34 bp) from Bolla (Stolla) esmeraldus (L. Miller, 1966) (type locality in Costa Rica), and therefore it represents a new species. This new species keys to “Staphylus chlorocephala” (E.32.1) in Evans (1953), but differs from it and other relatives by a broader and longer harpe that is not strongly expanded terminally and its dorsal margin is level with the ampulla, which is rounded, broader and separated from the costa by a shallow concavity, and the valva (without the harpe) is approximately diamond-shaped. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1931.5.6:A1257T, aly1656.18.2:G522A, aly2954.5.2:C147T, aly2954.5.2:G1434A, aly594.27.2:C60G, aly164.11.11:C48C (not T), aly1295.9.3:A81A (not G), aly155.2.2:C42C (not T), aly594.10.1:C823C (not T), aly594.10.1:T858T (not G); and COI barcode: A40G, T97C, A166G, A302G, A433T, G506G.

Barcode sequence of the holotype.

Sample NVG-18058B01, GenBank PV972510, 658 base pairs:

AACCTTATATTTTATTTTTGGTATTTGATCAGGTATAGTGGGAACTTCTTTAAGTATTCTTATTCGTTCTGAATTAGGAACTCCTGGATCTTTAATCGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCCATTATAATTGGAGGATTCGGAAATTGGTTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATGAGATTTTGATTATTACCTCCTTCTCTTATACTTTTAATCTCTAGAAGTGTTGTAGAAAATGGGGCAGGAACAGGATGAACCGTTTACCCCCCTCTTTCAGCTAATATTGCCCACCAAGGCTCATCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGTGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACCGCATTATTATTATTATTATCCCTTCCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCTGCTGGAGGAGGAGACCCTATCCTATACCAACATCTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 336–337 (genitalia Fig. 1046–1047), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU: Madre de Dios | Manu, Pakitza, 340m | 11°55’48”S 71°15’18”W | 3 May 1991 | leg. D. J. Harvey ], [ genitalia Vial | Number H-1687 | H. A. Freeman ], [ Staphylus | esmeraldus ♂ | L. Miller | det. H.A. Freeman ], [ DNA sample ID: | NVG-18058B01 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466675 ], and one red [ HOLOTYPE ♂ | Bolla (Stolla) | manu Grishin ].

Type locality.

Peru: Madre de Dios Region, Manu National Park, Pakitza, elevation 340 m, GPS −11.930, −71.255.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southeastern Peru.

Staphylus (Vulga) maria Grishin, new species

https://zoobank.org/78FF4642-D5EB-4293-92FA-ABADE6D7A280

(Fig. 10 part, 338–339, 1048–1049)

Definition and diagnosis.

Genomic analysis of a specimen from Tingo Maria in Peru identified by H. A. Freeman as Staphylus tingo Steinhauser, 1989 (type locality in Peru: Huanuco) places it away from the holotype of S. tingo (NVG-15038D07) and instead as sister to Staphylus (Vulga) putumayo (Bell, 1937) (type locality in Peru: Putumayo River, holotype sequenced as NVG-18025B03), but genetically differentiated from it at the species level (Fig. 10); e.g., their COI barcodes differ by 1.8% (12 bp), and therefore this specimen represents a new species. This new species keys to “S. putumayo putumayo” (E.32.5(a)) in Evans (1953), but differs from it and other relatives by a rounder and longer ampulla, expanded dorsad of the harpe and protruding distad of its end, armed with about a dozen spines directed posteroventrad; and the harpe has a shorter base along the dorsal side and a longer free section that is rounded and evenly convex ventrally. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3625.4.4:T45C, aly1222.14.32:C144T, aly274.10.5:C69T, aly274.10.5:A96G, aly451.9.2:A45G, aly103.37.1:T312T (not C), aly3850.3.17:C36C (not T), aly168.1.9:G108G (not A), aly537.5.5:A102A (not T), aly1139.26.41:G147G (not A); and COI barcode: A34G, A73G, T247C, A382A, A508G, T571C.

Barcode sequence of the holotype.

Sample NVG-18059A06, GenBank PV972511, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGGATAGTAGGAACTTCTTTAAGTATTCTTATTCGATCTGAGTTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGACTAGTACCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAACAATATAAGTTTTTGATTATTACCCCCATCTTTAATACTCCTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCATCTAATATTGCTCATCAAGGCTCATCTGTAGATTTAGCTATTTTTTCTCTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGACCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTACTTTTACTCTTATCTTTACCAGTATTAGCTGGAGCTATCACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 338–339 (genitalia Fig. 1048–1049), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU–Huanuco | Tingo Maria 800m | 23 June ‘82 | S. S. Nicolay ], [ genitalia | ♂ slide/vial # | H756 |Prep. S.S. Nicolay ], [ Staphylus | tingo ♂ | Steinhauser | det. H.A. Freeman ], [ DNA sample ID: | NVG-18059A06 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466764 ], and one red [ HOLOTYPE ♂ | Staphylus (Vulga) | maria Grishin ].

Type locality.

Peru: Huánuco Region, Tingo María, elevation 800 m.

Etymology.

The name is derived from the type locality in Tingo María and is a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of central Peru.

Staphylus (Vulga) cuzos Grishin, new species

https://zoobank.org/7DF9EA50-02F8-45C8-8647-5D25A11604B5

(Fig. 10 part, 340–341, 1050–1051)

Definition and diagnosis.

Genomic analysis of a female from Cuzco, Peru, places it as a close relative of Staphylus (Vulga) saxos Evans, 1953 (type locality Colombia: Cali) that is genetically differentiated from it at the species level (Fig. 10); e.g., their COI barcodes differ by 1.4% (9 bp), and therefore this female represents a new species. This new species keys to “S. saxos saxos” (E.32.30(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: whitish cheeks and palpi beneath; broader and more angular wings with a less rounded apex; larger subapical hyaline spots in a curve (the posterior spot is offset distad from others); besides these three, there is only one other (very small) hyaline forewing spot at the base of the cell M₃-CuA₂; a more weakly developed and narrower submarginal paler-brown band on the dorsal forewing; the lamella postvaginalis with the deep central notch and slightly convex on both sides; the lamella antevaginalis strongly sclerotized, its central section is nearly square in lateral view, with serrated margins, expanded on the sides into two terminally rounded lateral plates. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2532.10.1:A1881G, aly3721.1.24:C189T, aly3721.1.24:C117A, aly275211.6.8:G72A, aly275211.6.8:A90G, aly2379.17.1:G210G (not A), aly412.4.20:T61T (not C), aly1080.27.6:A743A (not G), aly1080.27.6:A785A (not C), aly378.41.1:C663C (not T); and COI barcode: A31G, T61T, A160G, T421C, T616T, however, the barcode may not always be able to identify this species due to the mitochondrial genome similarity with the new species described next.

Barcode sequence of the holotype.

Sample NVG-18059A05, GenBank PV972512, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCGGGAATAGTAGGAACTTCCTTAAGTATTCTTATTCGATCAGAATTAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACCGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCCCTTATATTAGGAGCCCCTGATATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGATTATTACCACCATCTTTAATACTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCATCTAATATTGCCCACCAAGGCTCTTCTGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCCTCCATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTCTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 340–341 (genitalia Fig. 1050–1051), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU:Cuzco 1050m | Quitacalzone | Cosnipata Road 1621 | 7.ii.2011 Kinyon ], [ DNA sample ID: | NVG-18059A05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035A05 | c/o Nick V. Grishin ], [ genitalia | NVG241118–69 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466763 ], and one red [ HOLOTYPE ♀ | Staphylus (Vulga) | cuzos Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Cuzco Department, Cosñipata Road, Quitacalzone, elevation 1050 m.

Etymology.

The name is derived from the region of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southern Peru.

Staphylus (Vulga) metos Grishin, new species

https://zoobank.org/568D04A9-85B8-4516-82C4-1AADD3B72D50

(Fig. 10 part, 342–343, 1052–1053)

Definition and diagnosis.

Genomic analysis of specimens from eastern Colombia and Ecuador places them as a clade sister to Staphylus (Vulga) saxos Evans, 1953 (type locality Colombia: Cali) that is genetically differentiated from it at the species level (Fig. 10); e.g., their COI barcodes differ by 1.5% (10 bp), and therefore these specimens represent a new species. This new species keys to “S. saxos saxos” (E.32.30(a)) in Evans (1953), but differs from it and other relatives by whitish cheeks and palpi beneath; not as broad and more rounded wings with a somewhat angled forewing apex; three small subapical hyaline spots, the middle one being tiny and shifted strongly basad from the line formed by the larger two; besides these three, either none (in the holotype), or several small forewing hyaline spots; a more strongly developed and broader submarginal paler-brown band on the dorsal forewing; the ampulla is prominently expanded, with nearly parallel dorsal and ventral margins in lateral view, terminally rounded and armed with more than a dozen spines along its upper two-thirds, and nearly reaches the end of the harpe, which is merged with the ampulla along its dorsal margin and ends as a terminally rounded triangle with the dorsoposterior and ventral margins nearly straight. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly173.67.5:C177T, aly666.25.1:T1590G, aly666.25.1:T2532C, aly86.4.4:T168C, aly671.37.5:T213G; and COI barcode: A31G, T61C, A160G, T421C, T616T, however, the barcode may not always be able to identify this species due to the mitochondrial genome similarity with the new species described above.

Barcode sequence of the holotype.

Sample NVG-18058D03, GenBank PV972513, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCGGGAATAGTAGGAACTTCCTTAAGTATTCTCATTCGATCAGAATTAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACCGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCCCTTATATTAGGAGCCCCTGATATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGATTATTACCACCATCTTTAATACTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCATCTAATATTGCCCACCAAGGCTCTTCTGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCCTCCATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTCTATTTGTTTGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 342–343 (genitalia Fig. 1052–1053), bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [ Rio Negro, 2400’ | Meta, Colombia | 15 Jan.’71 | S.S.Nicolay ], [ Staphylus | lizeri ♂ | Det. Hay | S.S. Nicolay ], [ Staphylus | lizeri ♂ | lizeri (Hayward) | det. H.A. Freeman ], [ DNA sample ID: | NVG-18058D03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG22035A04 | c/o Nick V. Grishin ], [ genitalia | NVG241118–70 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466701 ], and one red [ HOLOTYPE ♂ | Staphylus (Vulga) | metos Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂: NVG-18059A01, USNMENT 01466759 the same data as the holotype but collected on 7-Feb1969, genitalia H439 S. S. Nicolay and NVG-18059A02, USNMENT 01466760 Ecuador, Limoncocha, Río Napo, 240 m, 10-Feb-1971, S. S. and S. Nicolay leg., genitalia H441 S. S. Nicolay [USNM].

Type locality.

Colombia: Meta Department, Río Negro, elevation 2400’.

Etymology.

The name is derived from the department of the type locality and is treated as a noun in apposition.

Distribution.

Eastern Colombia and Ecuador.

Neotype designation for Carcharodus mazans Reakirt, [1867]

Carcharodus mazans Reakirt, [1867], currently a valid species of Staphylus Godman and Salvin, 1896 (type species Helias ascalaphus Staudinger, 1875), has been described from an unstated number of specimens from Mexico, near Veracruz, in the collection of W. H. Edwards (Reakirt [1867]). The description is short and is cited here: “Upper surface purplish brown, strewn with grayish white points; three transverse dark brown bands extending from the primaries’ costa to the abdominal margin of the secondaries; the first is at two-fifths the length of the wings: the second and broadest at four fifths, and the third is terminal. Interior to the second are three small white spots; two, close together, are near the costa, the other slightly below the middle; fringe brown; wings strongly scalloped and indented; expanse 1 inch. Underneath brown; the markings reproduced very indistinctly; body and antennæ brown” (Reakirt [1867]). To better understand the taxonomic identity of this species, we searched for its syntypes in all collections listed in the Acknowledgments section. A particular focus was on the CMNH collection, where specimens from the Edwards collection are preserved. No syntypes were found and we assumed that they were lost.

Not finding syntypes, we proceeded with the neotype designation. There is an exceptional need for a neotype of C. mazans to define this taxon objectively and ensure taxonomic stability in the application of this name, because the information available about this taxon is consistent with several species of Staphylus and because cryptic species are present among its relatives. For the neotype, we selected a specimen that matches the original description best in all aspects, comes from an old specimen stock used in original descriptions in the 2^nd half of the 19^th century, and agrees with the current usage of this name. Hereby, N.V.G. designates a female from Veracruz, Mexico, in CMNH, shown in Fig. 344–345 (DNA sample NVG-15096H04) as the neotype of Carcharodus mazans Reakirt, [1867]. This specimen was also considered by Holland (1931) as a paralectotype (non-conspecific) of Staphylus (Staphylus) ascalaphus (Staudinger, 1875) (type locality in Panama: Panama) and was illustrated on Pl. L, Fig. 34. A possible confusion between these two similar-in-appearance species (S. mazans and S. ascalaphus) necessitates neotype designation. Furthermore, syntypes of C. mazans were likely collected shortly before the original description in 1867, and the neotype, being a syntype of S. ascalaphus, was collected before its description in 1876. These two dates are only a few years apart, both specimens were collected “near Veracruz” and it is possible that the neotype came from the same stock of specimens as syntypes.

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of C. mazans, which is necessary because females of several species agree with the original description (including a new one), and these species can be identified by genitalia or DNA only; 75.3.2. The characters to differentiate this taxon from others are stated in the original description and given above, most importantly, brown wings with three transverse darker bands, three small white spots of the forewing just basad of the middle band: two near the apex and one near the middle of the wing, and scalloped and indented wings; 75.3.3. The neotype specimen is a female bearing the following seven rectangular labels (4^th handwritten, others printed with the handwritten text shown in italic): six white [ Atoyac | Vera Cruz. | May. H.H.S. ], [ B.C.A.Lep. Rhop. | Staphylus | ascalaphus, | Staud. ], [ Butterfly Book | Pl. L Fig. 34 ], [ Pholisora | ascalaphus ♀ | Staudinger ], [ Staphylus | mazans ♀ | (Reakirt) | det. H.A. Freeman ], [ DNA sample ID: | NVG-15096H04 | c/o Nick V. Grishin ], and one red, no text on this label, and shown in Fig. 344–345. The neotype was collected by H. H. Smith; 75.3.4. We failed to find syntypes of C. mazans among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list), in particular, searching the Edwards collection specimens in CMNH, and no syntypes have been reported in literature with statements that they were not found (Miller and Brown 1981), and therefore we believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. mazans in all characters, as evidenced by comparing the neotype shown in Fig. 344–345 with the characters of this taxon listed above; 75.3.6. The neotype is from Mexico: Veracruz, Atoyac, which becomes the new type locality, and the original type locality is given as “Mexico, (near Vera Cruz).” According to Selander and Vaurie (1962), Atoyac is a “Small town on the railroad between Córdoba and the city of Veracruz about 16 km. east of Córdoba; 1314 feet; 18° 54’, 96° 46’”W, which is near Veracruz; 75.3.7. The neotype is in the collection of the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH). The COI barcode sequence of the neotype, sample NVG-15096H04, GenBank PV972514, 658 base pairs, is:

AACTTTATATTTTATCTTTGGTATTTGATCTGGAATAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCTCTTATACTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATACTTTTAATTTCAAGTAGAATCGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCCCCCCTTTCAGCTAACATTGCCCATCAAGGTTCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCCTTTGATCAAATACCCTTATTTGTTTGAGCAGTTGGAATTACAGCATTATTATTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTC

Staphylus (Staphylus) panamicus Grishin, new species

https://zoobank.org/0379BC90-F3EF-4191-BBFF-ECDCF79DA3D8

(Fig. 10 part, 346–347, 1054–1055)

Definition and diagnosis.

Genomic analysis of a specimen from Panama identified by H. A. Freeman as Staphylus mazans (Reakirt, [1867]) (type locality Mexico: Veracruz, Atoyac, neotype sequenced as NVG-15096H04) is not monophyletic with it and instead forms a nuclear genome lineage sister to several other species, such as Staphylus (Staphylus) perforata (Möschler, 1878) (type locality in Colombia), Staphylus (Staphylus) lenis Steinhauser, 1989 (type locality in Trinidad), and Staphylus (Staphylus) rotundalus Grishin, 2023 (type locality in Ecuador), and therefore this specimen represents a new species (Fig. 10). This new species keys to “Staphylus mazans mazans” (E.32.20(c)) in Evans (1953), but differs from it and other relatives by the presence of two small hyaline spots in the forewing discal cell; the lack of a bulging process on the valva near the ampulla (there is a small bump instead); and rather uniformly sized bristles covering the dorsal two-thirds of the outer surface of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly274.26.3:C135T, aly2659.9.4:T159A, aly2637.1.3:T612C, aly274.20.27:C64T, aly423.23.6:G48A, aly1735.10.1:A81A (not G), aly525.71.1:T375T (not A), aly1585.5.2:C1227C (not T), aly2016.4.5:G87G (not A), aly2692.7.10:T60T (not C); and COI barcode: T415A, A511A, A520G, T533C, T646C however, the barcode may not always be able to identify this species due to the mitochondrial genome similarity with several other species.

Barcode sequence of the holotype.

Sample NVG-18058F12, GenBank PV972515, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCTCTTATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATACTTTTAATTTCAAGTAGAATCGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCCCCCCTTTCAGCTAACATTGCCCATCAAGGTTCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCCTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGGATTACAGCATTACTATTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTC

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 346–347 (genitalia Fig. 1054–1055), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA:SAN BLAS | Rio Armila | 8°40’N 77°25’W | 20.XII.1981 | leg. G.B.Small ], [ genitalia Vial | Number H-2212 | H. A. Freeman ], [ Staphylus | mazans ♂ | (Reakirt) | det. H.A. Freeman ], [ DNA sample ID: | NVG-18058F12 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466734 ], and one red [ HOLOTYPE ♂ | Staphylus (Staphylus) | panamicus Grishin ].

Type locality.

Panama: Guna Yala (formerly San Blas), Río de Armila, approx. GPS 8.6667, −77.4167.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected on the Atlantic slopes of Panama near the border with Colombia.

Neotype designation for Nisoniades mejicanus Reakirt, [1867]

Nisoniades mejicanus Reakirt, [1867], currently a valid species of Pholisora Scudder, 1872 (type species Hesperia catullus Fabricius, 1793), has been described from an unstated number of specimens from Mexico, near Veracruz, in the collection of W. H. Edwards (Reakirt [1867]). The description is short and is cited here: “Upper side brownish black, a submarginal row of pale brownish spots on both wings; on the primaries an interior tortuous row of nine spots, of which the first five are pure white and well defined, the others are sometimes obsolete; a white discal spot. Underneath paler, glossed with purple at the base of the primaries; their apex and the secondaries shining olivaceous brown; a row of five white spots runs from the costa of the primaries, and a white discal spot; the veins of the secondaries are prominently outlined in dark velvety brown; expanse 1 inch. Fringe brown. Body and antennæ as in N. Catullus” (Reakirt [1867]).

To better understand the taxonomic identity of this species, we searched for its syntypes in all collections listed in the Acknowledgments section. A particular focus was on the CMNH collection, where specimens from the Edwards collection are preserved. No syntypes were found and we assumed that they were lost. We found an old specimen from “Mex.” (no detailed locality) of Pholisora in FMNH that partly agreed with the original description of N. mejicanus, but it was from the Strecker collections and not from the Edwards collection, it was smaller than “1 inch” in expanse, and lacked “a submarginal row of pale brownish spots on both wings.” Therefore, this specimen is not a syntype. Not finding syntypes, we proceeded with the neotype designation. There is an exceptional need for a neotype of N. mejicanus to define this taxon objectively and ensure taxonomic stability in the application of this name, because the information available about this taxon is consistent with a cryptic new species present among its relatives. Hereby, N.V.G. designates a female from Presidio, Veracruz, Mexico, in MGCL, shown in Fig. 348–349 (DNA sample NVG-23054E11) as the neotype of Nisoniades mejicanus Reakirt, [1867].

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of N. mejicanus, which is necessary due to the presence of cryptic species; 75.3.2. The characters to differentiate this taxon from others are stated in the original description and given above, most importantly, brownish-black wings, forewings with a postdiscal irregular row starting from costa with five distinct white spots followed by three to four less distinct spots, a white discal spot, a submarginal row of pale-brownish indistinct spots on both wings above, and with purple gloss beneath, outlined with dark-brown veins on the hindwing; 75.3.3. The neotype specimen is a female bearing the following four rectangular printed (handwritten text shown in italics) white labels: [ T. Escalante | PRESIDIO | VER. | IV-38 ], [ A. C. Allyn | Acc. 1973–48 ], [ MGCL/FLMNH | Specimen no. | 26627 ], [ DNA sample ID: | NVG-23054E11 | c/o Nick V. Grishin ], and shown in Fig. 348–349; 75.3.4. We failed to find syntypes of N. mejicanus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list), in particular, searching the Edwards collection specimens in CMNH, and no syntypes have been reported in literature; therefore, we believe that they were lost; 75.3.5. The neotype closely agrees with the original description of N. mejicanus in all characters, as evidenced by comparing the neotype shown in Fig. 348–349 with the characters of this taxon listed above; 75.3.6. The neotype is from Mexico: Veracruz, Presidio, which becomes the new type locality, and the original type locality is given as “Mexico, (near Vera Cruz)”; 75.3.7. The neotype is in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL). The COI barcode sequence of the neotype, sample NVG-23054E11, GenBank PV972516, 658 base pairs, is:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTATCCTTATTCGTTCTGAATTAGGAACACCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGACTTTTACCTCCTTCACTTATACTATTAATTTCTAGTAGTATTGTAGAAAATGGTGCAGGTACTGGATGAACTGTATATCCCCCACTTTCAGCTAATATTGCTCATCAAGGTTCATCTGTAGATTTAGCAATTTTTTCACTTCATCTTGCTGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTCTATTACTATCTTTACCGGTATTAGCGGGTGCTATTACTATATTATTAACTGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGGGGAGACCCTATTTTATATCAACATTTATTT

Pholisora suroesta Grishin, new species

https://zoobank.org/23B7ECD8-843E-4C2E-96DD-59D9D1FFDD21

(Fig. 10 part, 350–351, 1056–1061)

Definition and diagnosis.

Genomic analysis of specimens identified as Pholisora mejicanus Reakirt, [1867] (type locality in Mexico: Veracruz, neotype sequenced as NVG-23054E11) reveals that they partition into two clades genetically differentiated at the species level (Fig. 10); e.g., their COI barcodes differ by 1.1% (7 bp). The clade with the neotype represents P. mejicanus and the second clade, containing specimens from southwestern Mexico, represents a new species. This new species keys to P. mejicanus (G.4.2) in Evans (1953), but differs from it and other relatives by a larger harpe that nearly reaches the dorsal margin of the valva, where the harpe narrows to a single sharp tooth; the harpe is more acute (while being rounded) at the distal end and has an overall shape of an equilateral triangle rather than a right triangle as in P. mejicanus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly322.9.2:C51T, aly527.6.11:G81A, aly318.3.19:C111T, aly318.3.19:A131T, aly8640.3.7:C279T; and COI barcode: A43A, T220T, T250T, T271C, T340C, T418T, A553A.

Barcode sequence of the holotype.

Sample NVG-23108E09, GenBank PV972517, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTATCCTTATTCGTTCTGAATTAGGAACACCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCACTTATACTATTAATTTCTAGTAGTATTGTAGAAAACGGTGCAGGTACTGGATGAACTGTATACCCCCCACTTTCAGCTAATATTGCTCATCAAGGTTCATCTGTAGATTTAGCAATTTTTTCACTTCATCTTGCTGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTCTATTATTATCTTTACCAGTATTAGCGGGTGCTATTACTATATTATTAACTGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGGGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 350–351 (genitalia Fig. 1056–1058), bears the following four rectangular labels (1^st handwritten, others printed), three white: [ MEX:Oax:5mi.N. | Oaxaca- 1 Aug.1990 | John Kemner-el.6000’ ], [ DNA sample ID: | NVG-23108E09 | c/o Nick V. Grishin ], [ genitalia | NVG241118–71 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Pholisora | suroesta Grishin ]. Paratypes: 8♂♂ and 5♀♀ from Mexico [MGCL except as indicated]: 1♀ NVG-22111C08 no other data, old specimen, C. A. Purpus leg. [MFNB]; Michoacán: 1♂ NVG-23054F08 Mpio Urapan, Santa Rosa, 1620 m, 7-Jun-1990, L. Gonzales-Cota leg. and 1♂ NVG-22088C05 Tzintzuntzan, 2150 m, 7-Aug-1973, L. D. and J. Y. Miller leg. [MGCL]; 1♂ NVG-23054F02 Guerrero, 2 mi W of Colotlipa, 1020 m, 27-Aug-1967, Miller-Pine leg.; 1♀ NVG-23054F01 Morelos, 19 mi S of Cuernavaca, 1100 m, 24-Aug-1967, Miller-Pine leg.; Puebla: 1♂ NVG-23108E10 Patla, 1800’, 5-Apr-1990, J. Kemner leg., genitalia NVG241118–72 (Fig. 1059–1061) [CMNH]; 1♀ NVG-24083F02, Atlixco, km 161, 11-Aug-1962, G. T. Austin leg., genitalia GTA-13646; and 1♂ NVG-23054F05 20 km N of Acatlán, 11-Aug-1971, S. and L. Steinhauser leg; and Oaxaca, J. Kemner leg: the same locality as the holotype: 1♂ NVG-22087H04 25-Apr-1988, genitalia SRS-4965; 1♀ NVG-20062C12 17-May-1988 [TMMC]; 1♀ NVG-23054E12 16-Aug-1988; and 1♂ NVG-23054F03 (leg, DNA sequenced), NVG-24064C08 (abdomen, DNA stored), 6-Jul-1989, genitalia NVG241111–04 and 1♂ NVG-23108E12 Hwy125 Putla–Tlaxiaco nr. Itunyoso exit, >7800’, 28-Jul-1990 [CMNH].

Type locality.

Mexico: Oaxaca, Tlalixtac, Hwy 175 ~5 mi north of Oaxaca, elevation ~6000’.

Etymology.

The name is formed from the Spanish word suroeste, which means southwestern and reflects the distribution of this species in Mexico. The name is treated as a feminine noun in apposition.

Distribution.

Southwestern Mexico.

Comment.

For comparison, we illustrate genitalia of three P. mejicanus males from different localities: NVG-23108E11 from Mexico: Nuevo Leon, Las Juntas, 6500’, 9-Jul-1990, John Kemner leg., genitalia NVG241118–73 (Fig. 1062–1064) [CMNH]; NVG-24105G11 from USA: Colorado, El Paso Co., S of Crystola, 7-Jul-1962, C. J. Durden leg., genitalia NVG250720–59 (Fig. 1065–1066) [TMMC]; and NVG-25027G09 from USA: New Mexico, Bernalillo Co., E. slope of Sandia Mountains, Dry Sink, 8100’, 29-Jul-1968, J. Lane leg., genitalia No. 6267 by Kilian Roever (Fig. 1067–1069) [CSUC].

Subtribe Carcharodina Verity, 1940

Lectotype designation for Theagenes stator Godman, 1899

Theagenes stator Godman, 1899 was described from a number of syntypes from many localities: Mexico (Guerrero, Veracruz, Tabasco, and Yucatán), Guatemala, Nicaragua, Panama, and Peru (Godman 1899). A male from Mexico: Veracruz, Atoyac was labeled by J. M. Burns as the lectotype of T. stator. However, this designation has not been published, and we publish it for him. To stabilize nomenclature, clarify the type locality, and define the name T. stator objectively, J. M. Burns hereby designates a syntype in the BMNH collection, the male that bears the following eleven labels (first two and the last round, others rectangular; first two with a red circle on one side, last yellow, others white; last handwritten, others printed with handwritten text shown in italics): ( Type ), ( Type ) and on the other side of this label handwritten ( H | 849 ), [ Atoyac, | Vera Cruz. | May. H.H.S. ], [ ♂ ], [ B.C.A.Lep.Rhop. | Theagenes | stator, | G.&S. ], [ Godman-Salvin | Coll. 1912.—23. ], [ genitalia NO. | 1412 | J.M.Burns 1984 ], [ B.M.(N.H.) | Rhopalocera | No. | Vial 0004 ], [ LECTOTYPE | Theagenes stator | Godman + Salvin | by J. M. Burns ], [ {QR Code} | BMNH(E) 1669580 ], ( 272 ) as the lectotype of Theagenes stator Godman, 1899. The lectotype was collected by Herbert Huntington Smith. The lectotype has its right antenna farther from the forewing than the left antenna and a conspicuous pinhole near the upper end of the right forewing discal cell in the middle. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of T. stator becomes Mexico, Veracruz, Atoyac, elevation 1314 ft, approx. GPS 18.900, −96.767 (Selander and Vaurie 1962).

Noctuana mimica Grishin, new species

https://zoobank.org/11C50FD1-285D-4CAC-B805-09D8040F5F47

(Fig. 9 part, 352–353, 1070–1074)

Definition and diagnosis.

Genomic analysis reveals that specimens from southern Mexico form a clade sister to several species of Noctuana Bell, 1937 (type species Helias noctua C. Felder and R. Felder, 1867) (Fig. 9), and therefore these specimens represent a new species. This new species is most similar to Noctuana stator (Godman, 1899) (type locality in Mexico: Veracruz) and keys to it (E.22.4) in Evans (1953), but is only distantly related to it and differs by a more strongly developed lobe at the vein M₂ on the forewing outer margin (and correspondingly deeper concavity at the vein M₁) and a very long claw-like smooth (not serrated) process from the inner surface of the ampulla near the harpe directed anterodorsad and reaching the costa of the valva. Males have a costal fold. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6551.2.4:C153T, aly2284.23.4:T68C, aly1937.34.1:T574C, aly1937.34.1:T735C, aly798.5.3:A336G; and COI barcode: T250C, A256T, T358C, T479A, A565G.

Barcode sequence of the holotype.

Sample NVG-23053G08, GenBank PV972518, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTGGGAACCTCTTTAAGTTTAATTATTCGCTCTGAATTAGGGACTCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCTCATGCCTTTATCATAATCTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGACTAATCCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCGCGAATAAATAACATAAGTTTTTGACTTTTACCCCCATCACTTATATTATTAATTTCAAGAAGTATTGTAGAAAATGGGGCTGGAACAGGGTGAACAGTTTACCCCCCCCTTTCAGCTAACATTGCTCATCAAGGATCTTCTGTAGATTTAGCTATTTTCTCCCTTCATTTAGCTGGTATTTCTTCTATTTTAGGTGCAATTAACTTTATTACAACAATTATTAATATGCGAATTAACAACATGTCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGGGCTATTACAATACTTTTAACTGATCGAAATCTCAATACATCTTTTTTCGATCCTGCAGGAGGGGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 352–353 (genitalia Fig. 1070–1074), bears the following nine printed (text in italics handwritten) rectangular labels, 5^th and the last red, others white: [ MX:Oaxaca | Hwy 175, ca 5 | mi N Oaxaca | 17 July 1988 | leg. J. Kemner ], [ Noctuana stator | (Godman & Salvin) | det GT Austin 1991 ], [ G.T. Austin colln. | MGCL Accession | # 2004–5 ], [ MGCL/FLMNH | Specimen no. | 37224 ], [ ] no text on this red label, [ DNA sample ID: | NVG-23053G08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24064F08 | c/o Nick V. Grishin ], [ genitalia | NVG241111–13 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Noctuana | mimica Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ from Mexico [MGCL]: NVG-23053G06, specimen no. 22401, Oaxaca, El Estudiente Sa. De Juarez, pine-oak forest 2200 m, 8-Aug-1987, J. de la Maza E. leg. and NVG-23053G07, specimen no. 37221, Chiapas, San Felipe, sta. #3, 3000’, 5-Aug-1974, R. Wind leg.

Type locality.

Mexico: Oaxaca, Tlalixtac de Cabrera, Hwy 175, ca. 5 mi north of Oaxaca City.

Etymology.

This species is similar in looks to N. stator while not being closely related to it and is a noun in apposition.

Distribution.

Oaxaca and Chiapas in Mexico.

Comment.

The type locality of this species is also the type locality of Piruna kemneri Freeman, 1990, Piruna mullinsi Freeman, 1991, Cecropterus (Thorybes) oaxacensis Grishin, 2023, and Pholisora suroesta new species proposed above.

Noctuana statoreca Grishin, new species

https://zoobank.org/58999DFE-822C-4A1F-8E6F-10BDA7A40C27

(Fig. 9 part, 354–355, 1075–1079)

Definition and diagnosis.

Genomic analysis reveals that a specimen from Ecuador is sister to Noctuana stator (Godman, 1899) (type locality Mexico, Veracruz, Atoyac) but is genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 2.9% (19 bp), and therefore this specimen represents a new species. This new species keys to N. stator (E.22.4) in Evans (1953) and was included by him in this species, but differs from it and other relatives by the following combination of characters: a costal fold in males; a somewhat more prominent lobe at the vein M₂ on the forewing outer margin than in N. stator (and correspondingly slightly deeper concavity at the vein M₁), discal orange spots on the hindwing underside more apparent than in N. stator, a narrower process of the left harpe, which is less protruding distad of the ampulla; a longer lower tooth of the right harpe; and a less robust process (directed anteriad) at the base of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly998.6.2:T57C, aly1264.14.2:A123G, aly1281.8.1:C1138A, aly1486.1.2:A82C, aly1500.11.1:T36C, aly1041.22.5:C85C (not T), aly57735.1.3:T187T (not G), aly57735.1.3:C188C (not T), aly18209.2.11:T321T (not C), aly2284.26.9:T93T (not G); and COI barcode: T92C, T187C, G316A, 433A, T499T, T556A.

Barcode sequence of the holotype.

Sample NVG-18061G10, GenBank PV972519, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGTTTAATTATTCGTTCTGAATTAGGAACTCCTGGTTCTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGTTTCGGAAATTGACTAGTCCCCCTTATATTAGGGGCCCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCATCACTTATATTATTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCATCTAATATTGCCCATCAAGGATCTTCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAACTTCATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGACCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 354–355 (genitalia Fig. 1075–1079), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR: Napo Pr. | Latas Grande Bridge | 1° 2.’S 77° 44.1’W | 480m 6 Nov.’92 | S. S. Nicolay, leg. ], [ DNA sample ID: | NVG-18061G10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22034H10 | c/o Nick V. Grishin ], [ genitalia | NVG241118–76 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466899 ], and one red [ HOLOTYPE ♂ | Noctuana | statoreca Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Napo Province, Latas Grande Bridge, elevation 480 m, approx. GPS −1.033, −77.735.

Etymology.

The name is a fusion of the name of its sister species and the country of the type locality: stator + Ec[u]a[dor], and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected east of the Andes in central Ecuador.

Noctuana statorana Grishin, new species

https://zoobank.org/AF2C431B-FE0D-4418-9F04-11CE8734A63F

(Fig. 9 part, 356–357, 1080–1084)

Definition and diagnosis.

Genomic analysis of a specimen from Guyana reveals that it is sister to the clade composed of Noctuana stator (Godman, 1899) (type locality Mexico, Veracruz, Atoyac) and a new species described above, thus representing a new species (Fig. 9). This new species is more distantly related to N. stator, e.g., their COI barcodes differ by 2.6% (17 bp), while keying to it (E.22.4) in Evans (1953), and was likely included by him in this taxon, but differs from it and related species by the following combination of characters: a costal fold in males; more prominent red spots on the ventral hindwing, in particular, the discal band with two well-developed spots by the anal fold; a wider process of the left harpe, armed with more than half a dozen teeth; and a thicker but shorter lower tooth of the right harpe with a more robust lobe above it. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1500.11.1:G93C, aly770.33.3:A66G, aly2811.5.5:A399G, aly26.44.11:T36C, aly26.44.11:C42T, aly998.6.2:T57T (not C), aly1264.14.2:A123A (not G), aly1454.5.3:T69T (not C), aly770.33.3:A67A (not C), aly1486.1.2:A82A (not C); and COI barcode: T92C, T187T, G316G, 433G, T499C, T556A.

Barcode sequence of the holotype.

Sample NVG-18012B08, GenBank PV972520, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGTTTAATTATTCGTTCTGAATTAGGAACTCCTGGTTCTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGACTAGTCCCCCTTATATTAGGGGCCCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCATCACTTATATTATTAATTTCAAGAAGTATTGTTGAAAATGGGGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCATCTAATATTGCCCATCAAGGATCTTCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCTGGTATTTCTTCTATTTTAGGGGCAATTAACTTCATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGACCAAATACCCTTATTTGTTTGAGCAGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 356–357 (genitalia Fig. 1080–1084), bears the following seven printed rectangular labels, six white: [ GUYANA: Acarai Mts./ridge | Sipu R. 2500–3000’ | 31.X.-10.XI.2000 | 1°22.2’N 58°57.9’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-18012B08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22034H09 | c/o Nick V. Grishin ], [ genitalia | NVG241118–75 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450273 ], [ {QR Code} | USNM ENT | 00275165 ], and one red [ HOLOTYPE ♂ | Noctuana | statorana Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana: Acarai Mts., Sipu River, elevation 2500’–3000’, GPS 1.370, −58.950.

Etymology.

The name is a fusion of the name of its sister species and the country of the type locality: stator + [Guy]ana, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Guyana.

Noctuana haematospilata Grishin, new species

https://zoobank.org/E84D5196-DF9C-4672-89C1-06B09A17B555

(Fig. 9 part, 358–359, 1085–1089)

Definition and diagnosis.

Genomic analysis of specimens from Peru and Ecuador initially identified as Noctuana haematospila (C. Felder and R. Felder, 1867) (type locality in Venezuela and Colombia) reveals that they are genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 5.5% (36 bp), and therefore these specimens represent a new species. This new species keys to N. haematospila (E.22.5) in Evans (1953) and was included by him in this species, but differs from it and other relatives by the absence of the costal fold in males; a more weakly expressed red pattern on the ventral forewing, in particular, in the posterior half; a strongly expanded process of the right harpe and a left harpe with two narrow prongs. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1022.5.11:G30T, aly499.17.4:C48A, aly4645.9.3:C36A, aly276790.1.1:A233G, aly1500.3.3:T87A; and COI barcode: A76G, C197T, C284T, G316G, T319C, T427C, A433G, A622C.

Barcode sequence of the holotype.

Sample NVG-7974, GenBank PV972521, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTAATTATTCGCTCTGAATTGGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCCTTTATTATAATTTTTTTTATAGTAATACCAATTATAATCGGAGGTTTTGGAAATTGATTAGTCCCCCTTATACTAGGAGCCCCTGACATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCATCACTTATATTACTAATTTCAAGAAGTATCGTAGAAAATGGGGCCGGAACAGGATGAACAGTTTATCCCCCTTTATCAACTAATATTGCCCATCAAGGATCCTCAGTAGATTTAGCTATTTTTTCCCTCCACTTAGCAGGAATTTCTTCAATCTTAGGGGCAATTAATTTCATTACAACAATTATTAACATACGAATTAATAATTTATCATTTGATCAAATACCCTTATTTATTTGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCTTTTTTTGACCCTGCCGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 358–359 (genitalia Fig. 1085–1089), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU:Cuzco 1700m | Mirador | Cosnipata Road 1602 | 4.ii.2011 Kinyon ], [ DNA sample ID: | NVG-7974 | c/o Nick V. Grishin ], [ genitalia | NVG17020759 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321814 ], and one red [ HOLOTYPE ♂ | Noctuana | haematospilata Grishin ]. Paratypes: 2♂♂ from Ecuador: 1♂ NVG-23053H05 Orellana, Topo, Jun-2002, M. Simon leg. [MGCL] and 1♂ NVG-18091C04 Morona-Santiago, San Isidro, Macas, 1250 m, GPS 2.12, −78.10, 15-Nov-2012, J.-C. Petit leg. [EBC].

Type locality.

Peru: Cuzco Department, Cosñipata Road, Mirador, elevation 1700 m.

Etymology.

The name is formed from the name of its sister species made longer to indicate its more southern distribution and is an adjective.

Distribution.

Ecuador and Peru.

Noctuana ventrovenata Grishin, new species

https://zoobank.org/5F289B7B-E148-48C2-ABF1-D8B95D05C08A

(Fig. 9 part, 360–361, 1090–1094)

Definition and diagnosis.

Genomic analysis of specimens from southern Peru initially identified as Noctuana haematospila (C. Felder and R. Felder, 1867) (type locality in Venezuela and Colombia) reveals that they are not monophyletic with it forming a clade sister to both N. haematospila and the new species described above (Fig. 9), and therefore these specimens represent a new species. This new species is strongly differentiated genetically from N. haematospila, e.g., their COI barcodes differ by 5.2% (34 bp). This new species keys to N. haematospila (E.22.5) in Evans (1953) and was included by him in this species, but differs from it and other relatives by the absence of the costal fold in males; a more strongly expressed red pattern on the ventral forewing with darker veins that stand out from the background more than in relatives; shorter and thicker process of the right harpe, and the left harpe with broader and overlapping prongs, rounded in dorsal view. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly361.22.1:A2022C, aly361.22.1:T2413G, aly276665.12.1:A336G, aly767.3.1:A1068T, aly767.3.1:A1281G; and COI barcode: A76G, G316A, T319T, T427C, A433A, T571T, A622C.

Barcode sequence of the holotype.

Sample NVG-18125D03, GenBank PV972522, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTAATTATTCGCTCTGAATTGGGAACCCCCGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTAACAGCTCACGCCTTTATTATAATTTTTTTTATAGTAATACCAATTATAATCGGAGGTTTTGGAAATTGACTAGTCCCCCTTATGTTGGGAGCCCCTGACATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCATCACTTATACTATTAATTTCAAGAAGTATCGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCCCCTTTATCAACTAATATTGCCCATCAAGGATCCTCAGTAGATTTAGCTATTTTTTCCCTCCACTTAGCAGGAATTTCTTCAATCTTAGGAGCAATTAATTTCATTACAACAATTATTAACATACGAATTAATAATTTATCATTTGATCAAATACCCTTATTTATTTGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCTTTTTTTGACCCTGCCGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ currently in the Dempwolf collection (Austin, Texas, USA), to be deposited in the Museo de Historia Natural, Lima, Peru (MUSM), illustrated in Fig. 360–361 (genitalia Fig. 1090–1094), bears the following seven printed rectangular labels, six white: [ Peru: Cuzco Dept 1970m | Cosñipata Valley, Rocotal | 13° 06’ S, 71° 34’ W | November 11, 2017 | Leg: W. Dempwolf ], [ Noctuana haemotospila | ♂ | Coll of: W R Dempwolf ], [ WRD 14,947 ], [ DNA sample ID: | NVG-18125D03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015G10 | c/o Nick V. Grishin ], [ genitalia | NVG241114–54 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Noctuana | ventrovenata Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-23053G11 (leg, DNA sequenced), NVG-24064F09 (abdomen, DNA stored) Peru, Cuzco, Jun-1996 (no other data, likely M. Simon leg.), genitalia NVG241111–14 [MGCL].

Type locality.

Peru: Cuzco Department, Cosñipata Valley, Rocotal, elevation 1970 m, GPS −13.10, −71.567.

Etymology.

The name refers to the darker veins on the ventral side of wings in this species compared to its relatives and is an adjective.

Distribution.

Currently known only from Cuzco Region in Peru.

Windia sonoria Grishin, new species

https://zoobank.org/CAD0778F-64DB-45B4-8464-10AAC6B8D176

(Fig. 9 part, 362–365, 1095–1097)

Definition and diagnosis.

Genomic analysis of Windia Freeman, 1969 (type species Windia windi Freeman, 1969) specimens reveals that they partition into two clades genetically differentiated at the species level (Fig. 9); e.g., their COI barcodes differ by 2.6% (17 bp). One clade contains the holotype of Windia windi Freeman, 1969 (type locality in Mexico: Colima) and corresponds to this species. The other clade, with specimens from Sonora and Sinaloa, Mexico, represents a new species. This new species is most similar to W. windi and has been identified as such, but differs from it by larger hyaline spots, e.g., there is usually a single spot in the forewing cell CuA₁-CuA₂, not two spots, and the apical spots are longer, dash-like; the left harpe protrudes farther distad from the process of the ampulla (nearly level with it in W. windi); and the process of the ampulla on the right valva is less robust, more finely serrated, and with a straighter ventral margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly808.1.8:C159T, aly3516.9.6:T162A, aly1019.30.7:G75A, aly1113.4.5:G72A, aly1405.20.35:G36A; and COI barcode: T112C, T212C, T349C, T562A, T634C.

Barcode sequence of the holotype.

Sample NVG-22101C02, GenBank PV972523, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGACTAATTATTCGTTCTGAATTAGGTACCCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTTCCACTTATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTTATACTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCCCCCCTCTCAGCAAATATTGCCCATCAAGGATCATCAGTTGACTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACCATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTCTATTTATTTGAGCTGTAGGAATTACAGCTTTACTTCTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACAATACTTTTAACAGATCGAAATCTTAATACATCTTTTTTTGACCCTGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 362–363, bears the following six printed (text in italics handwritten) rectangular labels, five white: [ MEX. Sonora, | 7 mi.SE.Alamos | VIII-12–60 ], [ D.C.RENTZ | COLLECTOR ], [ Collection of | C. S. MacNeill ], [ DNA sample ID: | NVG-22101C02 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8566872 ], and one red [ HOLOTYPE ♂ | Windia sonoria | Grishin ]. Paratypes: 7♂♂ and 4♀♀ from Mexico, Sonora: 2♂ and 3♀♀ 5 mi SE of Alamos, Arroyo Aduana, 1200’, 6,7-Sep-1987, Douglas Mullins leg. (1♂ NVG-14065A11 and 1♀ NVG-14065A12 [JAS]; 1♂ NVG-19064D10 and 1♀ NVG-19064D08 [UCDC]; and 1♀ NVG-23053F01 [MGCL]); 1♂ NVG-15102D03 Rte 16, 8.5 mi W of Río Yaqui, 26-Aug-1984, D. Mullins leg., genitalia X-2052 J. M. Burns 1985 [RAB]; 1♂ NVG-23053E08 Rte 16, 6.2 mi W of Río Yaqui, 6-Jul-1986, D. Mullins leg., genitalia NVG241018–05 (Fig. 1095–1097) [MGCL]; and 1♂ NVG-19064D09 Hwy16, 11.5 mi E of Río Yaqui, 5-Aug-1986, K. Hansen leg. [UCDC] and Sinaloa: 1♂ NVG-15102D04 2 mi S of Mazatlán, 30-Jun-1965, J. A. and M. A. Chemsak, E. G. and J. M. Linsley leg. [UCB]; 1♂ NVG-15102D05 5 mi N of Mazatlán, 26-Jul-1973, J. A. Chemsak, E. G. Linsley and A. E. Michelbacher leg. [UCB]; and 1♀ NVG-23053F02 6 mi N of Mazatlán, 30 m, 6-Aug-1973, L. D.& J. Y. Miller leg. [MGCL] (Fig. 364–365).

Type locality.

Mexico: Sonora, 7 mi southeast of Alamos.

Etymology.

The name is derived from the Mexican state of the type locality and is treated as a noun in apposition.

Distribution.

Sonora and Sinaloa in Mexico.

Comment.

Male genitalia of W. windi NVG-23053E09 from Mexico: Guerrero, Mezcala, Jul-1957, T. Escalante leg., genitalia SRS-5298 [MGCL], are illustrated for comparison in Fig. 1098–1102.

Ernsta (Delaga) aspes Grishin, new species

https://zoobank.org/6D44D6A1-110C-46A1-9653-40C0E5AC7C20

(Fig. 9 part, 366–367, 1103–1108)

Definition and diagnosis.

Genomic analysis reveals that a specimen from Namibia is sister to Ernsta sataspes (Trimen, 1864) (type locality in South Africa) and is genetically differentiated from it at the species level (Fig. 9); e.g., their COI barcodes differ by 3.8% (25 bp), and therefore it represents a new species. This new species keys to “Spialia sataspes” (III.16.4) in Evans (1937), but differs from it and other relatives by a pale discal hindwing band separated into spots, the presence of a row of submarginal spots on the ventral hindwing, better developed submarginal spots between the veins M₁ and M₃ on the forewing; the uncus that is longer compared to tegumen, terminally broader valva, the ampulla that is dorsally nearly straight (not convex), and the spined section of the costal process of the ampulla that is longer and nearly reaching the base of the harpe along its dorsal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly221.14.1:T219A, aly320.6.1:G325A, aly3241.1.2:C121T, aly814.7.6:T519C, aly2012.40.16:T60A, aly4250.7.1:T42T (not C), aly1577.11.1:C441C (not T), aly1577.11.1:C495C (not T), aly1577.11.1:A499A (not G), aly1577.11.1:T504T (not C); and COI barcode: T10C, C17C, A67G, T250C, T479A, T532C.

Barcode sequence of the holotype.

Sample NVG-21117F06, GenBank PV972524, 658 base pairs:

AACTTTATACTTTATTCTAGGAATCTGATCAGGAATAGTAGGAACTTCTTTAAGTTTACTTATTCGGTCAGAATTAGGTACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCTCCAGATATAGCCTTTCCACGAATAAATAACATAAGATTTTGACTTTTACCCCCCTCTTTAATACTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGTAGGAACAGGATGAACAGTATATCCACCTTTATCAGCTAATATTGCACACCAAGGAGCTTCTGTTGATTTAGCTATTTTCTCCCTTCATTTAGCTGGTATTTCTTCTATTCTAGGAGCAATTAATTTCATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTGGGAATTACAGCACTCTTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATCACAATACTACTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 366–367 (genitalia Fig. 1103–1108), bears the following three printed rectangular labels: blue [ NAMIBIA-Exp. ZMB 1992 | Grootfontein:Otavi Fontain | 4km E Otavi,19° 38’S/ | 17° 23’E,17.II.92,leg.W.Mey ], white [ DNA sample ID: | NVG-21117F06 | c/o Nick V. Grishin ], and red [ HOLOTYPE ♂ | Ernsta (Delaga) | aspes Grishin ]. An unnumbered genitalia vial is attached to the same pin as the specimen and its labels.

Type locality.

Namibia: 4 km east of Otavi, GPS −19.633, 17.383.

Etymology.

According to the ancient Greek historian Herodotus, Sataspes was a condemned man who was offered a chance to avoid execution by circumnavigating Africa. The name for its sister is formed from it by taking the second part of the word ([sat]aspes), thus making the name shorter for this more northern species. The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected in Namibia.

Tribe Pyrgini Burmeister, 1878

Heliopetes (Heliopyrgus) willioides Grishin, new species

https://zoobank.org/768AEFA1-081B-4777-B3D2-32AE6BE6540D

(Fig. 11 part, 368–371, 1109–1110)

Figure 11.

Phylogenetic trees of selected Pyrgini and Erynnini: Clitina inferred from protein-coding regions in a) the Z chromosome, based on 324,141 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of specimens identified as Heliopetes (Heliopyrgus) willi (Plötz, 1884) (type locality in Brazil: Minas Gerais, lectotype sequenced as NVG-18057A03) reveals that they partition into two clades genetically differentiated at the species level (Fig. 11); e.g., their COI barcodes differ by 1.5% (10 bp). The first clade consists of specimens from the northern parts of the range, including the lectotype, and corresponds to H. willi. The second clade includes specimens from Paraguay and Argentina and represents a new species. This new species keys to “Heliopetes domicella willi” (G.2.1(c)) in Evans (1953) and was included by him in this taxon, but differs from it by being paler, with larger white spots and narrower black veins between them, especially the subapical forewing spots; and a distally narrower harpe in lateral view, with a longer spike directed inward. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2165.8.22:T156G, aly2165.8.22:G159A, aly322.29.11:G141A, aly322.29.11:C195T, aly322.29.11:C228A; and COI barcode: T106T, T250C, C271T, T385C, T478C.

Barcode sequence of the holotype.

Sample NVG-22101G05, GenBank PV972525, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGAAATCCTGGATCACTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCCCCAGATATAGCATTCCCCCGTATAAATAACATAAGATTTTGATTACTACCTCCATCTTTAACTTTACTTATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCAGCTAATATTGCTCATCAAGGTTCTTCTGTAGACTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAACATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 368–369 (genitalia Fig. 1109–1110), bears the following nine printed (text in italics handwritten) rectangular labels, eight white: [ S. P. Colalao | Tucumán (R. A.) | I-49 Arnau ], [ rec’d from | J. E. Foerster ], [ Heliopyrgus domicella | willi | (Plotz) 1884 | Det. C. D. MacNeill ‘96 ], [ Collection of | C.D.MacNeill ], [ DNA sample ID: | NVG-22101G05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D09 | c/o Nick V. Grishin ], [ genitalia | NVG241114–04 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8566923 ], and one red [ HOLOTYPE ♂ | Heliopetes (Heliopyrgus) | willioides Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-22101G04, CASENT8566922 Paraguay, San Pedro Cororo-Río Ypane, 6–10-Dec-1983, M. Wasbauer leg. [CAS] (Fig. 370–371).

Type locality.

Argentina: Tucumán Province, San Pedro de Colalao.

Etymology.

The name is formed from the name of its sister species, H. willi, made longer for this more southern species. The name is treated as a noun in apposition.

Distribution.

Paraguay and Argentina.

Heliopetes (Heliopetes) arsaltines Grishin, new species

https://zoobank.org/8B7E5195-2F2D-4129-B58D-45F90466F693

(Fig. 11 part, 372–373, 1111–1112)

Definition and diagnosis.

Genomic analysis of specimens identified as Heliopetes (Heliopetes) arsalte (Linnaeus, 1758) (type locality in “Indiis,” likely the Guianas (Honey and Scoble 2001)) reveals that they partition into two non-sister clades in the Z chromosome tree and therefore belong to two species. One of the clades is sister to both Heliopetes (Heliopetes) elonmuski Grishin, 2023 (type locality in USA: Texas, Cameron Co.) and Heliopetes (Heliopetes) marginata Hayward, 1940 (type locality in Ecuador). This clade consists of specimens from the northern and eastern parts of the range, including Guyana, and therefore corresponds to H. arsalte (Fig. 11). The second clade consists of specimens from the western and southern parts of the range and is sister to all three species and therefore represents a new species (Fig. 11). This new species keys to “H. arsalte arsalte” (G.2.7(a)) in Evans (1953) and was included by him in this species, but differs from it and other relatives by the base of the costal cell on the hindwing underside not conspicuously orange (only with a trace of orange color), no large black preterminal bands on the wings, and no white apical band inside a darker area on the forewing upperside; the dorsally concave (rather than straight and more rounded) ampulla, with its distal end more turned inward (but still only slightly), a smaller gap between the ampulla and the harpe, and a larger number of teeth on the distal margin of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.44.6:T399A, aly216.15.5:C135T, aly127.91.2:T1146C, aly499.7.3:T1134A, aly499.7.3:A1680G. However, the COI barcode does not distinguish this species from H. arsalte due to low divergence in mitochondrial DNA.

Barcode sequence of the holotype.

Sample NVG-19091D08, GenBank PV972526, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACATTATTAATTTCAAGAAGTGTAGTAGAAAACGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTAATATTGCACACCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCCTTACACTTAGCAGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCATTTGATCAAATACCCTTATTTGTATGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTCTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 372–373 (genitalia Fig. 1111–1112), bears the following five printed rectangular labels, four white: [ BRAZIL, RJ, Casimiro | de Abreu (Aldeia Velha) | 22°39’S, 42°23’W | 24 Jan 1995, 200–400 m | leg. Caldas & students ], [ DNA sample ID: | NVG-19091D08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A02 | c/o Nick V. Grishin ], [ genitalia | NVG241118–78 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Heliopetes (Heliopetes) | arsaltines Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. GPS coordinates listed on the label of the holotype do not exactly correspond to the locality given in words. Paratypes: 4♂♂ and 4♀♀: Brazil: 1♂ NVG-18096H01 Ceara, Pira Pora, old [ca. 1900], Waehner leg. [MTD] and 1♂ NVG-20062H07 (abdomen, DNA sequenced) Rondônia, 6–8 km NE of Cacaulândia, 23-Apr-1992, C. J. Durden leg. [TMMC]; Peru: 1♀ NVG-19091D02 Cuzco, Cosñipata Road, Patria, 750 m, 11-Nov-2012, S. Kinyon leg. [USNM] and 1♂ NVG-22105D01, CASENT8568379 Satipo, Dec (no year), Pedro Paprzyok leg. [CAS]; Bolivia: 1♀ NVG-19091D07 Beni, 40 km E San Borja, Estacion Biological Beni, Palm Camp, 28-Aug-1987, M. G. Pogue leg. [USNM] and 1♂ NVG-22105C12, CASENT8568378 Yungas de Palmar, 1100 m, rec’d from J. E. Foerster [CAS]; 1♀ NVG-22105C11, CASENT8568377 Paraguay, San Pedro Cororo-Río Ypane, 1–4-Dec-1983, M. Wasbauer leg. [CAS]; and 1♀ NVG-19091D06 Argentina, Salta, Oran, nr. Aguas Blancas, GPS −22.733, −64.367, 19-Jan-2004, Nancy Vannucci leg. [USNM].

Type locality.

Brazil: Rio de Janeiro, Casimirio de Abreu, Aldeia Velha, elevation 200–400 m.

Etymology.

The name is from the close relative H. arsalte made longer to signify more southern distribution. The name is treated as a noun in apposition.

Distribution.

Widely distributed throughout South America, with the exception of its northern regions.

Comment.

Male genitalia of H. arsalte NVG-19091D05 (leg, DNA sequenced), NVG-23121A01 (abdomen, DNA stored), USNMENT 00232555 from Guyana: Upper Takutu-Upper Essequibo, Lethem, 250’, 3.373, −59.795, 20–21-Feb-1999, S. Fratello, R. Hanner, S. Hendricks, R. Williams leg., genitalia NVG241118–77 [USNM], are illustrated for comparison in Fig. 1113–1114.

Lectotype designation for Paches phalaena Mabille, 1898

Paches phalaena Mabille, 1898 (Staudinger in litt.) was described from an unstated number of specimens from “Tanampaya”, La Paz, Bolivia in the collections of Staudinger and Mabille (Mabille 1898). Judging from their labels, we located three syntypes: two originated from the Staudinger collection (one in MFNB and one in ZSMC) and one from the Mabille collection (BMNH). The syntype in the ZSMC is labeled in Staudinger’s handwriting “Phalaena Mab.”, called “cotyp.” on an older label and “Paratypus” on a more recent red label, sequenced as NVG-18056G04. The syntype in the BMNH has locality “Boliv.” mentioned in the left corner at the bottom of its identification label. The syntype the MFNB is the only one bearing a label with a more precise locality, “Tanamp.”, in addition to Bolivia. This specimen with a more detailed locality is the best candidate for the lectotype. To define the taxonomic identity of the name P. phalaena objectively, N.V.G. hereby designates this syntype in the MFNB collection, the male with the following seven rectangular labels (1^st purple, 3^rd pale greenish, others white; 3^rd and 5^th handwritten, others printed): [ Origin. ], [ Tanamp. | Bol. | Garl. ], [ G. Phalaena | Mab. ], [ Coll. | Staudinger ], [ Gorgythion | Phalaena | (Mab.) n - sp. | Mab. ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 940bac ], and [ DNA sample ID: | NVG-15032F08 | c/o Nick V. Grishin ] as the lectotype of Paches phalaena Mabille, 1898. The 3^rd label is in Mabille’s handwriting, and the lectotype was collected by Garlepp. The lectotype is in good condition with a small nick at the outer margin of the left forewing at the vein CuA₂, and parts of the fringe missing in the middle of the left hindwing and by the tornus of both hindwings. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032F08, GenBank PV972527, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTCTAAGACTACTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATCGGAGATGATCAAATCTATAATACAATTGTTACAGCACATGCCTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCTCGTATAAATAATATAAGATTTTGATTACTACCCCCCTCATTAACACTACTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTCTATCCCCCTCTTTCAGCTAATATTGCACATCAAGGTTCTTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGAATTAGAAACTTGTCATTTGATCAGATACCATTATTTGTGTGAGCAGTGGGAATTACAGCTTTACTTTTACTACTATCACTACCCGTTTTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCTTTCTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTT

Trina phalaena (Mabille, 1898) is a species distinct from Trina geometrina (C. Felder and R. Felder, 1867)

Genomic analysis of the lectotype of Paches phalaena Mabille, 1898 (type locality Bolivia: Tanampaya, NVG-15032F08), a taxon currently treated as a subspecies of Trina geometrina (C. Felder and R. Felder, 1867) (type locality in Venezuela and Colombia), together with a paralectotype and another specimen (Fig. 11), reveals that it is genetically differentiated from the nominal subspecies at the species level, e.g., their COI barcodes differ by 5.6% (37 bp). Taking into account differences in genitalia (Evans 1953), we propose that Trina phalaena (Mabille, 1898), reinstated status, is a species distinct from Trina geometrina (C. Felder and R. Felder, 1867).

Trina trina Grishin, new species

https://zoobank.org/8A70518D-E756-487F-B670-820B691D9C02

(Fig. 11 part, 374–375, 1115–1116)

Definition and diagnosis.

Genomic analysis of specimens initially identified as Trina geometrina (C. Felder and R. Felder, 1867) (type locality in Venezuela and Colombia) reveals that specimens from Panama and western Colombia are genetically differentiated from the rest at the species level (Fig. 11); e.g., their COI barcodes differ by 1.8% (12 bp), and therefore these specimens represent a new species. This new species keys to “T. geometrina geometrina” (E.34(a)) in Evans (1953) and was likely included by him in this species, but differs from it by narrower dark bands, especially towards the inner margin of the hindwing, and a narrower, more uniform in width harpe until its terminal hammerhead expansion (not evenly broadening towards it). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1113.17.2:T165A, aly208.19.5:C88T, aly84.45.3:G54A, aly536.184.3:C204T, aly16.28.1:G165A; and COI barcode: T59T, C220C, T250C, C266T, C271A, A628G.

Barcode sequence of the holotype.

Sample NVG-19088B09, GenBank PV972528, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTCTAAGACTATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCCCGTATAAATAACATAAGATTTTGATTATTACCACCTTCATTAACATTACTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCCCTCTCAGCTAATATTGCACATCAAGGTTCTTCAGTTGATTTAGCTATTTTTTCACTTCATTTAGCTGGTATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 374–375 (genitalia Fig. 1115–1116), bears the following seven rectangular printed (text in italics handwritten) labels, six white: [ Potrerillos 3600’ | Chiriqui Panama | 11 Feb.’70 | S. S. Nicolay ], [ Trina ♂ | geometrina | det. Fldr. | S.S. Nicolay ], [ DNA sample ID: | NVG-19088B09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–01 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01588922 ], and one red [ HOLOTYPE ♂ | Trina trina | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-19088B10, USNMENT 01588923 Colombia, Valle del Cauca, Hormiguero, el. 1000 m, approx. GPS 3.283, −76.483, 16-Jan-1992, J. Bolling Sullivan leg. [USNM].

Type locality.

Panama: Chiriquí, Potrerillos, elevation 3600’.

Etymology.

The name is tautonymous with the genus name and is formed from the name of its sister species, T. geometrina, shortened for this more northern relative. The name is a feminine noun in apposition.

Distribution.

Panama and western Colombia.

Comment.

Male genitalia of T. geometrina NVG-19088C01 (leg. DNA sequenced), NVG-23121A03 (abdomen, DNA stored), USNMENT 01588926 from Brazil: Federal District, Planaltina, 1000 m, −15.567, −47.667, 1-May-1991, Robbins and Becker leg., genitalia NVG241118–80 [USNM], are illustrated for comparison in Fig. 1117–1118.

Trina isa Grishin, new species

https://zoobank.org/4F9458F2-BD3A-433F-A13A-14806B8A4C16

(Fig. 11 part, 376–377, 1119–1120)

Definition and diagnosis.

Genomic analysis of a specimen from French Guiana initially identified as Trina geometrina (C. Felder and R. Felder, 1867) (type locality in Venezuela and Colombia) reveals that it is only distantly related to T. geometrina and is sister to all other species of Trina Evans, 1953 (type species Helias geometrina) (Fig. 11); e.g., their COI barcodes differ by 4.7% (31 bp), and therefore this specimen represents a new species. This new species keys to “T. geometrina geometrina” (E.34(a)) in Evans (1953), but differs from it by the pale discal band in the middle of the hindwing being narrower than the two darker bands around it; a straighter and terminally sharper process of the ampulla; and the harpe rapidly expanding from its base towards a massive tooth in the middle of its dorsal margin, thus the shape of the harpe is nearly triangular with concave sides. Due to possibly cryptic nature of this species, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly499.47.1:G386C, aly499.47.1:A422T, aly2165.1.4:G93A, aly2165.1.4:T136G, aly770.7.8:A93T; and COI barcode: T49A, A58G, T259C, T292C, A364C, T508T.

Barcode sequence of the holotype.

Sample NVG-7983, GenBank PV972529, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCACTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCACCTGATATAGCATTCCCCCGTATAAATAATATAAGATTCTGATTACTACCCCCTTCACTAACATTACTTATCTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCATCAAGGTTCTTCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCCGGTATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACTATCATCAACATACGAATTAGAAATTTATCATTTGATCAAATGCCTTTATTTGTTTGAGCAGTAGGAATTACTGCTTTACTTTTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCCTTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 376–377 (genitalia Fig. 1119–1120), bears the following five rectangular printed labels, four white: [ FRENCH GUIANA: | Saul, 200–450m | 3°37’N 53°43’W | 19 November 1993 | leg. D.J.Harvey ], [ DNA sample ID: | NVG-7983 | c/o Nick V. Grishin ], [ genitalia | NVG170207–68 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321823 ], and one red [ HOLOTYPE ♂ | Trina isa | Grishin ]. Paratype: 1♂ NVG-23119A07 the same data as the holotype but 17-Nov-1993.

Type locality.

French Guiana: Saul, elevation 200–450m, GPS 3.6167, −53.7167.

Etymology.

In Greek, ίσος (isos) means even or equal. The name is given for approximately the same width of alternating pale and dark bands, contrasting with T. geometrina and other species of the genus, which have wider pale bands. The name is treated as a noun in apposition.

Distribution.

Currently known only from French Guiana.

Santa aquila (Hayward, 1951) is a valid species distinct from Santa santes (E. Bell, 1940)

Genomic analysis of specimens identified as Santa santes (E. Bell, 1940) (type locality Peru: Río Santiago, holotype sequenced as NVG-18025B08) reveals that they partition into two clades genetically differentiated at the species level (Fig. 11); e.g., their COI barcodes differ by 2.1% (14 bp). The first clade consists of the S. santes holotype, and the second clade includes a specimen from Bolivia that we identify as Carrhenes aquila Hayward, 1951 (type locality in Bolivia) currently treated as a junior subjective synonym of S. santes. Therefore, we propose that Santa aquila (Hayward, 1951), reinstated status, is a valid species distinct from Santa santes (E. Bell, 1940).

Santa claus Grishin, new species

https://zoobank.org/4F6EA288-5F84-4F0C-A205-E861E10A5CE1

(Fig. 11 part, 378–379, 1121–1122)

Definition and diagnosis.

Genomic analysis of a specimen from Guyana initially identified as Santa trifasciatus (Lindsey, 1925) (type locality in Peru: Junín, holotype sequenced as NVG-22043D11) reveals that it is genetically differentiated from it at the species level (Fig. 11); e.g., their COI barcodes differ by 3.8% (25 bp), and therefore this specimen represents a new species. This new species keys to “Paches trifasciatus” (C.13.13) in Evans (1953), but differs from it by males with a weaker submarginal band of darker brown spots on the ventral forewing, which has a generally more prominent discal band, a vestigial hyaline spot by the forewing apex, broader and closer to each other uncus arms in the dorsal view, and a less curved process of the ampulla that does not approach the ventral margin of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly923.25.1:A1458G, aly1405.10.1:C75T, aly1405.10.1:A331C, aly804.1.8:C156T, aly804.1.8:C202T, aly6377.1.2:T2574T (not A), aly923.18.3:T258T (not C), aly2417.5.6:A48A (not T), aly2165.8.11:T63T (not C), aly804.1.8:C201C (not A); and COI barcode: T46A, T82C, T266C, C274T, T487A, T619T.

Barcode sequence of the holotype.

Sample 11-BOA-13382F10, GenBank PV972530, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATATTAGGTACATCATTAAGTTTATTAATTCGAACTGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAATCCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTACCCCCTTCTTTAACATTATTAATTTCTAGAAGTATTGTAGAAAACGGAGCAGGAACAGGATGAACTGTTTACCCCCCCTTATCCGCAAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATCTTAGGAGCAATCAACTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCTTTAGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCATTATTATTATTACTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGTGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 378–379 (genitalia Fig. 1121–1122), bears the following six printed rectangular labels, five white: [ GUYANA: Acarai Mts. | Sipu R. 900’-2500’ | 29.X.-12.XI.2000 | 1°23.2’N 58°56.8’W | Leg. S.Fratello et al ], [ DNA sample ID: | 11-BOA-13382F10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22032F06 | c/o Nick V. Grishin ], [ genitalia | NVG241121–04 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT | 00283575 ], and one red [ HOLOTYPE ♂ | Santa claus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana: Acarai Mts., Sipu River, elevation 900’–2500’, GPS 1.3867, −58.9467.

Etymology.

The name is given to complement the genus name with a culturally implied association and is a noun in apposition.

Distribution.

Currently known only from the holotype collected in Guyana.

Anisochoria huanuca Grishin, new species

https://zoobank.org/35C41CFF-A0F7-4DBF-9CCF-2224DA0AE856

(Fig. 11 part, 380–381, 1123–1124)

Definition and diagnosis.

Genomic analysis of specimens from the Tingo Maria region in Peru initially identified as Anisochoria verda Evans, 1953 (type locality in Ecuador: Río Verde, Río Pastaza) reveals that they are genetically differentiated from it at the species level (Fig. 11); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore these specimens represent a new species. This new species keys to “A. minorella verda” (E.59.4(a)) in Evans (1953), but differs from it by a darker and more contrasty pattern of the ventral hindwing, a more defined paler pattern on the dorsal side of wings (compared to more uniform brown wings of A. verda), a narrower valva, and a shorter process of the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly84.24.3:T68C, aly21.14.3:A36G, aly2946.2.9:A216G, aly349.40.1:C911T, aly16.4.3:C81T; and COI barcode: A40G, A262G, T355C, A412G, A433G, A631T.

Barcode sequence of the holotype.

Sample NVG-19091H09, GenBank PV972531, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGGTTATTACCACCTTCTTTAACACTATTAATTTCTAGAAGAATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTACCCCCCCCTTTCATCCAATATCGCCCATCAAGGTTCATCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCGGGTATTTCATCAATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACCGCTTTACTTTTATTACTATCATTACCTGTTTTAGCGGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCGGCCGGAGGTGGTGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 380–381 (genitalia Fig. 1123–1124), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU–Huanuco | Tingo Maria 800m | 23 June ‘82 | S. S. Nicolay ], [ DNA sample ID: | NVG-19091H09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22034H01 | c/o Nick V. Grishin ], [ genitalia | NVG241121–05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Anisochoria | huanuca Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 5♂♂ from Peru, Huánuco: Tingo María, D. and J. Jenkins leg. [MGCL]: 1♂ NVG-23054D09 30-Jul-1980 and 1♂ NVG-23054D12 Jul-1980; 12 km S of Tingo María, Santa Rosa de Queseda, 2700’, GPS −9.3793, −75.9544, D. and J. Lindsley leg. [MGCL]: 1♂ NVG-15042F02 18-Jun-2001 and 1♂ NVG-15042F03 19-Jun-2001; and 1♂ NVG-23054E01 1 km S of Las Palmas, 14 km S of Tingo María, 29-Mar-1981, J. Y. Miller leg. [MGCL].

Type locality.

Peru: Huánuco Region, Tingo María, elevation 800 m.

Etymology.

The name is derived from the region of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the vicinity of Tingo María in the Andes of central Peru.

Tribe Erynnini Brues and Carpenter, 1932 Subtribe Clitina Grishin, 2019

Clito mexicens Grishin, new species

https://zoobank.org/6EEA22C9-8E14-43DF-BCFF-861E88FACC41

(Fig. 11 part, 382–383, 1125–1128)

Definition and diagnosis.

Genomic analysis of specimens from southern Mexico initially identified as Clito congruens Grishin, 2023 (type locality in Panama) reveals that they are genetically differentiated from it at the species level (Fig. 11); e.g., their COI barcodes differ by 4.9% (32 bp), and therefore these specimens represent a new species. This species is sympatric and synchronic with C. congruens at least in Oaxaca, Mexico (3 mi SE of Tapanatepec, both species collected on 5-Feb-1969 by L. D. and J. Y. Miller), and is unusual, because it is closely related to C. congruens in the nuclear genome, but in the mitochondrial genome, it is sister to both C. congruens and Clito aberrans (Draudt, 1924) (type locality in Brazil: Amazonas, holotype sequenced as NVG-18093A08) and is more distant from them. This new species keys to “Clito clito” (which is C. aberrans) (E.52.3) in Evans (1953), but differs from it and C. congruens by a differently shaped central white area on the hindwing with a less straight basal edge and a more pronounced constriction towards the anal fold, prominently contrasting submarginal band on both wings formed by more or less disjunct spots, a larger spot in the forewing discal cell; a narrower harpe in lateral view with a smaller tooth in dorsal view, and a slightly more robust process of the ampulla best seen in dorsal view. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly82.19.2:T183C, aly2202.1.22:A19C, aly1080.1.7:A211C, aly2096.10.16:G327C, aly1409.3.3:A90C; and COI barcode: T49A, A370G, T376C, T460C, A622G.

Barcode sequence of the holotype.

Sample NVG-24087B01, GenBank PV972532, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCTTTAATATTGGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAATATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCTGCTAATATTGCTCACCAGGGATCCTCTGTAGATTTAGCTATCTTCTCATTACACTTAGCTGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATCAATATACGTGTTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGTATTACTGCATTATTATTACTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCCGGAGGGGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 382–383 (genitalia Fig. 1125–1126), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ MEXICO: Oaxaca | Candelaria, Loxicha | elev. 500m | 10-VII-1970 | leg. E. Welling ], [ E.C. Welling colln. | Allyn Museum | Acc. #1971–13 ], [ DNA sample ID: | NVG-24087B01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24112B03 | c/o Nick V. Grishin ], [ genitalia | NVG250720–17 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clito mexicens | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 4♂♂ and 1♀ from Mexico [MGCL]: Michoacan, Coahuayana, T. Escalante leg. Aug-1950: 1♂ NVG-24085B01 (leg, DNA sequenced), NVG-24112A12 (abdomen, DNA stored), genitalia NVG250720–15 and 1♂ NVG-24085B05; Guerrero: 1♂ NVG-24085A10 Acahuizotla, Jul-1957, T. Escalante leg. and 1♂ NVG-24085B03 (leg, DNA sequenced), NVG-24112B01 (abdomen, DNA stored) Rio Papagayo, 6 mi S of Tierra Colorada, 180 m, 28-Aug-1967, Miller and Pine leg., genitalia NVG250720–16 (Fig. 1127–1128); and 1♀ NVG-24085B02 (leg, DNA sequenced), NVG-24112B09 (abdomen, DNA stored) Oaxaca, 3 mi SE Tapanatepec, 150 m, 5-Feb-1969, L. D. and J. Y. Miller leg., genitalia NVG250720–18.

Type locality.

Mexico: Oaxaca, Candelaria Loxicha, elevation 500 m.

Etymology.

For the range of this species, proposing a fictional Latin verb, mexicere (to be Mexican, to manifest Mexico, to roam Mexico), we form its present active participle in the nominative singular to get mexicens, a word similar to aberrans or congruens.

Distribution.

Southern Mexico.

Comment.

Male genitalia of C. congruens NVG-24085A11 from Mexico: Oaxaca, 3 mi SE of Tapanatepec, 150 m, 5-Feb-1969, L. D. and J. Y. Miller leg., genitalia NVG241220–24 [MGCL], are illustrated for comparison in Fig. 1129–1130.

Clito sompoides Grishin, new species

https://zoobank.org/B193D6F6-8B7E-4B11-A638-020B874FABE9

(Fig. 11 part, 384–385, 1131–1132)

Definition and diagnosis.

Genomic analysis of a specimen from southeastern Peru initially identified as Clito sompa Evans, 1953 (type locality in Brazil: Bahia) reveals that it is genetically differentiated at the species level (Fig. 11); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore it represents a new species. At its type locality, this new species is sympatric with C. sompa and keys to “Clito clito” (which is C. aberrans) (E.52.4) in Evans (1953), but differs from it and other relatives by the following combination of characters: the hyaline spot in the forewing cell M₃-CuA₁ is offset distad from the spot in the cell CuA₁-CuA₂ similar to C. aberrans, and does not overlap it as in C. sompa; the harpe is much shorter than in C. aberrans and relatives, with the serrated portion being below the process of the ampulla, similar to C. sompa, not distad of it, as in C. aberrans. This species is not cryptic, but due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1139.42.1:G186A, aly276891.1.1:A200T, aly536.125.3:A96G, aly84.20.11:T91A, aly945.6.1:A1690C, aly876.13.6:G111G (not A), aly2284.27.5:A108A (not G), aly2284.27.5:A167A (not G), aly276665.10.4:C85C (not T), aly1297.14.4:A3915A (not G); and COI barcode: A58G, C318T, T499A, 508T, A565G.

Barcode sequence of the holotype.

Sample NVG-14107C05, GenBank PV972533, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGTATGTTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCACTAATACTATTAATTTCAAGAAGTATTGTAGAAAATGGTGTAGGAACAGGATGAACTGTATATCCTCCTTTATCTGCTAATATTGCCCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAGTTAGAAATTTATCATTTGACCAAATACCATTATTTGTTTGAGCAGTAGGAATTACTGCACTATTATTATTATTATCATTACCTGTTTTAGCTGGGGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 384–385 (genitalia Fig. 1131–1132), bears the following five rectangular labels (2^nd handwritten, others printed), four white: [ PERU Madre de Dios | Rio Tambopata Res. | 30km (air) sw Pro. | Maldonato, 290m | 12°50’S 069°20’W ], [ 9 March 1982 | malaise trap, 2.8 km | down main trail | Alluvium Terrace Forest ], [ genitalia NO. | X-63 68 | J.M.Burns 2006 ], [ DNA sample ID: | NVG-14107C05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clito sompoides | Grishin ].

Type locality.

Peru: Madre de Dios Region, Tambopata National Reserve, 30 km southwest of Puerto Maldonado, elevation 290 m, approx. GPS −12.833, −69.333.

Etymology.

The name is formed from the name of its sister species, C. sompa, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southeastern Peru.

Clito ada Grishin, new species

https://zoobank.org/1C7D1DC5-692A-4041-932C-A529375BA32A

(Fig. 11 part, 386–387, 1133–1135)

Definition and diagnosis.

Genomic analysis of a specimen from Panama that was initially identified as Clito clada (Evans, 1953) (type locality in Brazil: Maranhão) reveals that it is genetically differentiated from it at the species level (Fig. 11); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore it represents a new species. This new species keys to “Eracon mnemon clada” (E.13.8(b)) in Evans (1953), but differs from it by larger hyaline spots on the forewing (e.g., in the cell CuA₁-CuA₂) and more extensive pale areas on the hindwing, especially on its ventral side. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2643.3.3:T1254C, aly2643.3.3:A1263T, aly6954.5.16:G66A, aly600.10.42:C88T, aly1656.3.1:A835C; and COI barcode: A100G, A412G, A496G, T505C, A628G.

Barcode sequence of the holotype.

Sample NVG-14107C07, GenBank PV972534, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGATCAGGTATAGTAGGTACCTCCTTAAGTTTATTAATTCGAACTGAACTTGGTAATCCAGGTTCTTTAATTGGGGATGACCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTTTATCCACCTTTATCTGCTAATATTGCCCATCAAGGTTCCTCTGTTGACTTAGCTATTTTTTCCCTTCATTTAGCGGGAATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAGTTAGAAATTTATCATTTGATCAAATGCCTTTATTCGTTTGATCAGTTGGTATTACCGCTTTACTTTTACTATTATCATTACCAGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCCTTTTTTGATCCTGCGGGAGGGGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 386–387 (genitalia Fig. 1133–1135), bears the following five rectangular labels (1^st handwritten, others printed), four white: [ Colon 1000’ | Panama | I-6–73 ], [ DNA sample ID: | NVG-14107C07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23116A10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Clito ada | Grishin ]. Judging from the handwriting on the locality label, the holotype was likely collected by Gordon B. Small. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Colón, elevation 1000’.

Etymology.

The name is formed from its sister species, C. clada, made shorter for this more northern species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Clito rondo Grishin, new species

https://zoobank.org/D61696F3-26C1-46B1-935C-75D0D3579D58

(Fig. 11 part, 388–389, 1136–1139)

Definition and diagnosis.

Genomic analysis of a specimen from Rondônia, Brazil, that was identified by G. T. Austin as Clito clada (Evans, 1953) (type locality in Brazil: Maranhão) reveals that it is genetically differentiated from it at the species level (Fig. 11); e.g., their COI barcodes differ by 7.3% (48 bp), and therefore it represents a new species. This new species keys to “Eracon mnemon clada” (E.13.8(b)) in Evans (1953), but differs from it and other relatives by a more extensive gray overscaling on the dorsal side of the wings, especially in the distal half, and more extensive pale areas on the hindwing, especially on its ventral side. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2258.20.6:T81A, aly2258.20.6:A111G, aly2258.20.6:G166A, aly527.6.6:A60G, aly272.2.22:C531T, aly9588.6.1:A870A (not G), aly1849.16.1:T75T (not C), aly1849.16.1:A99A (not C), aly300.1.7:G90G (not C), aly1019.9.1:C1464C (not A); and COI barcode: A100G, A181G, T337A, T352C, T382C, A538G.

Barcode sequence of the holotype.

Sample NVG-15092H10, GenBank PV972535, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGATCAGGTATAGTAGGTACCTCCTTAAGTTTATTAATTCGAACTGAACTGGGTAACCCAGGCTCTCTAATTGGGGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATCATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGACTAGTACCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCACCTTTATCCGCTAATATTGCACATCAAGGCTCTTCTGTCGACTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAGAAACTTATCTTTTGATCAAATACCCCTATTTGTTTGATCAGTTGGTATTACTGCCTTACTTCTGTTATTATCATTACCAGTATTAGCTGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 388–389 (genitalia Fig. 1136–1139), bears the following five printed (text in italics handwritten) labels (3^rd triangular, others rectangular), four white: [ BRASIL: Rondônia | 62 km S Ariquemes | linea C-20, 7 km E | B-65, Fazenda | Rancho Grande | 10 October 1993 | leg. G. T. Austin ], [ genitalia Vial | GTA-3682 ], [ > no text, a leg is glued to this label, [ DNA sample ID: | NVG-15092H10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clito rondo | Grishin ]. The holotype and its genitalia are figured in Austin (2000) (fig. 51, 72), misidentified as C. clada.

Type locality.

Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande.

Etymology.

The name derived from the Brazilian state of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Rondônia, Brazil.

Clito zeloticus Grishin, new species

https://zoobank.org/26F25D38-A1D3-461C-8E76-03351AC48B1E

(Fig. 11 part, 390–391, 1140–1141)

Definition and diagnosis.

Genomic analysis of specimens from Southeast Brazil initially identified as Clito zelotes (Hewitson, 1873) (type locality in Brazil: Amazonas) reveals that they are genetically differentiated from it at the species level (Fig. 11); e.g., their COI barcodes differ by 4.9% (32 bp), and therefore these specimens represent a new species. This new species keys (incompletely) to C. zelotes (E.52.5) in Evans (1953), but differs from it and other relatives by a broad white area on the hindwing that nevertheless does not reach the outer margin, the submarginal dark area overscaled with gray, and similar grayish-green overscaling at the wing bases and throughout the wings in between the semihyaline spots; the ampulla with a knob-like process aligned with the costal margin; and a shorter harpe more similar to that of Clito sompa Evans, 1953 (type locality in Brazil: Bahia) but with a single terminal rounded tooth. This species is not cryptic and is identifiable by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1259.29.4:C42T, aly525.97.2:A22C, aly2627.4.49:C66G, aly127.14.2:A326G, aly10226.10.3:T42A; and COI barcode: T136C, A517C, T523C, T526C, A586A, T616C.

Barcode sequence of the holotype.

Sample NVG-15026E07, GenBank PV972536, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGATCAGGTATAGTAGGAACCTCCTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAATATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCCCCTCTTTCTGCTAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAACCTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTCGGTATCACCGCTTTACTTTTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTCGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 390–391 (genitalia Fig. 1140–1141), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRASIL: GUANABARA | Sumori | 20.viii 1972 | C. Callaghan ], [ A. C. Allyn | Acc. 1972–47 ], [ DNA sample ID: | NVG-15026E07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24064D01 | c/o Nick V. Grishin ], [ genitalia | NVG241111–06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clito zeloticus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-15026E08 Brazil, Espirito Santo, Santa Teresa, 4–7-Mar-1973, C. Callaghan leg. [MGCL].

Type locality.

Brazil: Rio de Janeiro, vicinity of Rio de Janeiro (formerly Guanabara).

Etymology.

The name is formed from the name of its sister species, C. zelotes, to make it longer for this more southern species. The name is treated as a noun in apposition.

Distribution.

Southeast Brazil.

Clito hondo Grishin, new species

https://zoobank.org/BDB1B00C-D78D-4F5D-95C8-F1785B08A0BB

(Fig. 11 part, 392–393, 1142–1143)

Definition and diagnosis.

Genomic analysis of a specimen from Honduras initially identified, for the lack of a better option, as Clito tuva Evans, 1953 (type locality in Brazil: Pará) reveals that it is genetically distant from other species of Clito Evans, 1953 (type species Papilio clito Fabricius, 1787) and is sister to a new species described next (Fig. 11). Although we have not sequenced C. tuva, the species from Honduras is phenotypically different from it and all known species and therefore is new. This new species keys to C. tuva (E.52.7) in Evans (1953), but differs from it and other relatives by being paler, with a larger hindwing central white area that reaches and merges with the white anal area that is wider than the central spot but is separated from the costal margin; the submarginal area that is paler, especially on the hindwing; the white area invading towards the costa past the vein Sc+R₁ on the ventral hindwing; and the upturned harpe that reaches the dorsal margin of the ampulla, which is without teeth or processes, and is just rounded and merged with the harpe. This species is not cryptic and is identifiable by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly84.92.7:T555C, aly1329.4.6:G144A, aly1329.4.6:C162T, aly1468.8.8:A150T, aly412.15.2:C193T, aly527.14.5:A84A (not T), aly116.20.1:C150C (not A), aly116.20.1:T2202T (not C), aly275206.10.2:A165A (not G), aly4339.2.2:G46G (not A); and COI barcode: A31G, A58T, A217G, T386C, T571C.

Barcode sequence of the holotype.

Sample NVG-21015B11, GenBank PV972537, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCGGGTATAGTAGGAACTTCTTTAAGTCTTTTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTAATATTAGGGGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAATATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTTTATCCCCCTTTATCTGCTAATATTGCCCATCAAGGATCATCTGTTGATCTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCATCCATTTTAGGAGCTATTAATTTTATTACTACAATCATTAATATACGAGTTAGAAATTTATCCTTTGATCAAATACCTTTATTTGTTTGAGCTGTCGGTATTACTGCATTACTTTTATTATTATCTCTACCTGTTTTAGCTGGAGCTATCACTATATTATTAACAGATCGAAATTTAAATACATCTTTCTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 392–393 (genitalia Fig. 1142–1143), bears the following seven rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), six white: [ Honduras ], [ Lindsay Collection | C. M. Acc. No. 8584 ], [ Clito | clito ♂ | (Fabricius) | det. H.A. Freeman ], [ DNA sample ID: | NVG-21015B11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23108C05 | c/o Nick V. Grishin ], [ genitalia | NVG241121–08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clito hondo | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Honduras.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Honduras.

Clito pallida Grishin, new species

https://zoobank.org/5687554E-38F6-4774-9525-C55F23B4F968

(Fig. 11 part, 394–397, 1144–1145)

Definition and diagnosis.

Genomic analysis of a specimen from Brazil and Bolivia initially identified, for the lack of a better option, as Clito tuva Evans, 1953 (type locality in Brazil: Pará) reveals that it is genetically distant from other species of Clito Evans, 1953 (type species Papilio clito Fabricius, 1787) and is sister to a new species described above (Fig. 11). Although we have not sequenced C. tuva, the species from Brazil and Bolivia is phenotypically different from it and all known species and therefore is new. This new species keys to C. tuva (E.52.7) in Evans (1953), but differs from it and other relatives by being paler, with a larger hindwing central white area that reaches and merges with the white anal area and the costal margin; the submarginal area that is paler, especially on the hindwing, where two marginal white spots nearly connect with the wide central area; the white area that reaches the costal margin on the ventral hindwing; and the harpe that is terminally rounded and protrudes distad of the ampulla, which is expanded dorsad and serrated along its dorsal margin. This species is not cryptic and is identifiable by its phenotype. In DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly587.18.4:C1227T, aly587.18.4:C1557T, aly203.3.4:C375T, aly203.3.4:C492T, aly798.5.3:A345C; and COI barcode: A40T, T139A, T212C, A325T, T574C.

Barcode sequence of the holotype.

Sample NVG-15026E05, GenBank PV972538, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCATTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTTGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAATATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTCTACCCCCCTTTATCTGCTAACATTGCTCATCAAGGTTCTTCTGTAGATTTAGCAATCTTCTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAGACACTTATCTTTCGATCAAATACCTTTATTTGTTTGAGCCGTAGGAATTACAGCTTTACTTTTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTATTTTATATCAACATCTATTT

Type material.

Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 394–395 (genitalia Fig. 1144–1145), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRASIL:MATO GROSSO | Buriti | 30.vii.1976 | C. Callaghan ], [ A. C. Allyn | Acc. 1976–15 ], [ DNA sample ID: | NVG-15026E05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24064C12 | c/o Nick V. Grishin ], [ genitalia | NVG241111–05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Clito pallida | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-15026E02 Bolivia, Beni, Benicito River, 19–25-Jul-1960, M. Simon leg. [MGCL] (Fig. 396–397).

Type locality.

Brazil: Mato Grosso, Buriti.

Etymology.

The name refers to the paler colors of this species compared to its relatives and is an adjective.

Distribution.

Currently known only from Brazil: Mato Grosso and Bolivia.

Subtribe Erynnina Brues and Carpenter, 1932

Echelatus dilloni E. Bell and W. Comstock, 1948 is a species distinct from Echelatus sempiternus (A. Butler and H. Druce, 1872)

Genomic comparison of Echelatus sempiternus dilloni Bell and W. Comstock, 1948 (type locality in Haiti: Pétionville), with other subspecies of Echelatus sempiternus (Butler and H. Druce, 1872) (type locality in Costa Rica) reveals that it is genetically differentiated from them at the species level (Fig. 12); e.g., their COI barcodes differ by 2.0% (13 bp). Therefore, we propose that Echelatus dilloni Bell and W. Comstock, 1948, new status, is a species distinct from Echelatus sempiternus (Butler and H. Druce, 1872).

Figure 12.

Phylogenetic trees of Erynnini (except Clitina) inferred from protein-coding regions in a) the Z chromosome, based on 309,549 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Echelatus jamaicus Grishin, new species

https://zoobank.org/A4254E41-5FF1-4BEA-9CB1-7DFEB7EA525A

(Fig. 12 part, 398–399, 1146–1148)

Definition and diagnosis.

Genomic analysis of specimens from Jamaica identified as Echelatus dilloni Bell and W. Comstock, 1948, new status (type locality in Haiti: Pétionville), reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 1.8% (12 bp), and may not even be monophyletic with it, although with weaker ultrafast bootstrap of 91% and 94% in the Z chromosome and the mitochondrial genome tree, respectively; and therefore they represent a new species. This new species keys to “Anastrus sempiternus dilloni” (F.6.1(c)) in Evans (1953), but differs from it by having a darker hindwing above without prominently paler areas of E. dilloni between the dark bands, and narrower sclerotized portions of the side lobes of the lamella postvaginalis. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly7690.1.10:T120C, aly997.6.6:C33T, aly1735.10.1:C42A, aly7069.12.1:C165T, aly526.6.7:G54A; and COI barcode: C82C, T139T, T271C, C407T, T427C, T463C.

Barcode sequence of the holotype.

Sample NVG-24064H11, GenBank PV972539, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTAATATTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCACCTCTTTCTGCTAATATTGCCCATCAAGGATCATCAGTAGATTTAGCTATTTTTTCATTACACTTAGCAGGAATTTCTTCTATCCTTGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCACTATTATTATTACTTTCATTACCTGTTTTAGCTGGTGCTATTACAATATTACTTACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 398–399, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ JAMAICA | Hope Gardens, Kingston | 4.IV.1964 | R. Brush ], [ Brush colln. | Allyn Museum | Acc. 1983–15 ], [ DNA sample ID: | NVG-24064H11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Echelatus | jamaicus Grishin ]. Paratype: 1♀ NVG-23119D10 Jamaica, no other details, from Wm. Schaus collection, genitalia NVG241121–09 (Fig. 1146–1148) [USNM].

Type locality.

Jamaica: Kingston, Hope Cardens.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Jamaica.

Comment.

Female genitalia of E. dilloni NVG-19113D08 (leg, DNA sequenced), NVG-23119D09 (abdomen, DNA stored) from Dominican Republic: Samaná, Las Terrenas, 27-Jun-1981, S. S. Nicolay leg., genitalia NVG241121–10 [USNM], are illustrated for comparison in Fig. 1149–1150.

Anaxas songus Grishin, new species

https://zoobank.org/C607F361-1AAE-418B-AC4B-95A79489F481

(Fig. 12 part, 400–401)

Definition and diagnosis.

Genomic analysis of a specimen from Bolivia initially identified as Anaxas obliqua (Plötz, 1884) (type locality not specified, likely in Southeast Brazil as deduced by genomic sequencing) reveals that it is sister to the Central American species Anaxas isidro (Grishin, 2012) (type locality in Panama) in the nuclear genome, but is genetically differentiated from it at the species level (Fig. 12), and therefore represents a new species. Despite the differences in the nuclear genome and phenotypic differences, especially in genitalia, all three species do not differ strongly in their mitochondrial genomes, e.g., COI barcodes of the new species exhibit only 0.3% (2 bp) difference from either A. isidro, or A. obliqua, which differ from each other by only 0.6% (4 bp) and do not form separate clades, despite significant genitalic differences. This new species keys to Anastrus obliqua (F.6.4) in Evans (1953), but males (female unknown) differ from A. obliqua by more prominent dark bands on the dorsal side, the lack of a lavender sheen from paler areas between the bands, rounder wings, a more prominent discal brown “wedge” from near the costa to the mid-hindwing, the ventral side heavily overscaled with pale-bluish scales in the anal area; and from A. isidro by a mostly brown ventral hindwing, overscaled with bluish-white only along its inner margin (not over the entire posterior half). Due to the partly cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly7069.13.2:G81A, aly491.2.1:C381T, aly2582.31.4:A45G, aly2582.31.4:T57C, aly127.18.2:T195A, aly536.118.2:T90T (not A), aly525.88.2:T111T (not C), aly653.3.2:C106C (not T), aly499.13.1:A51A (not G), aly1264.7.1:G400G (not A). However, the COI barcodes do not distinguish species in this group.

Barcode sequence of the holotype.

Sample NVG-18056D06, GenBank PV972540, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATCCGAACTGAACTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGACATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTACTAATTTCTAGAAGAATTGTAGAAAATGGGGCTGGTACAGGATGAACTGTTTACCCCCCTCTTTCTGCAAATATTGCACACCAAGGAGCATCAGTAGACTTAGCTATTTTTTCCCTTCATTTAGCGGGAATTTCCTCAATTCTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACTGCATTATTATTACTGCTCTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 400–401, bears the following five printed rectangular labels, four white: [ Rio Songo | Bolivia | 750 m. | Coll.Fassl ], [ DNA sample ID: | NVG-18056D06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A07 | c/o Nick V. Grishin ], [ genitalia | NVG241121–11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Anaxas songus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Bolivia: La Paz Department, Río Zongo, elevation 750 m.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Bolivia.

Potamanaxas crandama Grishin, new species

https://zoobank.org/09FD41FC-63D1-4D6E-89E1-A4979EBF1370

(Fig. 12 part, 402–405, 1151–1152)

Definition and diagnosis.

Genomic analysis of specimens from Panama initially identified as Potamanaxas cranda Evans, 1953 (Costa Rica) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.9% (19 bp), and therefore they represent a new species. This new species keys (incompletely) to “Potamanaxas thestia cranda” (E.49.8(a)) in Evans (1953), but differs from it by a nearly completely divided forewing cell spot, more weakly expressed pale spots distally from the central cream-colored spot in the middle of the forewing cell CuA₂-1A+2A; stronger dark veins towards the outer margin of the dorsal hindwing central white patch; and a terminally thicker and rounded harpe not narrowing towards its distal end, with a more robust keel at the base. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3762.2.1:C42A, aly3762.2.1:T49A, aly798.12.20:G93C, aly848.2.29:G81A, aly890.39.9:G40C; and COI barcode: T284C, C401T, C529T, A562A, T589C.

Barcode sequence of the holotype.

Sample NVG-14064F11, GenBank PV972541, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAACAGAACTTGGTAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTCCCTCTTATATTAGGAGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAATACTATTAATTTCTAGAAGTGTAGTGGAAAATGGAGCAGGTACTGGTTGAACTGTTTACCCCCCTTTATCCGCAAATATTGCCCACCAAGGTTCATCTGTAGATTTAGCTATTTTCTCCTTACATTTAGCCGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCCTTTGATCAAATACCTTTATTTATCTGAGCTGTTGGAATTACCGCTTTATTATTATTACTTTCATTGCCAGTATTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATTTAAACACATCTTTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 402–403 (genitalia Fig. 1151–1152), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PANAMA: Darien | Cana 1500m | 19.IV.1983 | leg. G.B.Small ], [ DNA sample ID: | NVG-14064F11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A07 | c/o Nick V. Grishin ], [ genitalia | NVG241121–11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Potamanaxas | crandama Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Panama, G. B. Small leg. [USNM]: 1♀ NVG-14064F10 Veraguas, Santa Fe, GPS 8.5167, −81.0833, 12-Sep-1981 (Fig. 404–405) and 1♂ NVG-14064F09 Darien, Cana, Cerro Pirre, 1500 m, GPS 7.9333, −77.7167, 3-Apr-1983.

Type locality.

Panama: Darién Province, Cana, elevation 1500 m.

Etymology.

The name is formed from the sister species name to make it longer and indicate that this new species is from Panama: crand[a] + [pan]ama. The name is treated as a noun in apposition.

Distribution.

Panama.

Potamanaxas ecuada Grishin, new species

https://zoobank.org/A29CA340-57D4-4970-BEF5-2E52172E861C

(Fig. 12 part, 406–409, 1153–1154)

Definition and diagnosis.

Genomic analysis of specimens from Ecuador initially identified as Potamanaxas louisghilli Grishin, 2015 (type locality in Costa Rica) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore they represent a new species. This new species keys (incompletely) to Potamanaxas thoria (Hewitson, 1870) (type locality in Ecuador) (E.49.4) in Evans (1953), but differs from it and other relatives by having only a small white spot on the club of the antennae, paler postdiscal spots (not dashes) on the forewing as in P. louisghilli, from which it differs by being darker, i.e., the forewing discal white band typically does not reach the inner margin, the hindwing band is shorter, and weaker or vestigial towards the inner margin, and the hindwing submarginal brown area is wider; and the terminal section of the harpe is broader and straighter. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly113.21.3:G45C, aly5.1.1:G567A, aly5.1.1:A639T, aly5.1.1:G720A, aly923.17.5:C118A; and COI barcode: T190C, A316G, A322G, A565G, A619G.

Barcode sequence of the holotype.

Sample NVG-14063H06, GenBank PV972542, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCCTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATCATTAATTGGGGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGCAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATGGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATTGTAGAAAATGGGGCAGGGACAGGTTGAACTGTTTATCCCCCCTTATCTGCCAATATTGCCCACCAAGGTTCTTCAGTAGATTTAGCTATTTTCTCCCTTCATTTAGCAGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACTGCTTTATTATTACTACTTTCATTACCTGTATTAGCAGGGGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCGGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 406–407 (genitalia Fig. 1153–1154), bears the following four printed rectangular labels, three white: [ ECUADOR: Pastaza | 25 km N Puyo 1100m | 01° 34’S, 78° 02’W | 1 Oct 1991 | D H Ahrenholz MD ], [ DNA sample ID: | NVG-14063H06 | c/o Nick V. Grishin ], [ genitalia | NVG121102–46 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Potamanaxas | ecuada Grishin ]. Paratypes: 2♂♂ and 2♀♀ from Ecuador, Pastaza, S. S. Nicolay leg. [USNM]: Puyo, 1000 m, 9-Sep-1977: 1♂ NVG-14063H05, 1♀ NVG-14063H07, and 1♀ 11-BOA-15609D04 (Fig. 408–409) and 1♂ 11-BOA-15609D03 Km 25 of Puyo–Napo Rd., 1200 m, 15-Oct-1986.

Type locality.

Ecuador: Pastaza Province, 25 km north of Puyo, elevation 1100m, GPS −1.5667, −78.0333.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the eastern side of the Andes in central Ecuador.

Potamanaxas enez Grishin, new species

https://zoobank.org/D3E0A6EA-1063-431B-8B6C-AE953BA837E3

(Fig. 12 part, 410–411, 1155–1157)

Definition and diagnosis.

Genomic analysis of specimens from Venezuela initially identified as Potamanaxas paphos Evans, 1953 (type locality Ecuador: Paramba) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 1.4% (9 bp), and therefore they represent a new species. This new species keys to “P. hirta paphos” (E.49.6(a)) in Evans (1953), but differs from it and other relatives by females (males unknown) with the forewing pale yellow band reaching the costal margin, where the band is not much narrower than in the upper region of the discal cell, and the hindwing white patch ending at the vein CuA₂ and having prominent dark veins near its discal margin, which is rounded, without white areas strongly sticking out in some cells. Due to unexplored individual variation and unknown males, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.6.21:G48A, aly728.6.21:C141T, aly3542.3.7:C145A, aly5174.1.8:C67A, aly151.22.7:C84T; and COI barcode: A40G, A283G, T373C, T490C, T581T, A631G.

Barcode sequence of the holotype.

Sample 11-BOA-15609C12, GenBank PV972543, 658 base pairs:

AACTTTATATTTTATCTTTGGAATTTGAGCGGGAATAGTGGGAACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATCATTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGTAATTGATTAGTGCCACTAATATTAGGAGCTCCAGATATAGCATTTCCACGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCTTTAATGTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTGCTAATATTGCCCACCAAGGCTCTTCAGTAGATTTAGCTATTTTTTCACTTCATTTAGCAGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGACCAAATACCTTTATTTATTTGAGCCGTAGGAATTACTGCTTTATTATTATTACTTTCACTACCTGTATTAGCGGGAGCTATTACTATATTATTAACAGATCGAAACTTAAATACATCTTTTTTTGATCCTGCGGGAGGAGGGGATCCAATTTTATATCAACATTTATTC

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 410–411 (genitalia Fig. 1155–1157), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ VENEZUELA-ARAGUA | Rancho Grande 1100m | 21 May’85 | S. S. Nicolay ], [ DNA sample ID: | 11-BOA-15609C12 | c/o Nick V. Grishin ], [ genitalia | NVG121102–67 | Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Potamanaxas | enez Grishin ]. Paratype: 1♀ NVG-2524 Venezuela, Aragua, Rancho Grande, Henry Pittier National Park nr. Maracay, 1100 m, Apr-1987, leg. Tomasz Pyrcz leg. [SMF].

Type locality.

Venezuela: Aragua, Rancho Grande, elevation 1100 m.

Etymology.

The name is derived from the country of the type locality, [V]enez[uela], and is treated as a noun in apposition.

Distribution.

Venezuela.

Potamanaxas huanca Grishin, new species

https://zoobank.org/63A858E3-BE5F-43E9-838A-E5B1F9F8A853

(Fig. 12 part, 412–413, 1158–1159)

Definition and diagnosis.

Genomic analysis of specimens from central Peru initially identified as Potamanaxas laoma cosna Evans, 1953 (type locality in Bolivia) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 3.6% (24 bp), and therefore they represent a new species. This new species keys to P. laoma laoma (E.49.10(c)) in Evans (1953), but differs from it and other relatives by a shorter doublet of pale spots distally from the central cream-yellow spot (which is larger and rounded, not concave distally) in the dorsal forewing cell CuA₂-1A+2A, resulting in a more extensive brown area between the spots; a cross-bar at an angle present in the middle of both upper and lower discal cell white spots (only upper has a bar in P. laoma cosna); both the harpe and its basal process are longer, and the harpe is bulged only slightly before turning posterodorsad. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly188.3.28:C45T, aly188.3.28:C51T, aly1260.27.1:C244G, aly1260.27.1:A245T, aly2694.18.7:G177C; and COI barcode: A166G, A199G, A229G, A541G, A565G, A628G.

Barcode sequence of the holotype.

Sample NVG-2954, GenBank PV972544, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATCATTAATTGGAGATGATCAAATCTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCCATCATAATTGGGGGATTTGGTAATTGATTGGTACCTTTAATACTAGGAGCTCCAGATATGGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCACCTTCTTTAATATTATTAATTTCCAGAAGAATCGTAGAAAATGGGGCAGGTACAGGTTGAACTGTTTACCCCCCCCTATCTTCTAATATTGCCCATCAAGGTTCTTCAGTTGACTTAGCTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCCCTATTCATTTGAGCTGTGGGAATTACTGCCTTATTATTATTGCTCTCATTACCTGTATTAGCAGGGGCTATCACTATACTATTAACTGATCGAAATTTAAATACATCTTTTTTTGACCCGGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 412–413 (genitalia Fig. 1158–1159), bears the following four printed rectangular labels, three white: [ Huanoabamba | C.Peru 1500 m | Coll. Fassl ], [ DNA sample ID: | NVG-2954 | c/o Nick V. Grishin ], [ genitalia | NVG241220–10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Potamanaxas | huanca Grishin ]. Paratype: 1♂ NVG-2952 data as the holotype.

Type locality.

Peru: Pasco Region, Huancabamba, elevation 1500 m.

Etymology.

The name is derived from the type locality and the Huanca (Wanka) people who lived in the highlands of central Peru, like this species. The name is treated as a noun in apposition.

Distribution.

The Andes of central Peru.

Potamanaxas quigga Grishin, new species

https://zoobank.org/AE96CA9E-AD88-40DF-9748-09F9602607E9

(Fig. 12 part, 414–415, 1160–1162)

Definition and diagnosis.

Genomic analysis of specimens from Colombia and Ecuador initially identified as Potamanaxas trigga Evans, 1953 (type locality in northern Peru) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.0% (13 bp), and therefore they represent a new species. This new species keys to “P. laoma trigga” (E.49.10(d)) in Evans (1953), but differs from it and other relatives by being darker, e.g., the doublet of paler spots distally from the round central spot in the dorsal forewing cell CuA₂-1A+2A is nearly replaced by a brown-violet area, the dorsal hindwing discal spot is almost reduced to a yellow bar with pale shading distally, and the postdiscal row of brown spots is better developed on the ventral hindwing; the basal process of the harpe is longer, and the valva is more strongly humped at the costa from the ampulla region. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly386.12.9:C114T, aly386.12.9:A516G, aly164.14.11:G33A, aly1500.3.4:G72A, aly1500.3.4:T117G; and COI barcode: A214A, T247C, A271A, 346C, T581C, A628G.

Barcode sequence of the holotype.

Sample NVG-14064G04, GenBank PV972545, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATCATAATTGGGGGGTTTGGTAATTGATTAGTACCCTTAATACTAGGAGCTCCAGATATAGCATTCCCACGAATAAACAATATAAGATTTTGACTTTTACCACCTTCTTTAATATTATTAATTTCCAGAAGAATCGTAGAAAATGGGGCGGGTACAGGTTGAACTGTTTACCCTCCCCTATCTTCTAATATTGCCCATCAAGGTTCTTCAGTTGACTTAGCTATTTTTTCCCTTCATTTAGCGGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCCCTATTCATTTGAGCTGTGGGAATTACTGCCTTATTACTATTACTTTCATTACCTGTATTAGCGGGAGCTATCACTATATTACTAACCGATCGAAATTTAAATACATCTTTTTTTGACCCAGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 414–415 (genitalia Fig. 1160–1162), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Sucre, 4300’ | Caqueta, Colombia | 23 Jan. ’71 | S.S.Nicolay ], [ genitalia | ♂ slide/vial # | H752 | Prep. S.S. Nicolay ], [ DNA sample ID: | 11-BOA-15609B01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-14064G04 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Potamanaxas | quigga Grishin ]. Both DNA sample IDs refer to leg samples; DNA from the latter was sequenced. Paratypes: 3♂♂ and 1♀ from Ecuador: 1♂ NVG-14064G07 Napo, Hollin-Loreto Rd., Km 16, 1200 m, 22-Sep-1990, S. S. Nicolay leg., genitalia NVG121102–76 [USNM]; 1♂ NVG-15024G04 Oriente, Sadzayacu, Jun-1968, R. de Lafebre leg. [MGCL]; and Morona-Santiago: 1♀ NVG-14064G12 Río Abanico, 1600 m, GPS −2.2617, −78.2033, Sep-2002, I. Aldas leg., genitalia NVG120922–04 [USNM] and 1♂ NVG-18041H06 Macas, el Retiro, 1900 m, GPS −2.200, −78.317, 30-Jul-2010, J.-C. Petit leg. [SMF].

Type locality.

Colombia: Caquetá Department, Sucre, elevation 4300’.

Etymology.

The name is a fusion of the names of the two relatives: qui[ra] + [tri]gga and is treated as a noun in apposition.

Distribution.

Colombia and Ecuador.

Festivia festi Grishin, new species

https://zoobank.org/8DEF49E5-9660-4E7C-97A3-D70370B92B23

(Fig. 12 part, 416–417, 1163–1164)

Definition and diagnosis.

Genomic analysis of specimens from Panama initially identified as Festivia festiva (Erichson, [1849]) (type locality in Guyana) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 6.4% (42 bp), and therefore they represent a new species. This new species keys to “Sostrata festiva” (E.42.2) in Evans (1953), but differs from it and other relatives by smaller dark spots on the ventral hindwing that are fewer in number, typically smaller hyaline spots on the forewing, and a broader harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.53.4:T54A, aly528.4.10:C9T, aly2532.13.1:A99G, aly853.5.1:G115A, aly276890.9.2:C67A; and COI barcode: T25C, T59C, T484C, T544C, T581C.

Barcode sequence of the holotype.

Sample NVG-18031H04, GenBank PV972546, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGAAATCCTGGCTCTTTAATTGGGGATGATCAAATTTACAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATCGGAGGATTTGGAAATTGACTAGTTCCTCTTATGTTGGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATAAGATTTTGATTATTACCCCCCTCATTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACCGTATACCCCCCTCTTTCTGCTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTCTTGGGGCTATTAATTTTATCACAACAATTATTAATATACGTATTAGAAATTTATCCTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATTACTGCATTATTATTATTACTCTCACTACCAGTATTAGCAGGAGCTATTACAATATTACTAACAGATCGTAATTTAAATACATCTTTCTTTGACCCAGCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 416–417 (genitalia Fig. 1163–1164), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA: Darien | Cana 400m | 2.VII.1981 | leg. G.B.Small ], [ DNA sample ID: | NVG-18031H04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A08 | c/o Nick V. Grishin ], [ genitalia | NVG241121–12 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466106 ], and one red [ HOLOTYPE ♂ | Festivia festi | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 2♀♀ from Panama [MGCL]: 1♀ NVG-15094H01 Darien, Darien National Park, slope of Cerro Pirre, 575 m, GPS 7.9966, −77.7121, 3-Apr-2015, J. R. MacDonald leg.; 1♀ NVG-15094H02 Colón, Pina, 200 m, 16-Feb-1973, H. L. King leg.; 1♂ NVG-15094H07 Panama (no details), 15-Jun-1970, H. L. King leg.

Type locality.

Panama: Darién Province, Cana, elevation 400 m.

Etymology.

The name is from the sister species made shorter for the more northern relatives and is treated as a noun in apposition.

Distribution.

Panama.

Festivia hannah Grishin, new species

https://zoobank.org/99980CB8-F228-4FCA-9DEC-21BFF49C09FF

(Fig. 12 part, 418–419, 1165–1166)

Definition and diagnosis.

Genomic analysis of specimens from Colombia initially identified as Festivia jinna (Evans, 1953) (type locality Colombia: Cauca, Corinto) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore they represent a new species. This new species keys to “Sostrata jinna” (E.42.6) in Evans (1953), but differs from it and other relatives by the following combination of characters: two (upper and lower) small spots in the cell CuA₂-1A+2A on the ventral forewing, which are absent or barely traceable in F. jinna; no discal brown spot on the ventral hindwing; the blue at the base of the ventral hindwing that is less extensive than in F. jinna; a smaller forewing discal cell spot; a broader discal band of blue scales on the dorsal hindwing; the forewing hyaline spots in the cells M₃-CuA₁ and CuA₁-CuA₂ are closer to each other than in F. jinna; bluish marginal spots on the hindwing (vestigial or absent in F. jinna); and a relatively shorter and terminally broader harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2487.17.2:T51C, aly2487.17.2:A93G, aly2127.3.2:A42G, aly536.211.7:G129T, aly1283.1.3:C132T; and COI barcode: A49C, C238T, A328G, T361C, A643G.

Barcode sequence of the holotype.

Sample NVG-21116D03, GenBank PV972547, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCCCTAAGAATATTAATTCGAACTGAATTAGGAAACCCCGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATCCCACTTATACTAGGAGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAATATTGTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGTACTGGGTGAACTGTTTACCCCCCTCTTTCTGCAAATATCGCTCACCAGGGTTCCTCTGTAGATTTAGCTATTTTTTCATTACACTTAGCTGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCACTATTATTATTACTCTCACTACCAGTATTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATCTAAATACTTCCTTTTTTGACCCCGCAGGAGGGGGAGATCCTATTTTGTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 418–419, bears the following five rectangular labels (2^nd handwritten, others printed), four white: [ Columb. | K. ], [ Pythonides | Adaman- | tinus Mab ], [ Coll. | Staudinger ], [ DNA sample ID: | NVG-21116D03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Festivia hannah | Grishin ]. Paratype: 1♂ NVG-15034C06 (leg, DNA sequenced), NVG-23078F04 (abdomen, DNA stored) data as the holotype, genitalia NVG240912–06 (Fig. 1165–1166), also labeled as “Origin.” (i.e., a type specimen) of Pythonides adamantinus, but it is not a syntype of this taxon because it is from Colombia and not from Bolivia.

Type locality.

Colombia.

Etymology.

The name of the sister species jinna may have Hebrew origins and could have been derived from Joanna (Yohanna), which is believed to mean God is gracious or gift of God. A related name Hannah (ןח) means grace or favor and is chosen as the species epithet for a relative of F. jinna. The name is a feminine noun in apposition.

Distribution.

Colombia.

Festivia tolima Grishin, new species

https://zoobank.org/B7EE5127-4102-48C2-BDBE-CCDA77183078

(Fig. 12 part, 420–421, 1167–1169)

Definition and diagnosis.

Genomic analysis of specimens from Colombia initially identified as Festivia jinna (Evans, 1953) (type locality Colombia: Cauca, Corinto) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.9% (19 bp), and therefore they represent a new species. This new species keys to “Sostrata jinna” (E.42.6) in Evans (1953), but differs from it and other relatives by females with a dark small discal spot on the ventral hindwing and a doublet of small spots in the cell CuA₂-1A+2A of the ventral forewing; the two spots in the cell CuA₁-CuA₂ of the ventral forewing are connected with each other; a more extensive blue overscaling at the base of the ventral forewing, as in F. jinna, and no blue marginal spots on the dorsal hindwing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1329.4.2:A138T, aly1407.8.9:G92C, aly923.3.5:C15T, aly10226.34.2:C69G, aly499.7.5:T81C; and COI barcode: C220T, T322C, A331G, T346T, T391C, T436C, G628A.

Barcode sequence of the holotype.

Sample NVG-15042H04, GenBank PV972548, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGAATATTAATTCGAACTGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTCACAGCTCATGCCTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATCCCACTTATATTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAATATTGCTAATTTCAAGAAGAATTGTAGAAAATGGGGCTGGCACTGGATGGACTGTTTACCCCCCTCTTTCTGCAAATATTGCTCACCAGGGTTCCTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCAATTCTTGGAGCCATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTGGGAATTACAGCATTACTATTATTACTTTCTCTACCAGTATTAGCTGGGGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 420–421 (genitalia Fig. 1167–1169), bears the following six printed rectangular labels, five white: [ COLOMBIA: TOLIMA | La Marina area, Rio | Ambeima, 1400 m. | 6.vi.1974 | S. & L. Steinhauser ], [ A. C. Allyn | Acc. 1974–23 ], [ DNA sample ID: | NVG-15042H04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24065A07 | c/o Nick V. Grishin ], [ genitalia | NVG241111–15 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Festivia tolima | Grishin ]. The first DNA sample ID refers to the extraction from a leg and the second from the abdomen (both sequenced to improve the quality of the dataset), followed by genitalia dissection. Paratype: 1♀ NVG-15042H05 (leg, DNA sequenced, poor quality dataset), NVG-24127F11 (abdomen, DNA sequenced) the same data as the holotype but 1600–1900 m, 12-Jun-1974, genitalia NVG250720–30.

Type locality.

Colombia: Tolima Department, Río Ambeima, La Marina area, 1400 m.

Etymology.

The name is derived from the department of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Tolima, Colombia.

Lectotype designation for Sostrata pusilla Godman and Salvin, 1895

Sostrata pusilla Godman and Salvin, 1895 was described from four specimens from Nicaragua, Panama, and Brazil (Godman and Salvin 1895). To stabilize nomenclature, clarify the type locality, and define the name S. pusilla objectively, N.V.G. hereby designates the syntype in the BMNH collection that, according to its label, was illustrated by Godman and Salvin (1895), the male that bears the following ten labels (first two and the last round, others rectangular; first two with a red circle on one side, last yellow, others white; last handwritten, others printed): ( Type ), ( Type ) and on the other side of this label handwritten ( H | 828 ), [ Bugaba, | 800–1300 ft | Champion. ], [ ♂ ], [ Type. | Sp. figured. ], [ B.C.A.Lep.Rhop. | Sostrata | pusilla, | G.&S. ], [ Godman-Salvin | Coll. 1912.—23. ], [ ], genitalia are glued to this label, [ BMNH(E) 1669570 ], ( 711 ) as the lectotype of Sostrata pusilla Godman and Salvin, 1895. The lectotype has nicks on both forewings at the end of the costal fold. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of S. pusilla becomes Panama: Chiriquí Province, Bugaba, elevation 800–1300 ft, approx. GPS 8.467, −82.633 (Selander and Vaurie 1962).

Three new species related to Sostrata pusilla Godman and Salvin, 1895

Genomic analysis of specimens initially identified as Sostrata pusilla Godman and Salvin, 1895 (type locality in Panama: Chiriquí) reveals that they partition into four clades genetically differentiated at the species level (Fig. 11); e.g., their COI barcodes differ by 2.4%–3.3% (16–22 bp). The first clade includes specimens from Costa Rica, Venezuela and Ecuador and corresponds to S. pusilla, including its subspecies Sostrata pusilla pulsa Evans, 1953 (type locality in Ecuador: Zamora). The other three clades correspond to new species that are described below. The second clade is sister to S. pusilla in the nuclear genome and consists of a specimen from Guyana. The third clade is sister to the fourth clade and consists of specimens from Rondônia, Brazil. The fourth clade is represented by a specimen from southeastern Peru.

Sostrata guyata Grishin, new species

https://zoobank.org/41C0932D-3F53-4B1F-81C7-B82920766713

(Fig. 12 part, 422–423, 1170–1172)

Definition and diagnosis.

This new species from Guyana corresponds to the second clade related to Sostrata pusilla Godman and Salvin, 1895 (type locality in Panama: Chiriquí) (Fig. 12) and keys to its nominate subspecies (E.42.8(a)) in Evans (1953), but differs from it and other relatives by the absence of semihyaline spots on the forewing, a less contrasting brown spots on the underside of both wings, a slightly concave dorsoposterior margin of the harpe, a thicker and longer dorsal bent-inward tooth of the harpe, a shorter and rather straight (only slightly bent inward) tooth of the ampulla, and the uncus with nearly parallel sides. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1265.12.2:T114C, aly1265.12.2:G135A, aly235.2.3:A60G, aly12063.20.5:G423A, aly21.5.3:G57A, aly461.13.2:T405T (not C), aly461.13.2:C458C (not G), aly461.13.2:C566C (not G), aly1849.16.1:G120G (not A), aly347.6.2:T42T (not C); and COI barcode: T5C, T70C, T121C, C220T, A316G, T403A.

Barcode sequence of the holotype.

Sample NVG-18032A08, GenBank PV972549, 658 base pairs:

AACACTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGTTTATTAATTCGAACCGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCCCTTATATTAGGGGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGTTGAACTGTTTACCCACCTTTGTCTGCTAACATTGCTCACCAAGGATCATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATCACTACAATTATTAATATACGTATTACAAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTATTATTATTACTATCACTACCAGTACTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTCGATCCAGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 422–423 (genitalia Fig. 1170–1172), bears the following six printed rectangular labels, five white: [ GUYANA: Two Hat Mt, | E.Kanukus, S.Rupununi, | S. Slope summit 2300–2600’ | 23–28.IX.2000 | 3° 8.8’N 59° 6.9’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-18032A08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A09 | c/o Nick V. Grishin ], [ genitalia | NVG241121–13 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00283570 ], and one red [ HOLOTYPE ♂ | Sostrata guyata | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana: Eastern Kanuku Mountains, Two Hat Mountain south slope summit, elevation 2300’– 2600’, GPS 3.1467, −59.1150.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Guyana.

Sostrata rondata Grishin, new species

https://zoobank.org/C7191A61-7565-4F6B-A479-AF45A8A5605B

(Fig. 12 part, 424–425, 1173–1175)

Definition and diagnosis.

This new species from Rondônia, Brazil corresponds to the third clade related to Sostrata pusilla Godman and Salvin, 1895 (type locality in Panama: Chiriquí) (Fig. 12) and keys to its nominate subspecies (E.42.8(a)) in Evans (1953), but differs from it and other relatives by the near absence of semihyaline spots on the forewing (there is a trace of an apical spot), paler brown coloration between the bands in the posterior half of the ventral hindwing, a slightly concave dorsoposterior margin of the harpe, a thinner and shorter dorsal bent-inward tooth of the harpe, a much larger and turning inward tooth of the ampulla, and the uncus with nearly parallel sides. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly499.41.3:A91C, aly330.11.2:G529C, aly330.11.2:A1377T, aly2095.1.11:A61T, aly2095.1.11:T120C; and COI barcode: A160G, T226C, A373G, T374G, T530C, T589C.

Barcode sequence of the holotype.

Sample NVG-18032A11, GenBank PV972550, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGTTTATTAATTCGGACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATCATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGGGCCCCTGACATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCACCTTTATCTGCTAATATTGCCCACCAAGGGGCATCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATCACTACTATTATTAACATACGTATTACAAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCACTATTATTATTACTATCACTACCAGTACTAGCAGGTGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGACCCAGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 424–425 (genitalia Fig. 1173–1175), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRAZIL: Rondônia | 8 km N of Cacaulândia | 10° 30’S, 62° 52’W | 5 Nov 1989 190m | leg DH Ahrenholz | SS Nicolay curator ], [ DNA sample ID: | NVG-18032A11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–14 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466123 ], and one red [ HOLOTYPE ♂ | Sostrata rondata | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Brazil, Rondônia, 62 km S Ariquemes [MGCL]: 1♂ NVG-15043A11, linha C-10, 5 m S of Cacaulândia, 18-May-1996, O. Gomes leg. and 1♀ NVG-23055C08 linha C-20, 10 km E B-65, 3 km E of Fazenda Rancho Grande, 15-Nov-1992, G. T. Austin leg.

Type locality.

Brazil: Rondônia, 8 km north of Cacaulândia, elevation 190 m, approx. GPS −10.500, −62.867.

Etymology.

The name is derived from the Brazilian state of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Rondônia, Brazil.

Comment.

Geographic coordinates given on the label of the holotype point to a locality approximately 17.5 km south of Cacaulândia, thus being inconsistent with the locality stated in words.

Sostrata peruata Grishin, new species

https://zoobank.org/87E828D2-FEE3-4B67-B09D-544A30A75425

(Fig. 12 part, 426–427, 1176–1178)

Definition and diagnosis.

This new species from Peru corresponds to the fourth clade related to Sostrata pusilla Godman and Salvin, 1895 (type locality in Panama: Chiriquí) (Fig. 12) and keys to its nominate subspecies (E.42.8(a)) in Evans (1953), but differs from it and other relatives by the facies most similar to Sostrata guyata, new species, a slightly concave dorsoposterior margin of the harpe, a dorsal bent-inward tooth of the harpe of intermediate thickness and length, a shorter and spike-like tooth of the ampulla, and a terminally broader uncus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly275209.4.2:G162A, aly127.27.6:G1131A, aly412.4.18:A62G, aly60.20.3:T63C, aly6841.17.2:T213C, aly330.11.2:G529G (not C), aly330.11.2:A1377A (not T), aly2095.1.11:A61A (not T), aly2095.1.11:T120T (not C), aly320.14.3:G123G (not A); and COI barcode: T5C, T103C, T292C, T403A, A562G, T565C.

Barcode sequence of the holotype.

Sample NVG-18032A10, GenBank PV972551, 658 base pairs:

AACACTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGTTTATTAATTCGGACTGAATTAGGAAATCCAGGATCTTTAATTGGTGACGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTAATACCAATTATAATTGGGGGATTTGGAAATTGATTAATTCCCCTTATATTAGGAGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCATTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTACCCACCTTTGTCTGCTAACATTGCTCACCAAGGATCATCTGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATCACTACAATTATTAACATACGTATTACAAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTATTATTATTATTATCACTACCAGTACTAGCGGGCGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 426–427 (genitalia Fig. 1176–1178), bears the following six printed rectangular labels, five white: [ PERU: Madre de Dios | Parque Manu, Pakitza | 12°07’ 70°58’, 400m | 16 Sept 1989 | Leg. R. Robbins ], [ DNA sample ID: | NVG-18032A10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–15 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466122 ], and one red [ HOLOTYPE ♂ | Sostrata peruata | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Madre de Dios Region, Manu National Park, Pakitza, elevation 400 m, approx. GPS −12.1167, −70.9667.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Amazonian region of southeastern Peru.

Gorgythion centralina Grishin, new species

https://zoobank.org/C43EC507-5BB3-421D-8EC5-55A745181CFD

(Fig. 12 part, 428–429, 1181–1182)

Definition and diagnosis.

Genomic analysis of specimens from Mexico and Central America initially identified as Gorgythion begga pyralina (Möschler, 1876) (type locality in Suriname) reveals that they are not monophyletic with it and are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore they represent a new species. This new species keys to G. begga pyralina (E.36.1(a)) in Evans (1953) and was included by him in this species, but differs from it and other relatives by the following combination of characters: the ventral hindwing without whitish spots and dashes but with a paler background on which all the spots of the bands are paler in the middle, a paler dorsal hindwing with a well-developed paler irregular area between the postdiscal and submarginal dark bands, a larger pale area separating the dark triangle at the forewing tornus from the postmedial dark patch (in Gorgythion vox Evans, 1953 (type locality in Guatemala), the pale line separating the dark triangle is narrow and smooth), a frequently violet flush (absent in G. vox), more pointed forewings (rounder in G. vox), a smoothly curved ventral margin of the left harpe, and a smaller, shorter ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly767.12.12:A756G, aly84.5.6:A909G, aly977.1.2:C48T, aly731.17.7:G54A, aly1283.1.52:G1311T; and COI barcode: T172C, 238T, T349C, T379A, T553C, T578C.

Barcode sequence of the holotype.

Sample NVG-15043G06, GenBank PV972552, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGGTTTGGAAATTGACTTGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTCTCAGCCAATATTGCTCATCAAGGAGCATCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTACTATTATCATTACCCGTTTTAGCAGGTGCTATTACTATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 428–429, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ GUATEMALA: SANTA | ROSA: Guazacapan | ex coll: E. LeMoult | 16.xi.1922 ], [ A. C. Allyn | Acc. 1968–1 ], [ DNA sample ID: | NVG-15043G06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gorgythion | centralina Grishin ]. Paratypes: 2♂♂ and 1♀: 1♀ NVG-20057C12 Mexico, Chiapas, no other data [TMMC]; 1♂ NVG-5001 Guatemala, Peten, Finca Ixobel S of Poptun, 1700 ft, GPS 16.3039, −89.4222, 5–10-Jun-2003, R. Leuschner leg., genitalia NVG151101–52 (Fig. 1181–1182) [USNM]; and 1♂ NVG-15043G07 El Salvador, La Perla, Litoral Km 66, 31-Dec-1972, S. and L. Steinhauser leg. [MGCL].

Type locality.

Guatemala: Santa Rosa, Guazacapán.

Etymology.

The name refers to the Central American distribution of this species and formed to rhyme with pyralina, the name of its relative it was misidentified as. The name is treated as a noun in apposition.

Distribution.

Currently known from southern Mexico to El Salvador.

Comment.

For comparison, we illustrate male genitalia of G. vox NVG-20054G03 from Panama: Panama, Gamboa, ca. 45 m, GPS 9.1118, −79.6879, 18-May-2012, J. R. MacDonald leg., genitalia RAA 0676 [MEM] (Fig. 1179–1180), and G. begga pyralina NVG-4978 from French Guiana: Montravel, GPS 4.9167, −52.2667, 4-Dec1993, Don J. Harvey leg., genitalia NVG151101–29 [USNM] (Fig. 1185–1186).

Gorgythion canalina Grishin, new species

https://zoobank.org/688442EC-E9F7-41D3-B603-C5AADB7E5566

(Fig. 12 part, 430–431, 1183–1184)

Definition and diagnosis.

Genomic analysis of specimens from central Panama initially identified as Gorgythion begga pyralina (Möschler, 1876) (type locality in Suriname) reveals that they are not monophyletic with it and are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore they represent a new species. This new species keys to G. begga pyralina (E.36.1(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a paler pattern in the distal part of the ventral hindwing with whitish spots and dashes, a darker submarginal area of the dorsal hindwing that is usually without paler spots (except the tornal spot), a larger pale area separating the dark triangle at the forewing tornus from the postmedial dark patch (in Gorgythion vox Evans, 1953 (type locality in Guatemala), the pale line separating the dark triangle is narrow and smooth), a frequently violet flush (absent in G. vox), more pointed forewings (rounder in G. vox), a smoothly curved ventral margin of the left harpe, and a larger, longer ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2379.29.8:C109T, aly2111.2.4:G63A, aly2111.2.4:G75A, aly3744.1.2:C19T, aly2555.7.1:A540C; and COI barcode: T172C, 238C, T349C, T379A, T553C, T578T.

Barcode sequence of the holotype.

Sample NVG-15101A01, GenBank PV972553, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGGTTTGGAAATTGACTTGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTCTCAGCCAATATTGCTCATCAAGGAGCATCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTACTATTATCATTACCCGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 430–431 (genitalia Fig. 1183–1184), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ Cocoli, | Panama C. Z. | XII-23–72 | G. B. Small ], [ DNA sample ID: | NVG-15101A01 | c/o Nick V. Grishin ], [ genitalia | NVG121102–33 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gorgythion | canalina Grishin ]. Paratypes: 12♂♂ and 2♀ from Panama: Colón, Gatun, West Creek Trail, ca. 30 m, GPS 9.2538, −79.9403, J. R. MacDonald leg. [MEM]: 1♂ NVG-20054F11, 10-Feb-2012, genitalia RAA 0675; 1♂ NVG-20054G06, 10-Feb-2012, genitalia RAA 0673; 1♂ NVG-20054G05, 19-May-2012; and 1♀ NVG-20054G02, 26-Aug-2012; Canal Zone: Farfan: 1♂ NVG-15043F06, 24-Feb-1970, ex coll. Jae [MGCL] and 1♀ NVG-15101A02 13-Dec-1967, S. S. Nicolay leg., genitalia NVG121102–34 [USNM]; and Ft. Sherman: 1♂ NVG-15101A04 10-Oct-1963, G. B. Small leg., genitalia NVG121102–85 [USNM] and 1♂ NVG-2090 Black Tank Rd. Jun-1976, R. MacDonald leg., genitalia RAA 0671 [MEM]; Colón, Santa Rita Arriba, ca. 250 m, GPS 9.3266, −79.7816, J. R. MacDonald leg. [MEM]: 1♂ NVG-20054F10 26-Aug-2012 and 1♂ NVG-2088 24-Feb-2012, genitalia RAA 0677; Panama, J. R. MacDonald leg. [MEM]: 1♂ NVG-2071 Veracruz, Howard Palm Jungle, ca. 40 m, GPS 8.9074, −79.6105, 2-Jul-2013, genitalia RAA 0810; 1♂ NVG-2089 5 km S of Bayano Lake Bridge, 100 m, GPS 9.1745, −78.7427, 29-May-2009, genitalia RAA 0672; and 1♂ NVG-20054G04 ca 12 km E of Bayano Bridge, ca. 80 m, GPS 9.1532, −78.6928, 12-Jul-2013; and 1♂ NVG-20054G01 Darién, Cerro Chucanti, 875 m, GPS 8.7893, −78.4515, 15-Feb-2012, J. R. MacDonald leg. [MEM].

Type locality.

Panama: Panamá Oeste Province, Cocolí.

Etymology.

The name refers to the distribution of this species centered around the Panama Canal area to rhyme with pyralina, the name of its relative it was misidentified as. The name is treated as a noun in apposition.

Distribution.

Currently known only from central Panama.

Comment.

For comparison, we illustrate male genitalia of G. vox NVG-20054G03 from Panama: Panama, Gamboa, ca. 45 m, GPS 9.1118, −79.6879, 18-May-2012, J. R. MacDonald leg., genitalia RAA 0676 [MEM] (Fig. 1179–1180) and G. begga pyralina NVG-4978 from French Guiana: Montravel, GPS 4.9167, −52.2667, 4-Dec-1993, Don J. Harvey leg., genitalia NVG151101–29 [USNM] (Fig. 1185–1186).

Gorgythion ayas Grishin, new species

https://zoobank.org/437A160D-0472-4B6F-B46F-6D5C4473C5B2

(Fig. 12 part, 432–433, 1187–1188)

Definition and diagnosis.

Genomic analysis of specimens from western Ecuador initially identified as Gorgythion begga begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) reveals that they are not monophyletic with it and are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore they represent a new species. This new species keys to G. begga begga (E.36.1(b)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a more extensive white area (no yellow overcast) covering more than half of the ventral hindwing with more extensive dark scaling along the margin and less developed intrusion of the postdiscal brown band of spots into this white area than in relatives, a better defined intricate whitish pattern along the outer margin of the ventral forewing, including the submarginal area, a wider pale area of the dorsal hindwing between the discal and postdiscal dark bands, a smoothly curved ventral margin of the left harpe, which is broader in the middle, and a narrower, shorter ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly168.4.6:C114T, aly145.12.7:G138C, aly87.14.6:C81G, aly727.19.3:G120T; and COI barcode: T49C, A184G, T349C, 400T, T505C, T526C.

Barcode sequence of the holotype.

Sample NVG-4990, GenBank PV972554, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCCTTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAAATTGACTTGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTCTCAGCCAATATTGCCCATCAAGGAGCATCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCATTATTCGTTTGAGCAGTAGGTATTACCGCATTACTTTTACTATTATCATTACCTGTTTTAGCAGGTGCTATTACTATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 432–433 (genitalia Fig. 1187–1188), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ ECUADOR-Guayas | Naranjal-750m | 19–24 Sept.1976 | leg S.S. Nicolay ], [ DNA sample ID: | NVG-4990 | c/o Nick V. Grishin ], [ genitalia | NVG151101–41 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gorgythion | ayas Grishin ]. Paratype: 1♀ NVG-4991 data as the holotype, genitalia NVG151101–42.

Type locality.

Ecuador: Guayas, Naranjal, elevation 750 m.

Etymology.

The name is derived from the type locality in [Gu]ayas and is treated as a noun in apposition.

Distribution.

Currently known only from western Ecuador

Gorgythion calima Grishin, new species

https://zoobank.org/775E8124-CEC1-4B88-89AF-55783285425D

(Fig. 12 part, 434–437, 1189–1190)

Definition and diagnosis.

Genomic analysis of specimens from western Colombia initially identified as Gorgythion begga begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) reveals that they are not monophyletic with it and are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 3.5% (23 bp), and therefore they represent a new species. This new species keys to G. begga begga (E.36.1(b)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a more extensive white area (no yellow overcast) covering more than half of the ventral hindwing and nearly reaching the margin and separated from it by a dark-brown line near the tornus, some elements of the whitish pattern along the outer margin of the ventral forewing, including the submarginal and tornal area in females (males without this pattern), a darker dorsal hindwing with a dark brown nearly unspotted distal half, a narrower left harpe in the middle, where its ventral margin is convex, a larger and longer ampulla, and a shorter, more stout, and rounded basal tooth of the left harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly159.10.6:G51T, aly159.10.6:C84T, aly1222.14.30:C108T, aly1222.14.30:C753T, aly1651.12.11:C96T; and COI barcode: C46T, T112C, A184G, A202T, T223A, T346C, T442C, T536C.

Barcode sequence of the holotype.

Sample NVG-4985, GenBank PV972555, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAAATTGACTTGTTCCATTAATATTAGGAGCTCCAGATATAGCATTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTATCCACCCCTTTCAGCTAATATTGCCCATCAAGGAGCATCTGTAGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACCGCATTACTTCTATTATTATCATTGCCTGTTTTAGCAGGTGCTATTACCATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 434–435 (genitalia Fig. 1189–1190), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ COLOMBIA:Dept. Valle | Calima Sam, 1000m | long. 76°34’, lat. 3°53’ | Jan.25 −1992 | J. Bolling Sullivan ], [ DNA sample ID: | NVG-4985 | c/o Nick V. Grishin ], [ genitalia | NVG151101–36 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gorgythion | calima Grishin ]. Paratype: 1♀ NVG-4986 data as the holotype, genitalia NVG151101–37 (Fig. 436–437).

Type locality.

Colombia: Valle del Cauca, Calima Dam, elevation 1000 m, GPS 3.8833, −76.5667.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from western Colombia.

Gorgythion lorina Grishin, new species

https://zoobank.org/274B008E-4899-43D2-AAC6-DB223972B4B4

(Fig. 12 part, 438–439, 1191–1192)

Definition and diagnosis.

Genomic analysis of a specimen from northeastern Peru initially identified as Gorgythion begga pyralina (Möschler, 1877) (type locality in Suriname) reveals that it is not monophyletic with it, being sister to the previously described new species, and is genetically differentiated at the species level (Fig. 12); e.g., their COI barcodes differ by 1.8% (12 bp), and therefore this specimen represents a new species. This new species keys to G. begga pyralina (E.36.1(a)) in Evans (1953), but differs from it and other relatives by a darker ventral hindwing without whitish spots and dashes, a paler dorsal hindwing with a well-developed paler irregular area between the postdiscal and submarginal dark bands, which are better defined and stand out more strongly on the paler ground color on both sides of the wings, a larger pale area separating the dark triangle at the forewing tornus from the postmedial dark patch (in Gorgythion vox Evans, 1953 (type locality in Guatemala), the pale line separating the dark triangle is narrow and smooth), some violet flush (absent in G. vox), more rounded forewings, a narrower left harpe in the middle, where its ventral margin is convex, a larger ampulla, and a shorter, but pointed, basal tooth of the left harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly798.8.12:G81A, aly234.28.2:C183T, aly234.28.2:C109T, aly967.1.5:C78T, aly6034.6.2:G90T, aly640.7.2:T48T (not C), aly814.1.4:C15C (not T), aly671.12.4:T166T (not A), aly671.12.4:C167C (not A), aly525.26.8:C87C (not T); and COI barcode: A208G, C220T, T223T, A316T, T526C, T574C, T646C.

Barcode sequence of the holotype.

Sample NVG-4999, GenBank PV972556, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTGTACCATTGATATTAGGAGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCACCTCTTTCAGCTAATATTGCCCATCAAGGAGCATCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACCGCATTACTTTTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 438–439 (genitalia Fig. 1191–1192), bears the following four printed rectangular labels, three white: [ PERU, Loreto | Puerto Almendra | Rio Nanay, 120m | 03°50’S, 73°23’W | 2 Sept 1995 | Leg. R. Robbins ], [ DNA sample ID: | NVG-4999 | c/o Nick V. Grishin ], [ genitalia | NVG151101–50 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gorgythion | lorina Grishin ].

Type locality.

Peru: Loreto Region, Puerto Almendra, Río Nanay, elevation 120 m, approx. GPS −3.833, −73.383.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northeastern Peru.

Gorgythion cerrada Grishin, new species

https://zoobank.org/F4F81BBD-095C-43E1-8289-89759DB77A82

(Fig. 12 part, 440–441, 1193–1195)

Definition and diagnosis.

Genomic analysis of a specimen from central Brazil initially identified as Gorgythion canda Evans, 1953 (type locality in Paraguay) reveals that it is genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore this specimen represents a new species. This new species keys to G. canda (E.36.3) in Evans (1953), but differs from it and other relatives by the lack of a paler spot near the costal margin just distad the middle of the forewing, smaller hyaline subapical forewing spots, a darker dorsal hindwing with broader submarginal dark spots, and a less developed paler pattern in the submarginal area of the ventral hindwing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly378.25.6:C60T, aly1244.14.2:G447A, aly331.33.2:A254G, aly50.32.2:T198C, aly204.3.9:A24G; and COI barcode: C46C, T85T, T220T, A415A, T418T, T428C, A547C, T646T.

Barcode sequence of the holotype.

Sample NVG-5000, GenBank PV972557, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTGTACCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTCTTTCAGCTAATATTGCTCATCAAGGAGCATCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCCTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 440–441 (genitalia Fig. 1193–1195), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ 20 kil. N. Sao Joao da | Alianca, Go., Brazil | April 13, 1956 | F. S. Truxal ], [ MACHRIS BRAZILIAN | EXPEDITION - 1956 | LOS ANGELES | COUNTY MUSEUM ], [ Gorgythion | b. vox ♀ | Det. E | S.S. Nicolay ], [ DNA sample ID: | NVG-5000 | c/o Nick V. Grishin ], [ genitalia | NVG151101–51 | Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Gorgythion | cerrada Grishin ].

Type locality.

Brazil: Goiás, 20 km north of São João d’Aliança.

Etymology.

Cerrado biome is the predominant ecosystem of Central Brazil, where this species is found. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Central Brazil.

Camptopleura mexicanes Grishin, new species

https://zoobank.org/81E32D38-D28C-43C1-9D05-A19E98FF684A

(Fig. 12 part, 442–443, 1196–1198)

Definition and diagnosis.

Genomic analysis of specimens from southern Mexico initially identified as Camptopleura theramenes Mabille, 1877 (type locality Colombia: Bogotá) reveals that they are genetically differentiated from it at the species level (Fig. 12); e.g., their COI barcodes differ by 4.6% (30 bp), and therefore they represent a new species. This new species keys to C. theramenes (F.11.1) in Evans (1953) and was included by him in this species, but differs from it and other relatives by a more contrasting pattern of the dorsal hindwing with a broader discal paler area between the darker discal and postdiscal bands, a paler posterior part of the ventral hindwing with a less defined and more diffuse darker brown pattern, a more prominent basal tooth of the left harpe with a less defined central tooth, and a broader right harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly7985.4.2:G159A, aly1019.34.1:A1387T, aly1651.36.1:T1659C, aly4683.1.4:C135T, aly4683.1.4:C453T; and COI barcode: G200A, T205C, T304C, A409G, T607C.

Barcode sequence of the holotype.

Sample NVG-23121C12, GenBank PV972558, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGCTTATTAATTCGAACAGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAATTCCCCTAATATTGGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCATTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCCTTTCAACTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTGGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGAATTAGAAATCTTTCCTTTGATCAAATACCCCTATTTGTTTGAGCAGTAGGAATTACTGCATTACTTTTACTCCTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTTCCTTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 442–443 (genitalia Fig. 1196–1198), bears the following six rectangular labels (2^nd handwritten, others printed), five white: [ Paso San Juan, | V. Cruz. ], [ Camptopleura | theramenes | Mab ], [ Collection | W.Schaus ], [ DNA sample ID: | NVG-23121C12 | c/o Nick V. Grishin ], [ genitalia | NVG250720–49 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Camptopleura | mexicanes Grishin ]. Paratypes: 3♂♂ from Mexico: 1♂ NVG-19112E11, USNMENT_01602063 Veracruz, Coatepec, old, Coll. W. Schaus [USNM] and Chiapas: 1♂ NVG-15092B02, San Quintin, 6-Jul-1971, R. Wind leg. [MGCL] and 1♂ NVG-22101F02, CASENT_8566908, Puente Chamula, 18-Jul-1976, P. Hubbell leg. [CAS].

Type locality.

Mexico: Veracruz, Paso San Juan.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from southern Mexico.

Subfamily Trapezitinae Waterhouse and Lyell, 1914

Thymele dirpha Boisduval, 1832 and Thymele phalos Boisduval, 1832 are nomina dubia

Thymele dirpha Boisduval, 1832 (type locality in New Ireland) and Thymele phalos Boisduval, 1832 (type locality in Papua New Guinea: New Ireland), both described from an unstated number of specimens, are currently placed in the genus Felicena G. Waterhouse, 1932 (type species Thymele dirpha Boisduval, 1832). Evans (1949) regarded Thymele phalos as a junior subjective synonym of his Felicena dirpha but with a question mark and treated Sabera albicilla Joicey and Talbot, 1917 (type locality in Indonesia: Papua) and Felicena dirpha nota Evans, 1949 (type locality Papua New Guinea, Goodenough Is.) as subspecies of F. dirpha.

We translate the original description of T. dirpha, which was given the number 8 in the publication, as follows (the first sentence from Latin and the others from French): “Wings dark brown; forewings with four white square spots arranged in a band, preceded by a solitary dot; undersides of the hindwings shining, with a silvery discoidal spot surrounded by black. Wings of a blackish-brown color; the forewings with a transverse band of four white, semi-transparent, quadrangular spots, preceded by a solitary dot; undersides of the hindwings yellowish, with a central silvery spot bordered by black. Size of [Hesperia] Comma. New Ireland.” (Boisduval 1832).

We translate the original description of T. phalos, which was given the number 9 in the publication, as follows (the first sentence from Latin and others from French): “With brown wings; forewings with a line of four white dots, preceded by a solitary dot; hindwings reddish-brown underneath, with a larger dot at the base, and behind the middle, four nearly golden-yellowish dots. Wings of a blackish-brown color; the forewings have a line of four small white dots, preceded by a similar dot; the undersides of the hindwings are reddish-brown, with a large dot near the base, and beyond the middle, a series of four dots that are yellow-white, almost golden in color. It is about the size of H[esperia]. Comma and is found in New Guinea.” (Boisduval 1832).

These two descriptions were consecutive in the work (No. 8 and 9), and start similarly, but otherwise they do not describe similar butterflies. For instance, the ventral hindwing in T. dirpha is yellowish and with a central silvery spot encircled by black, but in T. phalos, it is reddish-brown with a large dot near the base and four dots past the middle that are yellowish. Therefore, T. phalos is not an obvious synonym of T. dirpha. Moreover, neither of the descriptions agrees with S. albicilla nor F. dirpha nota in any characters. Among species known to us, the description of T. dirpha may refer to females of Trapezites Hübner, [1819] (type species Trapezites symmomus Hübner, 1823), e.g., Trapezites petalia (Hewitson, 1868) (type locality in Australia), which agrees with the original description fairly well; or Hesperilla Hewitson, 1868 (type species Hesperia ornata Leach, 1814), e.g., Hesperilla dirphia Hewitson, 1868 (type locality in Australia) (is the similarity in names accidental?). However, these species are not recorded from New Ireland and the entire New Guinea. Some specimens of the latter species may agree somewhat with the original description of T. phalos, for which we have no better candidates than some Hesperilla species. It is also possible that T. dirpha and T. phalos were either mislabeled (unlikely) or have not been found since their original description (more likely), and both are valid species awaiting re-discovery. Therefore, pending further research, we propose that Thymele dirpha Boisduval, 1832 and Thymele phalos Boisduval, 1832 are nomina dubia.

Type species of Felicena Waterhouse, 1932 is Sabera albicilla Joicey and Talbot, 1917

The type species of the genus Felicena Waterhouse, 1932 (type locality in New Ireland) was designated as Thymele dirpha Boisduval, 1832 (type locality in New Ireland); however, the diagnosis of the genus referred to Sabera albicilla Joicey and Talbot, 1917 (type locality in Indonesia: Papua) (Waterhouse 1932), which was mentioned in the same work as a junior subjective synonym of T. dirpha. Above, we argue that T. dirpha and S. albicilla are not synonyms and the former is a nomen dubium. Therefore, we conclude that Waterhouse’s application of T. dirpha to S. albicilla is a misidentification, and the type species of the genus Felicena was misidentified. To secure the applicability of Waterhouse’s description and ensure stability for continued usage of the genus name, under Article 70.3.2 of the ICZN Code, we fix the type species of Felicena Waterhouse, 1932 as Sabera albicilla Joicey and Talbot, 1917 (species selected), misidentified as Thymele dirpha (previously cited as type species) in the original description of the genus Felicena by Waterhouse (1932).

Felicena albicilla (Joicey and Talbot, 1917) is a valid species and Felicena dirpha nota Evans, 1949 is its subspecies

In the sections above, we argue that Thymele dirpha Boisduval, 1832 (type locality in New Ireland) is a nomen dubium and Sabera albicilla Joicey and Talbot, 1917 (type locality in Indonesia: Papua), which is the type species of Felicena Waterhouse, 1932, is not its junior subjective synonym, and therefore a valid species, Felicena albicilla (Joicey and Talbot, 1917), reinstated status. Felicena dirpha nota Evans, 1949 (type locality Papua New Guinea, Goodenough Is.) was originally proposed as a subspecies of T. dirpha. However, because T. dirpha was misidentified by Evans (1949), the name for this species is Felicena albicilla, and therefore we form the following new species-subspecies combination: Felicena albicilla nota Evans, 1949.

Felicena wau Grishin, new species

https://zoobank.org/2855AE03-767D-487F-B9FB-BC7BC051F69B

(Fig. 444–445, 1199–1201)

Definition and diagnosis.

A specimen initially identified as Felicena albicilla albicilla (Joicey and Talbot, 1917), reinstated status, (type locality in Indonesia: Papua, Wandammen Mtns.) exhibits 4.3% (28 bp) COI barcode difference from a specimen SAMN18673727, BN000355, CJM-16–2664 from Papua New Guinea, West Sepik, Frieda River, sequence taken from the alignment provided in Kawahara et al. (2023), and exhibiting phenotypic differences detailed below, represents a new species. This new species keys to “F. dirpha albicilla” (E.2.1(a)) in Evans (1949), but differs from it and other relatives by the lack of white at the margin of the hindwing on both sides with only the fringe being white, smaller forewing hyaline spots, a postdiscal row of gray-purple spots on the ventral hindwing, a terminally narrower process of the ampulla, a narrower harpe, and a broader valva in the middle. This species is not cryptic. In DNA, a combination of the following base pairs is diagnostic in the COI barcode: T118C, T139C, T355G, T490C, T574A.

Barcode sequence of the holotype.

Sample NVG-22101D05, GenBank PV972559, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTAATAATTCGTGTAGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAACACAATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGGCTAATCCCTCTCATATTAGGAGCTCCTGATATGGCCTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCCGGAACTGGTTGAACTGTTTACCCCCCACTTTCCTCGAATATTGCTCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAACATACGAATTAATAATTTATCATTTGACCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTATTACTACTTTTATCTTTACCTGTTTTAGCCGGTGCAATTACAATATTACTCACAGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 444–445 (genitalia Fig. 1199–1201), bears the following eight rectangular labels (2^nd handwritten, others printed), seven white: [ New Guinea: Morobe | District, Blue Point | Mt. Kaindi road, 5 mi. | W. of Wau, 1800m | 3-V-1973 | Thomas W. Davies ], [ Felicena | dirpha | dirpha | TWD. Bois. ], [ THOMAS W. DAVIES | COLLECTION | DONATED TO THE CALIFORNIA | ACADEMY OF SCIENCES | 1987 ], [ DNA sample ID: | NVG-22101D05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D10 | c/o Nick V. Grishin ], [ genitalia | NVG241114–05 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8566887 ], and one red [ HOLOTYPE ♂ | Felicena wau | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Papua New Guinea: Morobe Province, Blue Point, Mt. Kaindi Road, 5 mi west of Wau, elevation 1800 m.

Etymology.

The name derived from the type locality and is a noun in apposition.

Distribution.

Eastern New Guinea.

Subfamily Hesperiinae Latreille, 1809 Tribe Hesperiini Latreille, 1809 Subtribe Hesperiina Latreille, 1809

Mnaseas violaceus Grishin, new species

https://zoobank.org/243F666B-0D17-4A8A-8748-BA987F07C20C

(Fig. 13 part, 446–447, 1202–1203)

Definition and diagnosis.

Genomic analysis of a specimen from Guyana initially identified as Mnaseas kayei (Bell, 1932) (type locality in Trinidad) reveals that while it is sister to this species, it is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore it represents a new species. This new species keys to “Euphyes sirene kayei” (M.28.16(a)) in Evans (1955), but differs from it and other relatives by a rounder, less produced at the tornus hindwing, which is more strongly purple-red (instead of yellower) beneath; and a relatively larger, longer harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly814.16.1:T90C, aly144.14.6:C111T, aly318.14.17:T2493C, aly2258.4.29:A93G, aly923.10.4:G213A, aly103.44.2:T729T (not C), aly1313.25.1:A54A (not G), aly5021.3.14:G1239G (not A), aly127.41.2:C90C (not T), aly2487.22.3:A36A (not G); and COI barcode: T19T, T59C, T223C, G317A, A470A, T574C.

Barcode sequence of the holotype.

Sample NVG-18013D06, GenBank PV972560, 658 base pairs:

AACTCTATATTTTATTTTTGGAATTTGATCAGGAATATTAGGAACTTCATTAAGATTACTAATTCGTACAGAACTAGGAAATCCAGGATCACTAATTGGAGACGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCCGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTACAGGAACTGGATGAACGGTATATCCACCTTTATCATCTAATATTGCCCATCAAGGATCTTCAGTAGATTTAACAATTTTTTCCCTTCATTTAGCAGGAATTTCATCAATTCTTGGAGCCATTAATTTTATTACAACTATTATTAACATACGAATTAAAAATTTATCATTTGATCAAATACCTCTATTTATTTGATCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACCATATTACTTACAGATCGAAATTTAAATACTTCTTTTTTTGATCCCGCAGGAGGTGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 446–447 (genitalia Fig. 1202–1203), bears the following six rectangular printed labels, five white: [ GUYANA:Mazaruni–Potaro | Kaieteur Falls 200–450m | 5°14’N 59°33’W | 18 Dec – 25 Dec 1989 | Leg. S. Fratello ], [ DNA sample ID: | NVG-18013D06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121A12 | c/o Nick V. Grishin ], [ genitalia | NVG241121–16 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450385 ], and one red [ HOLOTYPE ♂ | Mnaseas violaceus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana: Potaro-Siparuni region, Kaieteur Falls, elevation 200–450 m, GPS 5.233, −59.550.

Etymology.

The name is for the violaceus sheen of the hindwing and is an adjective.

Distribution.

Currently known only from the holotype collected in Guyana.

Cyclosma paragua Grishin, new species

https://zoobank.org/851E4DD0-5B6D-4EBD-B385-35AB5C37CE7C

(Fig. 13 part, 448–449, 1204–1205)

Definition and diagnosis.

Genomic analysis of a specimen from Paraguay initially identified as Cyclosma altama (Schaus, 1902) (type locality in Brazil: Paraná) reveals that it is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore it represents a new species. This new species keys to C. altama (L.13.2) in Evans (1955), but differs from it and other relatives by males with a doublet of semihyaline spots in the forewing discal cell, a narrower valva, and the dorsodistal margin of the harpe with several widely separated small teeth. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2041.13.4:G69C, aly1838.8.7:G199T, aly168.1.4:T54C, aly2532.12.2:T645C, aly461.9.5:A153G, aly927.1.8:C195C (not T), aly927.1.8:C222C (not T), aly536.15.2:T234T (not C), aly2508.19.2:C54C (not A), aly2508.19.2:G57G (not A); and COI barcode: T46C, T127C, T157T, T386C, A565G.

Barcode sequence of the holotype.

Sample NVG-21015B12, GenBank PV972561, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACCTCTTTAAGTCTTTTAATTCGAACAGAATTAGGTAATCCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAACAATATAAGATTTTGAATATTACCCCCCTCTTTAACATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACCGGTTGAACAGTTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGATCATCTGTTGATCTAGCAATTTTTTCATTACATTTAGCTGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGATCTGTAGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGGGCCATTACAATACTACTTACTGATCGAAACTTAAATACATCATTTTTTGATCCTGCAGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 448–449 (genitalia Fig. 1204–1205), bears the following seven rectangular labels (2^nd and 3^rd handprinted, others printed with text in italics handwritten), six white: [ Sapucay | Paraguay | | Foster ], [ HESPERIA | ALTAMA | SCHAUAS ], [ COMP.W.TYPE | R.C.WILLIAMS ], [ Cyclosma | altama ♂ | (Schaus) | det. H.A. Freman ], [ DNA sample ID: | NVG-21015B12 | c/o Nick V. Grishin ], [ genitalia | NVG241121–17 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cyclosma | paragua Grishin ].

Type locality.

Paraguay: Sapucaí.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Paraguay.

Lindra pindra Grishin, new species

https://zoobank.org/1CFC077B-E0A1-40DD-95B7-FE58481D3D55

(Fig. 13 part, 450–453, 1206–1213)

Definition and diagnosis.

Genomic analysis of specimens from Panama initially identified as Lindra brasus (O. Mielke, 1968) (type locality in Brazil: Distrito Federal) reveals that they are not monophyletic with this species and are genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore they represent a new species. This new species keys to “Lindra gulala” (O.9.2) in Evans (1955), which he misidentified and in which he included this new species, but differs from it and other relatives by females with a single well-defined subapical hyaline spot (the second one is minute) and a narrower hyaline spot in the cell CuA₁-CuA₂; and males without a pale longitudinal ray in the ventral hindwing cell CuA₂-1A+2A but with a more conspicuous cream-colored postdiscal spot near the vein 1A+2A, a narrower valva with a broader process from the distal part of the sacculus, a narrower harpe towards its dorsal rounded end, and a bulkier ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1585.9.2:A127C, aly506.10.2:C180T, aly506.10.2:G222A, aly2258.11.2:G69C, aly281.16.1:C550T; and COI barcode: T64C, T247C, A295C, A433G, A508A.

Barcode sequence of the holotype.

Sample NVG-18113B07, GenBank PV972562, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATATTAGGAACTTCATTAAGACTATTAATCCGTACAGAATTAGGAAATCCAGGATCATTAATTGGAGACGATCAAATTTATAACACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCCTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAACAATATAAGATTTTGACTTCTTCCCCCCTCATTAACTTTATTAATTTCCAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCTTTATCTTCAAATATTGCACATCAAGGATCTTCAGTTGATTTAGCTATTTTCTCTCTCCATTTAGCCGGTATCTCATCTATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATATATCATTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACAGCTTTATTATTATTGTTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTCTCTATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 450–451 (genitalia Fig. 1206–1207), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PANAMA:CANAL ZONE | Fort Clayton | 9°00’N 79°35’W | 6.I.1973 | leg. G.B.Small ], [ genitalia NO. | X-41 40 | J.M.Burns 1996 ], [ DNA sample ID: | NVG-18113B07 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531444 ], and one red [ HOLOTYPE ♀ | Lindra pindra | Grishin ]. Paratypes: 4♂♂ from Panama: 1♂ NVG-18083E11, NHMUK_012824226, molecular NHMUK_0247274679, no detailed location, Dec-1907, Pemberton leg. [BMNH] and Colón Province, Gamboa, R. A. Anderson leg. [MGCL]: 1♂ NVG-24066D05, 27-Jul-1983; 1♂ NVG-24066D06 (leg, DNA sequenced) NVG-24077A03 (abdomen, DNA stored), 11-Aug-1985; and 1♂ NVG-24066D07, 10-Aug-1985, genitalia SRS-4465 (Fig. 452–453, genitalia Fig. 1208–1213).

Type locality.

Panama: Panamá Province, Fort Clayton, approx. GPS 9.000, −79.583.

Etymology.

The name is a fusion: p[anamanian] + [L]indra and is treated as a noun in apposition.

Distribution.

Currently known only from Panama.

Metron nigroalbum (Shuey, 2024), new combination, is confirmed as a valid species

Genomic analysis of Metrocles nigroalbum Shuey, 2024 (type locality in French Guiana) reveals that it is a close sister to Metron mentor Dolibaina, Mielke and Casagrande, 2024 (type locality in Brazil: Acre, holotype sequenced as OM46.697) (Dolibaina et al. 2024), but is genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 1.5% (10 bp), and it differs by the harpe more expanded dorsad and less overlapping with the ampulla. Therefore, we confirm M. nigroalbum as a valid species and propose to place it in the genus Metron Godman, 1900 (type species Pamphila chrysogastra Butler, 1870) as Metron nigroalbum (Shuey, 2024), new combination.

Lectotype designation for Hesperia hypodesma Plötz, 1882

Hesperia hypodesma Plötz, 1882, the name attributed to Hopffer (Hpf.) by Plötz in the original description, was described from at least two syntypes (male and female, from “Parà, Rio”) originally in MFNB, with the collection number given as 5275 (Plötz 1882a). However, the historical collections catalog in MFNB, handwritten by Carl Heinrich Hopffer (1810–1876), who was the curator of the entomological collections until his death, lists a single specimen of “Hesperia sp.” from “Bahia” under the entry number 5275. In contrast, entry number 5265 lists two specimens of “Hesperia Hypodesma N.” from “Rio and Parà” collected by “v[on]. Langsd[orf]f and Sieber”, respectively, and most likely corresponds to the syntypes of H. hypodesma. Names followed by “N.” in Hopffer’s catalog and on specimen labels written by him were probably coined by Hopffer for species that he considered new, and “N.” could stand for the Latin Nobis, i.e., “us” or “of us”, similar to “m.” meaning “mihi”, i.e., “me” or “of me”. Alternatively, and possibly more likely, “N.” could be an abbreviation for the Latin “Nova” or German “Neue”, simply meaning that the name of the species was new. Plötz’s attribution of the name hypodesma to Hopffer agrees with these findings. Therefore, the original description of H. hypodesma gave the number 5275 instead of 5265 by mistake. Similar errors in collection numbers in Plötz’s publications have been reported previously (Zhang et al. 2023e). The species in the Plötz’s key just preceding H. hypodesma is Hesperia zisa Plötz, 1882 (currently a valid species of Metrocles Godman, 1900), with the MFNB number 5270, from “Rio”. The collections catalog lists a single specimen of “Hesperia sp.” from “Rio” collected by “v[on]. Langsd[orf]f”, likely corresponding to a syntype (possibly the only one) of H. zisa. This correct number 5270 may explain the origin of the mistake in the collection number of the next species given as a larger and more similar number (5275 instead of 5265).

We found a single syntype of H. hypodesma in MFNB, a male with the collection number label “5265” and a blue-green label written by Hopffer: “Hypodesma | N. | Rio v. Lgsdf | Parà Sieber” echoing the entry in the collections catalog. This syntype was in the second-to-last drawer with other type specimens, in the section following the types ordered alphabetically. Therefore, the syntype was removed from its original position in the historical collections drawer at a later time than other types and placed in the type drawer after the alphabetically arranged specimens, without the header labels used for previously segregated types. We failed to find the second syntype, likely a female as stated by Plötz (1882a). It was almost certainly left in its original location in the drawer when the labeled syntype was removed, and is expected to be unlabeled, making its detection difficult. Only one specimen for each collection number (the header specimen) bears a label with this number. Other specimens were placed in a column below it and originally did not bear any labels.

Moreover, it is not clear which specimen was from “Rio” and which was from “Parà”, because both localities were listed on the header specimen label. From the order of the localities, one may attempt to deduce that the first specimen (i.e., the one with the labels) was from “Rio”, and the second specimen (not found, unlabeled) was from “Parà”. However, Plötz’s description gave a different order (“Parà, Rio”) and listed male and female, thus suggesting that the male might have been from “Parà” and the female from “Rio”, which is opposite to the order on the collection label. Generally, we suspect that the order on the labels did not correspond to the order in the collection, and because Hopffer considered these specimens to be the same species, he might not have seen the value of separating them by localities and thus have not distinguished them in any way, mixing specimens from different localities together. Therefore, we used genomic DNA comparison to deduce the provenance of the syntype sampled as NVG-18052A09. Genomic analysis placed the syntype together with specimens we identified as “Metron chrysogastra hypodesma” from Guyana, Trinidad, and Brazil: Rondônia and apart from the specimen from South Brazil (Fig. 13). Therefore, we deduce that the male syntype was collected in Brazil: Pará rather than in Rio de Janeiro, in accord with the locality that Plötz listed first and not according to the order of localities listed on the label. It is also possible that the labels might have been switched between the two specimens at some later time. This male syntype from Pará agrees with the original description of H. hypodesma (Plötz 1882a) and the current application of this name (Evans 1955; Mielke 2005) and is from the locality listed first in the description. Therefore, this syntype is a reasonable choice for the lectotype from a possibly polytypic series.

To stabilize nomenclature and define the name H. hypodesma objectively, N.V.G. hereby designates the syntype in the MFNB collection, the male that bears the following six labels (1^st red, 2^nd blue-green, others white; 3^rd and 4^th handwritten, others printed): [ Typus ], [ 5265 ], [ Hypodesma | N. | Rio v. Lgsdf | Parà Sieber ], [ hypodesma | Pl. | 5275 type ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 44a0b4 ], [ DNA sample ID: | NVG-18052A09 | c/o Nick V. Grishin ], as the lectotype of Hesperia hypodesma Plötz, 1882. The second label gives the collection number, and the third label is written by Hopffer, listing two possible localities of the lectotype and collectors for each locality. The lectotype is missing its head, abdomen and both hindwings. Instead, the right hindwing of another species is glued on. This hindwing is excluded from the lectotype. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of H. hypodesma becomes Brazil: Pará, deduced by DNA comparison of the lectotype with specimens from known localities as a binary choice between “Parà” and “Rio [de Janeiro]” given on the lectotype label and in the historical MFNB collections catalog. Based on this locality, the lectotype was collected by Friedrich Wilhelm Sieber (1775–1831). The COI barcode sequence of the lectotype, sample NVG-18052A09, GenBank PV983801, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTGGGGAATCCGGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCCTCATTAGTATTATTAATCTCAAGAAGAATTGTTGAAAATGGAGTAGGAACTGGTTGAACAGTTTACCCCCCCCTATCTTCTAATATTGCCCATCAAGGATCTTCTGTTGATTTGGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACAATATTACTTACTGATCGAAATTTAAATACTTCTTTCTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Metron hypodesma (Plötz, 1882) and Metron gades Evans, 1955 are species distinct from Metron chrysogastra (A. Butler, 1870)

Genomic analysis reveals that Hesperia hypodesma Plötz, 1882 (type locality in Brazil, likely Pará, in agreement with genomic analysis of the lectotype) and Metron chrysogastra gades Evans, 1955 (type locality in Peru: Chanchamayo), currently treated as subspecies of Metron chrysogastra (Butler, 1870) (type locality in Venezuela and Colombia), are genetically differentiated from it at the species level in the nuclear genome (Fig. 13a), but their mitochondrial genomes experience introgression (Fig. 13b) and, although displaying differences of 1.4%-2.1% (9–14 bp), cannot be used reliably to distinguish between these taxa. Therefore, we propose that Metron hypodesma (Plötz, 1882), reinstated status, and Metron gades Evans, 1955, new status, are species distinct from Metron chrysogastra (Butler, 1870). As a result, M. chrysogastra becomes monotypic.

Metron chrysoaca Grishin, new species

https://zoobank.org/F272C961-8B7C-442D-AD85-3BC4D83FB25E

(Fig. 13 part, 454–455, 1214–1215)

Definition and diagnosis.

Specimens from Oaxaca, Mexico, form a clade in the nuclear genome tree sister to Metron chrysogastra (Butler, 1870) (type locality in Venezuela and Colombia), but are genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 3.8% (25 bp), and therefore they represent a new species. This new species keys (incompletely) to “M. chrysogastra chrysogastra” (M.33.2(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: palpi and pectus are creamy white beneath with a slight orange tinge on the sides; the abdomen is orange beneath in males and with some orange in females; the forewing in males has subapical pale spots, three on the ventral side; the ventral side of the wings has a strong green sheen, equally prominent in the apical third of the ventral forewing; a broader valva with a bulkier ampulla; and a less rounded, more straight distal margin of the harpe, which is shorter and appears more truncate. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2012.60.3:C72T, aly2012.60.3:C75T, aly686.8.1:A146G, aly1222.15.11:A288G, aly1222.15.11:C291A; and COI barcode: T38C, T169C, T226C, A286G, A541G, T607C.

Barcode sequence of the holotype.

Sample NVG-20062E09, GenBank PV972563, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATGCTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGACATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAGTATTGTTAATCTCAAGAAGAATTGTTGAAAATGGAGTAGGAACTGGTTGAACAGTTTATCCCCCCCTATCTTCTAATATCGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTACTATTATTGCTTTCATTACCTGTTTTAGCTGGAGCTATTACAATATTACTTACTGATCGAAATTTAAATACTTCCTTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 454–455 (genitalia Fig. 1214–1215), bears the following seven rectangular labels (3^rd handwritten, others printed, 2^nd and the last red, others white): [ Mexico: Oaxaca | Sierra Madre del Sur | La Soledad-Buena Vista | ~5000’ 16.iv.1990 | J. Kemner leg. #189 ], [ Texas Memorial | Museum –UTexas | JKemner Spec. | 1366 ], [ 189 ], [ DNA sample ID: | NVG-20062E09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22056B03 | c/o Nick V. Grishin ], [ genitalia | NVG241121–18 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Metron chrysoaca | Grishin ]. The numbers 1366 and 189 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2^nd and 3^rd labels were original labels on the holotype. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀, data as the holotype: 1♂ NVG-23048H10 [MGCL] and 1♀ NVG-20062E08 (leg, DNA sequenced), NVG-22056B02 (abdomen, DNA stored), genitalia NVG241121–19 [TMMC].

Type locality.

Mexico: Oaxaca, Sierra Madre del Sur, La Soledad-Buena Vista, elevation ~5000’.

Etymology.

The name is a portmanteau formed from the phrase “chryso[gastra from Oax]aca” and is a noun in apposition.

Distribution.

Currently known only from Oaxaca, Mexico.

Metron cremicolor Grishin, new species

https://zoobank.org/5B98E70B-35F1-4770-834E-30A1AE9455A0

(Fig. 13 part, 456–457)

Definition and diagnosis.

A female from the Southeast Region of Brazil is sister to Metron hypodesma (Plötz, 1882) (type locality in Brazil, likely Pará, in agreement with genomic analysis of a syntype) in the nuclear genome tree, but is genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore it represents a new species. This species keys to “Metron chrysogastra hypodesma” (M.33.2(c)) in Evans (1955) and he probably included it in that taxon, but differs from it and other relatives by females with developed subapical and submarginal white spots as in Metron gades Evans, 1955 (type locality in Peru: Chanchamayo) (usually absent in M. hypodesma), cream-colored stripes on the abdomen beneath as in M. hypodesma (orangish in M. gades), a narrower ventral hindwing cream band, and a less orange (whiter) ventral side of palpi and procoxae. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.8.16:T61A, aly728.8.16:C62G, aly85.20.3:T21C, aly85.20.3:G24A, aly1019.29.17:C160T, aly1155.14.6:A426A (not T), aly525.36.2:G123G (not A), aly9588.5.1:G717G (not A), aly2012.67.3:A129A (not G), aly536.80.3:G187G (not A); and COI barcode: A229G, G281A, A517G, T607C, C610T.

Barcode sequence of the holotype.

Sample NVG-23093H11, GenBank PV972564, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTGGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATGGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAATATTATTAATCTCAAGAAGAATTGTTGAAAATGGAGTAGGAACTGGTTGAACAGTTTACCCCCCCCTATCTTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTGGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTGGGAATTACAGCATTACTATTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACAATATTACTTACTGATCGAAATTTAAATACTTCCTTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 456–457, bears the following four rectangular labels (2^nd handwritten, others printed with handwritten text shown in italics), three white: [ BRASILIEN | Sao Paulo | Santos | Umgebung | Tf. 7. 4. 1927 | leg. R. Spitz ], [ Santos 7/4 27 ], [ DNA sample ID: | NVG-23093H11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Metron cremicolor | Grishin ].

Type locality.

Brazil: São Paulo, Santos.

Etymology.

The name is given for more cream-colored and less orange patterns of this species and is an adjective.

Distribution.

Currently known only from the holotype collected in Southeast Brazil.

Metron cerradon Grishin, new species

https://zoobank.org/9CE13038-2097-445B-9A11-A751159EFC12

(Fig. 13 part, 458–459, 1216–1217)

Definition and diagnosis.

A male from the Central-West Region of Brazil is sister to the clade consisting of Metron cremicolor new species (type locality in Brazil: São Paulo) and Metron hypodesma (Plötz, 1882) (type locality in Brazil, likely Pará, in agreement with genomic analysis of a syntype) in the nuclear genome tree, but is genetically differentiated from them at the species level (Fig. 13); e.g., their COI barcodes differ by 2% (13 bp) being more similar to those of Metron gades Evans, 1955 (type locality in Peru: Chanchamayo) with 0.6% (4 bp) difference, possibly due to introgression. Hence, this male represents a new species that keys to “Metron chrysogastra hypodesma” (M.33.2(c)) in Evans (1955), but differs from it and other relatives by males with the abdomen white beneath and orangish on the sides, the ventral side of palpi and procoxae less orange, mostly cream-colored with a tint of orange, the ventral hindwing discal band medium-broad, about 1/3 of the wing length in width, the forewing with well-developed postdiscal cream spots in the cells M₃-CuA₁, CuA₁-CuA₂ and CuA₂-1A+2A, no discal cell spot, no subapical spots, and the fringes along the hindwing tornus are paler, the same color as palpi beneath. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly85.20.3:T21C, aly85.20.3:G24A, aly686.7.13:C180T, aly890.35.8:T279C, aly127.14.3:A30G, aly4568.5.1:A318A (not G), aly4568.5.1:T321T (not C), aly274.37.1:C93C (not T), aly1222.45.2:G2215G (not A), aly423.5.14:A306A (not G); and COI barcode: A110A, T206C, A214G, A409G, A565G.

Barcode sequence of the holotype.

Sample NVG-23049B03, GenBank PV972565, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTGGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCCTAATATTGGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAGTATTATTAATCTCAAGAAGAATTGTTGAAAATGGAGTAGGAACTGGTTGAACAGTTTACCCCCCCCTATCTTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTGGCAATTTTTTCTCTTCATTTGGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCCTTACTATTATTACTTTCATTACCTGTTTTAGCTGGGGCTATTACAATATTACTTACTGATCGAAATTTAAATACTTCTTTCTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 458–459 (genitalia Fig. 1216–1217), bears the following six rectangular printed (with handwritten text in italics) labels, five white: [ BRASIL: MATO GROSSO | km. 876 of Cuiaba-Santarem | Hy.; 15.vii.1978 ], [ Allyn Museum | Acc. 1985–8 ], [ DNA sample ID: | NVG-23049B03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24129D02 | c/o Nick V. Grishin ], [ genitalia | NVG250720–33 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Metron cerradon | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Mato Grosso, km. 876 of Cuiabá–Santarém Highway (BR-163).

Etymology.

The name is formed from the Cerrado, an ecoregion of tropic savanna in Brazil, which is a likely habitat of this species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Central-West Brazil.

Metron fascia Grishin, new species

https://zoobank.org/7FC82DA5-A5A9-4643-917A-C043F5C0092C

(Fig. 13 part, 460–461, 1218–1220)

Definition and diagnosis.

A specimen from Costa Rica is sister to Metron fasciata (Möschler, 1876) (type locality in Suriname) but is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 3.8% (25 bp), and therefore it represents a new species. This new species keys to M. fasciata (M.33.4) in Evans (1955) and was likely included by him in this taxon, but differs from it and other relatives by the following combination of characters in males: greenish ground color of ventral hindwings; the discal white band on the hindwing does not reach the costal margin and is separated from it by a yellowish (not green) area; forewing subapical and submarginal spots are well-defined, not suffused with the ground color, white (not yellow-green) on the ventral side and nearly connected with the yellower discal spots into a single band, but all spots are separated from each other by darker veins, more so than in M. fasciata, especially on the dorsal side; the valva is smoothly narrowing towards the harpe; the ampulla is rounded, knob-like; the harpe is rounded and ends in a dorsal tooth. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly499.11.2:A126G, aly614.5.6:C84T, aly349.23.7:C93T, aly349.23.7:C102T, aly1859.3.1:A30G, aly84.85.3:A170A (not C), aly84.85.3:G171G (not A), aly1265.18.1:T171T (not C), aly1265.18.1:A186A (not G), aly1097.7.1:T33T (not C); and COI barcode: T10C, T82C, T277C, T358C, T568C.

Barcode sequence of the holotype.

Sample NVG-21044B11, GenBank PV972566, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAAGAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGAAACCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTACCCCCCTCCTTAATATTATTAATTTCAAGAAGAATTGTCGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCTTCTAACATTGCCCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAATCTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTATTACTTCTTCTTTCTTTACCTGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 460–461 (genitalia Fig. 1218–1220), bears the following six printed rectangular labels, five white: [ COSTA RICA | Heredia Province | 3.8 km W | Santa Clara | 5 Oct. 1987 | leg G&A Austin ], [ DNA voucher | LEP-79365 ], [ DNA sample ID: | NVG-21044B11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24065F07 | c/o Nick V. Grishin ], [ genitalia | NVG241111–23 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Metron fascia | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Costa Rica: Heredia Province, 3.8 km west of Santa Clara.

Etymology.

The name is formed from the name of its sister species M. fasciata made shorter to indicate more northern distribution and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Costa Rica.

Tisias canna Evans, 1955 is a species distinct from Tisias lesueur (Latreille, [1824])

Genomic comparison reveals that Tisias lesueur canna Evans, 1955 (type locality Peru, Puno Region, Carabaya Province, Oroya) is genetically differentiated from Tisias lesueur lesueur (Latreille, [1824]) (type locality given as “États Unis”, likely in Southeast Brazil) at the species level (Fig. 13); e.g., their COI barcodes differ by 5.8% (38 bp). Therefore, and in the presence of phenotypic differences detailed in Evans (1955), we propose that Tisias canna Evans, 1955, new status, is a species distinct from Tisias lesueur (Latreille, [1824]), which becomes monotypic.

Tisias ador Grishin, new species

https://zoobank.org/ADF203A0-F05F-4326-8B3D-F45A3F33E30B

(Fig. 13 part, 462–463, 1221–1222)

Definition and diagnosis.

Phenotypic analysis of a specimen from Ecuador that is sister to both Tisias canna Evans, 1955, new status (type locality Peru, Puno Region, Carabaya Province, Oroya) and Tisias lesueur (Latreille, [1824]) (type locality given as “États Unis”, likely in Southeast Brazil) in the nuclear genome tree (Fig. 13) suggests that it represents a new species most similar to Tisias caesena (Hewitson, 1867) (type locality in Brazil), due to differences in stigma and genitalia. This new species keys to Tisias caesena (K.20.5) in Evans (1955), but differs from it and other relatives by a broader stigma; smaller forewing hyaline spots with the two discal cell spots clearly separated from each other and from the spot in cell CuA₁-CuA₂; the lack of postdiscal hyaline spots on the hindwing; less irregular and almost evenly rounded dorsodistal margin on the harpe with a smaller and rounded dorsal tooth, and a broader ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.219.15:C73A, aly322.16.2:A97C, aly3268.9.5:T33G, aly461.7.6:A187C, aly9588.18.1:T258C, aly731.13.1:A1167A (not T), aly6954.5.14:C108C (not T), aly320.21.8:G108G (not A), aly2659.4.7:C108C (not T), aly2659.4.7:G123G (not A); and COI barcode: T16C, A40G, T56C, T133A, T169C, T541C.

Barcode sequence of the holotype.

Sample NVG-18112A03, GenBank PV972567, 658 base pairs:

AACTTTATATTTTATCTTTGGTATTTGAGCAGGAATATTGGGAACTTCTTTAAGTCTATTAATTCGAACAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCCTCATTAACATTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACCGGTTGAACAGTTTACCCACCTTTATCCTCCAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTCTCCCTTCATTTAGCCGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAAAAATCTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACAGCATTATTATTACTCTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACCGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATCCTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 462–463 (genitalia Fig. 1221–1222), bears the following six printed rectangular labels, five white: [ ECUADOR: Morona-Santiago | Río Abanico | 2° 15.7’ S, 78° 12.2’ W | IX.2002 1600 m | I.Aldas, leg. ], [ DNA sample ID: | NVG-18112A03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035C10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–20 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531350 ], and one red [ HOLOTYPE ♂ | Tisias ador | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Morona-Santiago Province, Río Abanico, elevation 1600 m, GPS −2.2617, −78.2033.

Etymology.

The name is derived from the county of the type locality, [Ecu]ador, and is a noun in apposition.

Distribution.

Currently known only from the holotype collected on the eastern slope of the Andes in central Ecuador.

Tisias migera Grishin, new species

https://zoobank.org/205B2EE9-396A-4C74-8B35-198E0A9C145D

Fig. 13 part, 464–465)

Definition and diagnosis.

A female from Minas Gerais, Brazil, is sister to Tisias canna Evans, 1955, new status (type locality Peru, Puno Region, Carabaya Province, Oroya) but is genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore it represents a new species. This new species keys to “Tisias lesueuri canna” (K.20.4(a)) in Evans (1955), but differs from it by females having two or three (not one) hyaline spots on the hindwing, these spots are smaller than in Tisias lesueur (Latreille, [1824]) (type locality given as “États Unis”, likely in Southeast Brazil), the ventral hindwing with a better developed pale spot in cell CuA₂-1A+2A but a weakly developed discal cell spot, a more strongly constricted (nearly divided in two) discal cell spot on the forewing with three apical spots in line, and paler fringes around the hindwing tornus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly443.6.3:T132G, aly443.6.3:G258A, aly2631.9.10:G99A, aly2631.9.10:T126C, aly529.54.6:C138T, aly577.16.2:A186A (not G); and COI barcode: T139T, T304C, A433G, T520C, T530C, T553G.

Barcode sequence of the holotype.

Sample NVG-23081G11, GenBank PV972568, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTTCCCCCCTCATTAACATTGTTAATTTCAAGAAGAATCGTAGAAAATGGTGCTGGAACTGGTTGAACAGTTTATCCACCTCTATCTTCTAATATCGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTCTCCCTTCATTTAGCTGGTATTTCCTCTATTTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATCTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGCATTACAGCACTACTTTTACTTTTATCTTTACCGGTATTAGCTGGAGCTATCACTATATTACTTACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 464–465, bears the following four rectangular labels (1^st handwritten, others printed), three white: [ Minas Ge- | raes. | Hänsch. ], [ Hesperiidae | Coll.Thieme ], [ DNA sample ID: | NVG-23081G11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Tisias migera | Grishin ]. According to its label, the holotype was collected by Richard Hänsch (also spelled “R.Haensch” on printed labels) (1865 – ?), a German entomologist and insect dealer based in Berlin, who collected in Minas Gerais, Brazil, in 1896–1897 (Döbler 1973).

Type locality.

Brazil: Minas Gerais.

Etymology.

The name is a fusion of words in the type locality state, Mi[nas] + Gera[is], and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Southeast Brazil.

Xeniades (Tixe) cuska Grishin, new species

https://zoobank.org/067D86B4-952C-4FD1-831F-03906EA94221

(Fig. 13 part, 466–467, 1223–1224)

Definition and diagnosis.

Genomic analysis of a specimen from southeastern Peru initially identified as Xeniades (Tixe) rinda (Evans, 1955) (type locality in Venezuela) reveals that it is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 8.8% (58 bp), and therefore it represents a new species. This new species keys to “Tisias rinda” (K.20.2) in Evans (1955), but differs from it and other relatives by shorter brands, paler forewings at the margins, larger and closer to each other two hyaline spots in the forewing discal cell, no hyaline spot in hindwing cell Rs-M₁; and a more strongly developed dorsal segment of the harpe with a broader but still pointed tooth. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1155.7.3:C727A, aly3512.7.1:T21C, aly5021.1.3:A53T, aly5021.1.3:G56T, aly1158.5.1:A178C, aly1042.21.10:G63G (not A), aly1042.21.10:T81T (not C), aly216.12.2:A109A (not G), aly671.33.4:A45A (not C), aly671.33.4:T48T (not G); and COI barcode: T10C, A34T, A181T, A334G, T562C.

Barcode sequence of the holotype.

Sample NVG-18125G02, GenBank PV972569, 658 base pairs:

AACTTTATACTTTATTTTTGGCATTTGAGCAGGTATATTAGGAACTTCCTTAAGATTATTAATTCGTACTGAATTAGGTAACCCAGGATCTTTAATCGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATATTATTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGAACTGGTTGAACGGTTTATCCTCCTTTATCTTCTAATATTGCCCACCAAGGTTCTTCAGTTGATTTAACAATTTTTTCTCTCCATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATATAATATTTGACCAAATACCATTATTTGTTTGATCTGTAGGAATTACTGCTTTATTATTACTTTTATCTTTACCAGTTCTAGCCGGAGCTATTACTATATTACTCACTGACCGAAATTTAAATACTTCTTTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ currently in the Dempwolf collection (Austin, Texas, USA), to be deposited in the Museo de Historia Natural, Lima, Peru (MUSM), illustrated in Fig. 466–467 (genitalia Fig. 1223–1224), bears the following seven printed rectangular labels, six white: [ Peru: Cuzco Dept, 950m | Cosñipata Valley, Chontachaca | 13° 02’ S, 71° 28’ W | November 13, 2017 | Leg: W. Dempwolf ], [ Tisias rinda | ♂ | Coll of: W R Dempwolf ], [ DNA sample ID: | NVG-18125G02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015G01 | c/o Nick V. Grishin ], [ genitalia | NVG241114–45 | c/o Nick V. Grishin ], [ WRD 15,081 ], and one red [ HOLOTYPE ♂ | Xeniades (Tixe) | cuska Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Cuzco Department, Cosñipata Valley, Chontachaca, elevation 950m, approx. GPS −13.0333, −71.4667.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of southeastern Peru.

Lectotype designation for Cobalus percosius Godman, 1900

Cobalus percosius Godman, 1900 was described from seven specimens from Mexico (Veracruz), Guatemala, and Panama (Godman 1900b). To stabilize nomenclature, clarify the type locality, and define the name C. percosius objectively, N.V.G. hereby designates the syntype in the BMNH collection with genitalia illustrated by Godman (1900b) the male that bears the following seven printed labels (first two round, others rectangular; first two with a red circle on one side, others white) and a genitalia minislide No. 634 pinned together with labels: ( Type ) and on the other side of this label handwritten ( H | 2260 ), ( Type | H.T. ), [ Atoyac, | Vera Cruz. | May. H.H.S. ], [ ♂ ], [ 634 ], [ B.C.A.Lep.Rhop. | Cobalus | percosius, | Godm. ], [ Godman-Salvin | Coll. 1913.—2. ] as the lectotype of Cobalus percosius Godman, 1900. The lectotype was collected by Herbert Huntington Smith. The lectotype has scales completely removed from its left wings to reveal venation and the right hindwing spread over the forewing. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of C. percosius becomes Mexico, Veracruz, Atoyac, elevation 1314 ft, approx. GPS 18.900, −96.767 (Selander and Vaurie 1962).

Oligoria (Oligoria) colombia Grishin, new species

https://zoobank.org/C9A40A3C-D64E-4EE2-B1B1-07684407C33C

(Fig. 13 part, 468–469, 1225–1226)

Definition and diagnosis.

Genomic analysis of specimens from Colombia, Venezuela, and Ecuador initially identified as Oligoria (Oligoria) lucifer (Hübner, [1829]) (type locality in Suriname) reveals that they are not monophyletic with it and instead form a clade sister to Oligoria (Oligoria) percosius (Godman, 1900) (type locality in Mexico: Veracruz), and are genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 2.9% (19 bp), and therefore these specimens represent a new species. This new species keys to Decinea lucifer (L.11.8) in Evans (1955), but differs from it and other relatives by the following combination of characters: on the forewing, three subapical hyaline spots in a row, hyaline spots in the cells M₃-CuA₁ and CuA₁-CuA₂ are larger, one or no hyaline spots in the discal cell; males with extensive ocherous overscaling on both sides of wings; a smaller pale spot with limited pale-brown overscaling around it in the ventral forewing cell CuA₂-1A+2A, the harpe is more upturned, nearly diamond-shaped, rounded terminally, with a sharp dorsal tooth (directed anterodorsad) and a strongly defined ventral angle, and the ampulla projecting dorsad more strongly than in other species, nearly reaching the level of the basal hump of the costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2612.6.2:C230T, aly2612.6.2:T5811C, aly276890.2.8:C93T, aly276890.2.8:C121T, aly813.4.5:A1494T; and COI barcode: T59C, T142C, T439C, T530C, A631G.

Barcode sequence of the holotype.

Sample NVG-18113B12, GenBank PV972570, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTACTAATTCGTACAGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTTCCACTTATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTACCCTCCTTTATCTTCTAATATTGCCCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACTGCACTACTATTACTCTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTTCATTTTTTGATCCTGCAGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 468–469, bears the following six rectangular labels (1^st, 2^nd, and 5^th handwritten and others printed with handwritten text in italics), five white: [ JAN.19, 1986 | MIRANDA, 1000m | CAUCA, COLOMBIA | J.B.SULLIVAN ], [ 368 ], [ Genit. Vial | SRS–3253 ], [ DNA sample ID: | NVG18113B12 | c/o Nick V. Grishin ], and two red [ Bo Sullivan | I-98 ], [ HOLOTYPE ♀ | Oligoria (Oligoria) | colombia Grishin ]. Paratypes: 1♂ and 1♀: 1♀ NVG-22111G10 Venezuela, Valencia, F. Kummerow leg. [MFNB] and 1♂ NVG-21054F07 Ecuador, Pichincha, Hotel Tinalandia, 12 km E Santa Domingo de los Colorados, 750–850 m, 11-May-1988, G. and A. Austin leg., genitalia GTA-531 (Fig. 1225–1226) [MGCL].

Type locality.

Colombia: Cauca Department, Miranda, evaluation 1000 m.

Etymology.

The name is derived from the country of the type locality and the known distribution centered around Colombia. The name is a noun in apposition.

Distribution.

Colombia, Venezuela, and Ecuador.

Oligoria (Oligoria) argentinia Grishin, new species

https://zoobank.org/A6EA6F9C-B860-4230-B65E-F374B17B3B8E

(Fig. 13 part, 470–471, 1227–1228)

Definition and diagnosis.

Genomic analysis of specimens from Argentina initially identified as Oligoria (Oligoria) lucifer (Hübner, [1829]) (type locality in Suriname) reveals that they are not monophyletic with it and instead form a clade sister to Oligoria (Oligoria) obtena Grishin, 2023 (type locality in Ecuador) while being genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore these specimens represent a new species. This new species keys to Decinea lucifer (L.11.8) in Evans (1955), but differs from it and other relatives by the following combination of characters: three subapical hyaline spots in a row (smaller compared to other species), hyaline spots in the cells M₃-CuA₁ and CuA₁-CuA₂ are medium-sized or larger compared to other species, two hyaline spots in the forewing discal cell, a medium pale spot with more developed pale-brown overscaling around it in the ventral forewing cell CuA₂-1A+2A; the harpe is projecting posteriad, broadly rounded and terminally flatter in lateral view, the dorsal tooth is directed dorsad, and the ampulla does not reach the level of the basal hump of the costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4645.9.3:C24T, aly4645.9.3:C67T, aly536.174.1:C1275T, aly536.174.1:T3004C, aly798.26.2:G48A, aly216.60.2:A84A (not G), aly905.7.3:T75T (not C), aly50.31.2:T1710T (not G), aly50.31.2:T3556T (not C), aly10226.34.1:T279T (not G); and COI barcode: T10C, T193C, G200A, A433G, T536C.

Barcode sequence of the holotype.

Sample NVG-21054E12, GenBank PV972571, 658 base pairs:

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCCCTTCACCTAGCTGGTATTTCTTCTATTTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATCTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACCGCTTTATTACTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATGTTACTTACTGATCGAAATCTTAATACTTCATTTTTTGACCCAGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 470–471 (genitalia Fig. 1227–1228), bears the following seven rectangular labels (2^nd handwritten, others printed), six white: [ ARGENTINA Jujuy | (Ledesma) | Libertador General | San Martin, 470 m | 14-iii-94 Leg R | Eisele 94J1 ], [ ♂ ], [ MGCL Accession | #2011–4 | Robert Eisele ], [ DNA sample ID: | NVG-21054E12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24065B10 | c/o Nick V. Grishin ], [ genitalia | NVG241111–18 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Oligoria (Oligoria) | argentinia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 2♀♀ from Argentina, Jujuy Province, Ledesma Department, R. Eisele leg. [MGCL]: the same data as the holotype, except as specified: 1♂ NVG-24065F02 and 1♀ NVG-24065F03 26-Aug-1990, and 1♀ NVG-24065F04 Calilegua, Rt. 83, 5–7.5km W of Rt. 34, 550–600 m, 9-Oct-1992.

Type locality.

Argentina: Jujuy Province, Ledesma Department, Libertador General San Martín, elevation 470 m.

Etymology.

The name is derived from the county of the type locality and is treated as a noun in apposition.

Distribution.

Currently known from northern Argentina.

Oligoria (Oligoria) ecuadoria Grishin, new species

https://zoobank.org/C079EE9B-04BF-4593-9769-9074D00A17D3

(Fig. 13 part, 472–473, 1229–1230)

Definition and diagnosis.

Genomic analysis of a specimen from Ecuador initially identified as Oligoria (Oligoria) lucifer (Hübner, [1829]) (type locality in Suriname) reveals that it is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 5.5% (36 bp), and therefore it represents a new species. This new species keys (incompletely) to Decinea lucifer (L.11.8) in Evans (1955), but differs from it and other relatives by the following combination of characters: the abdomen is pale beneath in its distal half; on the forewing, one subapical hyaline spot, hyaline spots in the cells M₃-CuA₁ and CuA₁-CuA₂ are small and narrow, dot and streakshaped, no hyaline spots in the discal cell; no pale spot but only extensive pale-brown overscaling in the ventral forewing cell CuA₂-1A+2A; a shorter aedeagus and a slightly shorter saccus, the harpe is only slightly upturned, somewhat triangular in shape, with a concavity near its distal end along the ventral margin and a broader dorsal tooth directed dorsad, and the ampulla does not reach the level of the basal and more prominent than in other species hump of the costa. This species is not cryptic but due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly822.23.9:A115C, aly203.3.4:A462G, aly203.3.4:T468C, aly3201.4.1:T207C, aly525.115.3:A317G, aly3595.4.1:T60T (not C), aly3595.4.1:C93C (not T), aly4305.26.14:G111G (not C), aly527.1.3:A117A (not C), aly1500.10.2:A138A (not G); and COI barcode: T79C, T115C, T223C, T361C, G506A.

Barcode sequence of the holotype.

Sample NVG-17098F03, GenBank PV972572, 658 base pairs:

AACTTTATATTTTATCTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGCAACCCAGGATCATTAATTGGTGATGATCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGACTAGTTCCTCTTATATTAGGAGCCCCCGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCGCCTTCTTTAACACTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCCTTATCTTCTAATATCGCTCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTATTTGATCCGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTACTTACTGACCGAAATCTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 472–473 (genitalia Fig. 1229–1230), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR: Napo Prov | 4 km Tena–Pano Rd. | 1O 02’S, 77 O 50’W | 600m 28 Sept 1990 | S S Nicolay leg ], [ DNA sample ID: | NVG-17098F03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119D11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–21 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 00913434 ], and one red [ HOLOTYPE ♂ | Oligoria (Oligoria) | ecuadoria Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Napo Province, km 4 of Tena-Pano Road, elevation 600 m, GPS −1.033, −77.833.

Etymology.

The name is derived from the county of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected east of the Andes in central Ecuador.

Oligoria (Oligoria) peruvia Grishin, new species

https://zoobank.org/3BA5F8E6-938C-48C5-97C5-01B583DD5C67

(Fig. 13 part, 474–475, 1231–1232)

Definition and diagnosis.

Genomic analysis of a specimen from central Peru initially identified as Oligoria (Oligoria) lucifer (Hübner, [1829]) (type locality in Suriname) reveals that it is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 7.1% (47 bp), and therefore it represents a new species. This new species keys to Decinea lucifer (L.11.8) in Evans (1955), but differs from it and other relatives by the following combination of characters: the abdomen is dark beneath in its distal half; on the forewing, three subapical hyaline spots in a row, hyaline spots in the cells M₃-CuA₁ and CuA₁-CuA₂ are medium-sized, two small hyaline spots in the discal cell; a larger and more diffuse pale spot with more extensive pale-brown overscaling around it in the ventral forewing cell CuA₂-1A+2A; the saccus broader in the lateral view, the harpe is directed posteriad, more rounded, nearly oval, with a sharp dorsal tooth directed anterodorsad, and a smaller ampulla does not reach the level of the basal and weakly developed hump of the costa on the overall narrower valva. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly188.25.1:T1386C, aly188.25.1:A2043T, aly276754.1.1:T127C, aly276754.1.1:C136T, aly2096.5.1:A138G, aly822.23.9:A115A (not C), aly1656.26.1:A465A (not T), aly1656.26.1:A675A (not T), aly1656.26.1:T946T (not C), aly203.3.4:A462A (not G); and COI barcode: T25C, G101A, T562C, A532T, C596A.

Barcode sequence of the holotype.

Sample NVG-22044C03, GenBank PV972573, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATACTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACACTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCCCTCTCCTCAAATATTGCCCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCCCTTCATCTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCAATTCTATTACTTTTATCTTTACCTGTTTTAGCCGGAGCTATTACTATATTACTTACTGATCGAAATATTAATACTTCTTTCTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Cornell University Insect Collection, Ithaca, New York, USA (CUIC), illustrated in Fig. 474–475 (genitalia Fig. 1231–1232), bears the following nine rectangular labels (4^th handprinted with a red double frame, others printed with handwritten text shown in italics), eight white: [ El Campamiento | Col.PerenePERU | 27 June ‘20 ], [ Cornell Univ.Ex- | pedition Lot 607 | Sub 116 ], [ Cornell U.| Lot. 703 | Sub. 826 ], [ Cobalus | percosius | Det. | A.W.L. G.+S. ], [ Decinea | lucifer ♂ | (Huber) | Det. H.A. Freeman ], [ DNA sample ID: | NVG-22044C03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23117B11 | c/o Nick V. Grishin ], [ genitalia | NVG240817–37 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Oligoria (Oligoria) | peruvia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Junín Region, Chanchamayo Province, “Colonia del Perené”, El Campamiento.

Etymology.

The name is derived from the county of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected on the eastern slopes of the Andes in central Peru.

Comment.

The type locality of this species is also the type locality of Metiscus huaynai Lindsey, 1925, which is currently a junior subjective synonym of Sodalia sodalis (Butler, 1877).

Atrytonopsis dospuntos Grishin, new species

https://zoobank.org/83818FAE-875A-45E8-A3D9-49C67A0C3854

(Fig. 13 part, 476–477, 1233–1234)

Definition and diagnosis.

Genomic analysis of specimens from Oaxaca, Mexico, reveals that they form a clade sister to Atrytonopsis pittacus (W. H. Edwards, 1882) (type locality in USA: Arizona, Graham Co.) and are genetically differentiated from it at the species level in the nuclear genome (Fig. 13), and therefore they represent a new species. Its mitochondrial genomes experience introgression with A. pittacus, although some specimens may differ by 1.4% (9 bp) in the COI barcode, This new species keys to A. pittacus (N.1.6) in Evans (1955), but differs from it and other relatives by the following combination of characters: darker overall with smaller spots, e.g., the upper and the lower spot in the forewing discal cell are usually not connected with each other, ventral hindwing spots that form the postdiscal band are usually narrower, less diffuse, and with sharper-defined edges; and a slightly narrower valva, with a more prominent ampulla and a more pronounced concavity along the costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly85.29.5:A94C, aly5041.1.8:A195G, aly113.26.4:T138C, aly1294.3.3:C105T, aly536.43.1:A333C. Some specimens of the new species do not differ from A. pittacus in the COI barcode, likely due to introgression.

Barcode sequence of the holotype.

Sample NVG-21015A09, GenBank PV972574, 658 base pairs:

AACCTTATATTTTATTTTTGGTATTTGAGCTGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAGGAAATCCAGGCTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGCTCACCAAGGATCTTCAGTAGATTTAGCAATCTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCAGTTTTAGCTGGCGCTATTACTATACTATTAACTGATCGAAATCTTAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCCATTCTTTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 476–477 (genitalia Fig. 1233–1234), bears the following five rectangular labels (1^st handwritten, others printed), four white: [ Mex:Oax: road to | Grutas de San Sebastian | 10 July 1991–el.+5500’ | John Kemner ], [ DNA sample ID: | NVG-21015A09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23108B11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–22 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Atrytonopsis | dospuntos Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂ and 1♀ from Mexico, Oaxaca, John Kemner leg. [CMNH]: the type locality: 1♂ NVG-23108C02 10-Jul-1991 and 1♀ NVG-21015A10 13-Aug-1991 and 5 mi N of Oaxaca on Hwy 175, 6000’ 1-Aug-1990: 1♂ NVG-23108B12 genitalia H-1200 by H.A. Freeman (not located) and 1♂ NVG-23108C01.

Type locality.

Mexico: Oaxaca, road to Grutas de San Sebastian, elevation above 5500’.

Etymology.

In Spanish, dos puntos means colon. The name refers to the small size of discal cell forewing spots, resembling a colon punctuation mark. The name is a noun in apposition.

Distribution.

Southwestern Mexico.

Thespieus genta Grishin, new species

https://zoobank.org/F78D9DF9-B1D1-4A98-B6FA-0E34F01F4EA5

(Fig. 13 part, 478–479, 1235–1236)

Definition and diagnosis.

Genomic analysis of a specimen from southern Peru initially identified as Thespieus argentina Draudt, 1923 (type locality in Argentina: Salta, lectotype sequenced as NVG-18093D07) reveals that it is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 8.4% (55 bp), and therefore it represents a new species. This new species keys (incompletely) to T. argentina (O.7.16) in Evans (1955) and was probably included by him in this species, but differs from it and other relatives by males with a pale stigma, a narrower forewing discal cell spot, a well-developed spot in the forewing cell M₁-M₂, strongly separated from each other discal white spots in the hindwing cells Sc+R₁-Rs and Rs-M₁ (not slanted and frequently joined into a line); a more upturned harpe with a more strongly humped ventral margin and a narrower, rounded discal margin. This species is not cryptic, but due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1735.9.3:T273C, aly660.1.1:C66T, aly660.1.1:G174T, aly12063.10.1:C76G, aly12063.10.1:A113T, aly281.11.3:G75G (not C), aly281.11.3:T81T (not C), aly525.106.5:G144G (not T), aly133.30.3:C84C (not A), aly133.30.3:T123T (not A); and COI barcode: T112C, T259C, T274G, T361C, T571C.

Barcode sequence of the holotype.

Sample NVG-8065, GenBank PV972575, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAACCCCGGATCTTTAATTGGAGATGATCAAATCTATAATACCATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTGGGGGCCCCCGATATAGCTTTCCCACGAATAAATAATATAAGATTCTGAATATTACCCCCGTCATTAACATTATTAATCTCAAGAAGAATCGTAGAAAATGGTGCTGGGACTGGATGAACAGTATACCCACCTTTATCCTCAAATATCGCTCATCAAGGATCATCTGTTGACTTAGCAATTTTCTCCCTTCATTTAGCTGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACCTATCATTTGACCAAATACCACTATTTGTATGATCTGTCGGTATTACAGCCCTTCTTTTACTACTATCTTTACCTGTTTTAGCAGGAGCTATCACTATATTACTTACTGATCGAAATTTAAATACTTCTTTTTTCGACCCAGCAGGAGGGGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 478–479 (genitalia Fig. 1235–1236), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU: Cuzco Dept. | Santuario Histórico | Machu Picchu | Aguas Calientes, 2050 m | 13°09’S, 72°31’W | 21 October 2001 | D.H.Ahrenholz leg. ], [ DNA sample ID: | NVG-8065 | c/o Nick V. Grishin ], [ genitalia | NVG170208–50 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321905 ], and one red [ HOLOTYPE ♂ | Thespieus | genta Grishin ].

Type locality.

Peru: Cuzco Department, Santuario Histórico Machu Picchu, Aguas Calientes, elevation 2050 m, GPS −13.1500, −72.5167.

Etymology.

The name is formed from the name of its sister species [ar]gent[in]a made shorter to indicate its more northern distribution. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of southern Peru.

Thespieus panareus Grishin, new species

https://zoobank.org/7B483777-00F4-42E5-A0C0-047BD8BDB76C

(Fig. 13 part, 480–481, 1237–1238)

Definition and diagnosis.

Genomic analysis of a specimen from Panama reveals that it is sister to Thespieus macareus (Herrich-Schäffer, 1869) (type locality not given, likely in Mexico as deduced by genomic sequencing of the lectotype NVG-15035B02) and is genetically differentiated at the species level (Fig. 13); e.g., their COI barcodes differ by 8.4% (55 bp), and therefore it represents a new species. This new species keys to T. macareus (O.7.7) in Evans (1955) and was included by him in this species, but differs from it and other relatives by a typically larger discal brown spot in the cell Sc+R₁-Rs on the ventral hindwing; and a narrower valva with a less elongated harpe more rounded distad and with two teeth near the ampulla, which is more prominent than in T. macareus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1106.3.2:A260G, aly272.17.2:A94T, aly3446.4.1:A51T, aly1432.27.1:A81G, aly208.44.1:C198T, aly26.38.1:G210G (not A), aly26.38.1:A238A (not T), aly1222.7.5:C124C (not T), aly443.3.19:A141A (not C), aly443.3.19:T162T (not C); and COI barcode: T10C, T50C, T157C, C364A, T448C.

Barcode sequence of the holotype.

Sample NVG-18012A09, GenBank PV972576, 658 base pairs:

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATGTTAGGAACTTCCCTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCACGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTGGGGGCCCCCGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGAATGTTACCTCCTTCTTTAACATTGTTAATCTCAAGAAGAATCGTAGAAAATGGGGCAGGAACAGGATGAACAGTATATCCACCTTTATCTTCAAATATTGCACATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATCCTAGGAGCTATTAATTTTATCACAACAATCATTAACATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCAGTAGGTATTACAGCTTTACTTTTACTTTTATCTTTGCCTGTTTTAGCGGGTGCTATTACAATACTTCTTACTGATCGAAATTTAAATACCTCATTTTTCGATCCTGCGGGGGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 480–481 (genitalia Fig. 1237–1238), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA–CHIRIQUI | Volcan Baru | 23 Mar.’85 | S. S. Nicolay ], [ DNA sample ID: | NVG-18012A09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121B01 | c/o Nick V. Grishin ], [ genitalia | NVG241121–23 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450262 ], and one red [ HOLOTYPE ♂ | Thespieus | panareus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Chiriquí Province, Volcán Barú.

Etymology.

The name is a fusion of the name of the country of the type locality and the name of the sister species: Pana[ma] + [maca]reus. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in western Panama.

Thespieus maldan Grishin, new species

https://zoobank.org/BDB910B8-1865-465F-BFE4-17819D6970E1

(Fig. 13 part, 482–483, 1239–1240)

Definition and diagnosis.

Genomic analysis of specimens from Mexico initially identified as Thespieus dalman (Latreille, [1824]) (type locality in Brazil, lectotype sequenced as NVG-18078F01) reveals that they are not monophyletic with it and instead form a clade sister to Thespieus mandal Grishin, 2019 (type locality in Brazil: Rio de Janeiro), and are genetically differentiated from it at the species level (Fig. 13); e.g., their COI barcodes differ by 3.8% (25 bp), and therefore these specimens represent a new species. This new species keys to T. dalman (O.7.4) in Evans (1955), but differs from it and other relatives by having darker ventral side of wings, such as reduced pale scaling in the anterior part of the hindwing with larger (but still small) dark-brown discal spots and a darker brown area anteriad of the two largest hyaline spots; a broader valva with a larger ampulla and a more elongated harpe distally ending with a sharp and broad tooth, more strongly concave along the posteroventral margin and with a sharper, more prominent dorsal tooth near the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly770.41.5:T108G, aly528.8.2:C144A, aly686.17.2:T102C, aly322.15.3:T258C, aly420.49.2:G2496A; and COI barcode: T193C, A343T, T586A, T596C, A625G.

Barcode sequence of the holotype.

Sample NVG-19013B11, GenBank PV972577, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAACTGATTAGTTCCATTAATATTGGGAGCCCCTGACATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCTCCTTTATCCTCTAACATTGCTCATCAAGGATCTTCAGTAGATTTAGCAATTTTTTCACTTCATCTAGCTGGGATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTGCCTGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAAATCTAAATACTTCCTTCTTTGACCCTGCAGGGGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 482–483 (genitalia Fig. 1239–1240), bears the following eight rectangular labels (4^th handwritten, others printed with handwritten text shown in italics), seven white: [ MEXICO | Tamaulipas: | Rancho Pico de Oro | vic. of Los Kikos ], [ coll. | 6 Feb 1974 | Roy O. Kendall | & C. A. Kendall ], [ HESPERIIDAE, | Hesperiinae: | Thespieus delman | (Latreille, [1824]) | det. R. O. Kendall | [ ♂ M. & B. No. 263.1] ], [ Thespieus | dalman | det Warren ], [ DNA sample ID: | NVG-19013B11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22057D09 | c/o Nick V. Grishin ], [ genitalia | NVG241121–24 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Thespieus | maldan Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-19013B10 Mexico, San Luis Potosí, Sierra Madre Oriental, El Salto Falls, 23-Dec-1972, Roy O. Kendall and C. A. Kendall leg. [TAMU].

Type locality.

Mexico: Tamaulipas, Rancho Pico de Oro, vic. of Los Kikos.

Etymology.

The name is an anagram of the name of the relative, T. dalman, and is treated as a noun in apposition. As a mnemonic, letter l alphabetically precedes n, corresponding to the more northern distribution of T. maldan new species from northeastern Mexico, compared to T. mandal from southeastern Brazil. The two sister species, T. maldan new species and T. mandal, have similar names and are more distantly related to T. dalman, which is set apart by its more distinct name.

Distribution.

Currently known from northeastern Mexico (Tamaulipas, San Luis Potosí).

Subtribe Moncina A. Warren, 2008

Alychna bogotana Grishin, new species

https://zoobank.org/13A5BBD8-D8D0-49B8-92D7-8F0B60719AC5

(Fig. 14 part, 484–485, 1241–1242)

Definition and diagnosis.

Genomic analysis of a specimen from Bogotá, Colombia, initially identified as Alychna victa (Evans, 1955) (type locality in southern Peru: Urohuasi) reveals that it is genetically differentiated at the species level (Fig. 14); e.g., their COI barcodes differ by 6.8% (45 bp), and therefore it represents a new species. This new species keys to “Lychnuchus victa” (K.12.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: a broader yellow-orange discal band on the forewing; and a more elongated harpe with a rather straight serrated anterodorsal margin forming the right angle with the posterodorsal margin that is half as long and irregular, not strongly concave. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly207.4.4:T207A, aly207.4.4:A498T, aly2811.6.1:A603C, aly2811.6.1:C612T, aly2202.11.2:G215A, aly890.57.5:A48A (not G), aly890.57.5:A828A (not G), aly2012.47.1:G328G (not A), aly1841.4.6:G114G (not A), aly60.22.3:G48G (not A); and COI barcode: A28G, T82C, T232C, A391G, T436C, A508G.

Barcode sequence of the holotype.

Sample NVG-18111H01, GenBank PV972578, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGGGCAGGTATACTAGGAACTTCATTAAGTTTATTAATTCGTACTGAACTAGGAAACCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAATTCCATTAATATTAGGGGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGAATGTTACCCCCATCTTTAACATTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTATACCCCCCCCTTTCTTCTAATATTGCTCATCAAGGTTCATCTGTTGATTTAGCGATTTTTTCCTTACATTTAGCAGGAATTTCATCTATTTTAGGGGCCATTAATTTTATCACTACAATTATTAATATACGAATTAGAAACTTATCATTTGATCAAATACCACTATTTGTGTGATCTGTGGGAATTACAGCTTTATTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 484–485 (genitalia Fig. 1241–1242), bears the following seven rectangular labels (1^st handwritten, others printed, six white: [ Lychnuchus | olenus Hbr | Bogota ], [ EASmyth | Collection | 1947 ], [ DNA sample ID: | NVG-18111H01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG22035C07 | c/o Nick V. Grishin ], [ genitalia | NVG241121–25 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531337 ], and one red [ HOLOTYPE ♂ | Alychna bogotana | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Colombia: Bogotá.

Etymology.

The name is derived from the type locality and is an adjective.

Distribution.

Currently known only from the holotype collected in Bogotá, Colombia.

Alychna colonis Grishin, new species

https://zoobank.org/1D227B78-0E5D-4D59-B95E-9F8B2391F9DE

(Fig. 14 part, 486–487, 1243–1244)

Definition and diagnosis.

Genomic analysis of a specimen from northern Ecuador initially identified as Alychna exclamationis (Mabille, 1898) (type locality in Bolivia, lectotype sequenced as NVG-18042G08) reveals that it is not monophyletic with this species but is sister to a clade of several species (Fig. 14), and therefore it represents a new species. This new species is genetically differentiated from others at the species level, e.g., differing in the COI barcode by 5.6% (37 bp) from A. exclamationis; and keys to “Psoralis exclamationis” (J.43.3) in Evans (1955), but differs from it and other relatives by the following combination of characters: more brown-orangish overscaling, especially on the dorsal side, broader cream semihyaline spots on the forewing, a broader stigma; a broader harpe that is more extended posteriad, a shorter and less curved inward dorsal process of the harpe, the ending of the process can be seen in lateral view (thus the harpe is dorsally sharp viewed laterally), a less prominent hump on the costa near the ampulla, and a terminally slightly broader uncus in dorsal view. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.183.1:C91A, aly529.14.1:C102T, aly529.14.1:C225G, aly235.13.3:A61C, aly838.6.5:G75A, aly1085.3.2:T143T (not A), aly23605.1.41:T1245T (not G), aly1968.6.14:T88T (not C), aly208.4.4:G45G (not A), aly208.4.4:G69G (not A); and COI barcode: T50C, T59C, T124C, T337A, T542C.

Barcode sequence of the holotype.

Sample NVG-18121A12, GenBank PV972579, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACTTCACTAAGTTTACTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTCCCTCTTATATTAGGGGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCATTAATATTACTAATTTCAAGAAGAATCGTTGAAAATGGTGCAGGTACTGGATGAACTGTATATCCCCCCCTTTCCTCTAATATTGCACATCAAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATCTAGCTGGAATCTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTACTATTACTGCTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACTTCCTTCTTCGACCCAGCTGGAGGAGGGGACCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 486–487 (genitalia Fig. 1243–1244), bears the following seven rectangular labels (4^th handwritten, others printed with handwritten text shown in italics), six white: [ ECUADOR Napo Baeza | | 2377m. 10.V.82 #41 ], [ ECUADOR EXP. 1982 | H.E. Frania & | F.A.H. Sperling | collectors ], [ genitalia NO. | X-39 79 | J.M.Burns 1995 ], [ Psoralis ], [ DNA sample ID: | NVG-18121A12 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531930 ], and one red [ HOLOTYPE ♂ | Alychna colonis | Grishin ].

Type locality.

Ecuador: Napo Province, Baeza.

Etymology.

The name is formed from the word ‘colon’ and reflects the pattern of semi-equal pale forewing spots that are shaped more like a colon than like the letter ‘i’ (in A. ayonis) or an exclamation mark (in A. exclamationis). The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of northern Ecuador.

Alychna semicolonis Grishin, new species

https://zoobank.org/5DC2E3AC-0BD4-45F0-BB5A-9570ECF77019

(Fig. 14 part, 488–489)

Definition and diagnosis.

Genomic analysis of a specimen from southern Peru initially identified as Alychna exclamationis (Mabille, 1898) (type locality in Bolivia, lectotype sequenced as NVG-18042G08) reveals that it is not monophyletic with this species but is sister to the species described above and is genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 5.8% (38 bp), and therefore it represents a new species. This new species keys to “Psoralis exclamationis” (J.43.3) in Evans (1955), but differs from it and other relatives by the following combination of characters: medium-sized cream semihyaline spots on the forewing, broader than in Alychna ayonis Grishin, 2023 (type locality in Ecuador: Napo) but narrower than in Alychna colonis, new species; the dash distad of the stigma is several times the length of the spot near the base of the cell M₃-CuA₁, the subapical hyaline spot is very small (as in A. ayonis), the ventral hindwing is nearly uniformly brown, without pale spots. Due to the cryptic nature of this species, lacking abdomen in the holotype and the only known specimen, and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly529.14.1:C102T, aly529.14.1:C225G, aly536.183.1:C91A, aly29.10.1:A184T, aly235.13.3:A61C, aly1624.1.9:T87T (not C), aly2984.10.7:G102G (not A), aly1259.34.2:A25A (not C), aly4778.18.1:T777T (not C), aly322.10.3:G93G (not T); and COI barcode: T46C, A76G, T197C, T428C, T622C.

Barcode sequence of the holotype.

Sample NVG-23085D04, GenBank PV972580, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACCTCATTAAGTTTATTAATTCGTACAGAATTGGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTCTCATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGTGCAGGTACTGGATGAACTGTCTATCCCCCCCTTTCTTCTAATATCGCCCACCAAGGATCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATCTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATCATTAATATACGAATTAGAAATATATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCGGTATTAGCAGGAGCTATCACAATACTTTTAACTGATCGAAATTTAAACACTTCTTTCTTTGATCCAGCCGGAGGAGGGGACCCCATCTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 488–489, bears the following five rectangular labels (3^rd handwritten, others printed), four white: [ Marcapata ], [ 259. ], [ exclamationis Mab. | n. sp. e coll. Stg. ], [ DNA sample ID: | NVG-23085D04 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Alychna semicolonis | Grishin ]. The abdomen is missing in the holotype.

Type locality.

Peru: Cusco Region, Quispicanchi Province, Marcapata.

Etymology.

The name is formed from the word ‘semicolon’ and reflects the pattern of the pale forewing spots in this species that are shaped more like a semicolon, with the lower segment being longer than the upper. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of southern Peru.

Wahydra vekana Grishin, new species

https://zoobank.org/C881343F-A8D7-4F8E-89EE-2BFBEFFA4895

(Fig. 14 part, 490–491, 1245–1246)

Definition and diagnosis.

Genomic analysis of specimens from Colombia and Ecuador initially identified as Wahydra kenava (A. Butler, 1870) (type locality in Venezuela) reveals that they are genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore they represent a new species. This new species keys to “Zalomes kenava” (I.8.2) in Evans (1955), but differs from it and other relatives by the following combination of characters: darker overall, with smaller and more separated spots of the dorsal forewing, e.g., the subapical spot is smaller, and the discal spot by the inner forewing margin is disconnected from the band, because the spot in the cell CuA₂-1A+2A is broken into two; ventral hindwing darker spots are better defined and less diffuse especially in the discal area; the harpe is narrow, similar to that in W. kenava, evenly upturned but slightly more expanded terminally, serrated along the dorsal margin; the ampulla more expanded and its dorsal margin is aligned with the costa (lower in W. kenava and other species). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly318.28.1:A351T, aly890.57.5:A822G, aly1405.25.3:T441C, aly1405.25.3:A645T, aly12285.3.3:A433C; and COI barcode: A28A, T197C, T385T, T448T, T616T.

Barcode sequence of the holotype.

Sample NVG-22107F10, GenBank PV972581, 658 base pairs:

AACTTTATATTTCATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGACTAGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGGACTGGTTGAACAGTTTACCCCCCCCTTTCATCTAATATTGCTCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCCCTACATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATATATCATTTGATCAAATACCATTATTTGTATGATCAGTAGGAATCACAGCTTTACTTTTACTCTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTCTTACTGATCGAAACTTAAATACATCATTTTTTGATCCGGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 490–491 (genitalia Fig. 1245–1246), bears the following nine printed (text in italics handwritten) rectangular labels, eight white: [ COLOMBIA: | Guasca;July ‘69 ], [ J. Herrera | Collector ], [ Collection of | C. D. MacNeill ], [ Wahydra thisbe | (Hayw.) | Det. C.D. MacNeill ‘96 ], [ DNA sample ID: | NVG-22107F10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D11 | c/o Nick V. Grishin ], [ genitalia | NVG241114–06 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8568605 ], and one red [ HOLOTYPE ♂ | Wahydra vekana | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂ and 2♀♀: 1♂ NVG-22107F11, CASENT8568606 data as the holotype and Ecuador: 1♂ NVG-22042G10 and 1♀ NVG-22042G09 Baños, Feb-1939, K. J. Hayward leg. [ANSP]; 1♂ NVG-18091A01 Tungurahua, Cruz Loma, 2800 m, GPS −1.3333, −78.4167, 3-Nov-2013, J.-C. Petit and E. and J. Brockmann leg. [EBC]; and 1♀ NVG-18092C03 Imbabura, Río Cristopamba, Cuellaje, GPS 0.25, −78.52, 10-Dec-2013, J.-C. Petit leg. [EBC];

Type locality.

Colombia: Cundinamarca Department, Guasca.

Etymology.

The name is an anagram of the specific epithet of its sister species W. kenava and is treated as a noun in apposition.

Distribution.

Colombia and Ecuador.

Adlerodea asemodia Grishin, new species

https://zoobank.org/9D08494D-9818-4997-9C6D-8CB8E53B83CE

(Fig. 14 part, 492–493, 1247–1248)

Definition and diagnosis.

Genomic analysis of specimens from northwestern Ecuador initially identified as Adlerodea subpunctata (Hayward, 1940) (type locality in Argentina: Misiones) reveals that they are not monophyletic in the nuclear genome and are genetically differentiated from it at the species level in the nuclear genome (Fig. 14); however, their COI barcodes do not differ strongly (0.6%, 4 bp), and therefore they represent a new species. This new species keys (incompletely) to Adlerodea petrovna (J.42.2) in Evans (1955), but differs from it and other relatives by the following combination of characters: the fringes are mostly beige in color; the ventral side of wings is sprinkled with pale overscaling, except the darker region in the middle of the basal half on the forewing; the ventral hindwing with a single dark-brown (sometimes pupilled with pale brown) spot by the end of the discal cell; and the harpe is intricately elaborated along its dorsoanterior margin: a central long tooth of about the same length as the margins on either side of it armed with a small tooth on its dorsal side, a double-humped shallow projection at the base, and a distal tooth serrated along the dorsal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly322.22.2:T169A, aly2087.24.3:G276A, aly7069.13.1:A36T, aly1395.9.13:G54A, aly2532.20.3:C114T; and COI barcode: T118C, A379A, A433A, A550A, G631G.

Barcode sequence of the holotype.

Sample NVG-19024D04, GenBank PV972582, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACATCTTTAAGTTTATTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTACAACACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCACCCTCATTAATATTATTAATCTCAAGAAGAATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCCTTATCCTCAAATATTTCTCATCAAGGTTCTTCAGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAACTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCTTTATTATTACTTTTATCCCTACCAGTTTTAGCTGGGGCTATTACTATACTTCTTACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGGGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 492–493 (genitalia Fig. 1247–1248), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR Pichincha | Alluriquin 700m | 4 Nov’88 | S. S. Nicolay ], [ genitalia | ♂ slide/vial # | H1079 | Prep. S.S. Nicolay ], [ DNA sample ID: | NVG-19024D04 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532923 ], and one red [ HOLOTYPE ♂ | Adlerodea | asemodia Grishin ]. Paratypes: 2♂♂ from Ecuador, Pichincha [USNM]: 1♂ NVG-23126B04 Alluriquín, 700 m, 26-May-1988, D. H. Ahrenholz leg. and 1♂ NVG-19023E07, USNMENT 01532849 Río Palenque, 200m, 21-Sep-1975, S. S. Nicolay leg., genitalia H653.

Type locality.

Ecuador: Pichincha Province, Alluriquín, elevation 700 m.

Etymology.

The name is formed from the name of its sister species, A. asema, made longer to indicate more southern distribution. The name is treated as a noun in apposition.

Distribution.

Currently known only from northwestern Ecuador.

Mucia castana Grishin, new species

https://zoobank.org/274127DB-9078-428D-A4E5-CE689315CB72

(Fig. 14 part, 494–495, 1249–1250)

Definition and diagnosis.

Genomic sequencing of a specimen from the Ecuadorean Andes initially identified as Mucia rusta Evans, 1955 (type locality in Venezuela) reveals that it is genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore it represents a new species. This new species keys to Psoralis rusta (J.43.7) in Evans (1955), but differs from it by a narrower, straighter, and longer stigma; more elongated wings in males; more robust ampulla and a more concave costa of the valva; and the harpe protruding dorsad from the ampulla. Due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly887.27.1:C152A, aly887.27.1:C153A, aly363.18.13:C108T, aly102.10.2:A76C, aly102.10.2:T88G, aly1398.3.4:C108C (not T), aly1937.10.2:A33A (not C), aly1937.10.2:G64G (not A), aly839.9.1:T423T (not C), aly839.9.1:T468T (not C); and COI barcode: T22A, A91C, T235C, T367C, A479A.

Barcode sequence of the holotype.

Sample NVG-21048A04, GenBank PV972583, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTACTAATTCGAACAGAATTAGGTAATCCTGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGACTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCACCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCACCTCTATCTTCTAATATTGCCCACCAAGGATCATCTGTTGATTTAGCAATTTTCTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATATCATTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACTGCTTTATTATTACTTTTATCTTTACCCGTATTAGCAGGAGCTATTACAATACTTCTTACTGATCGAAACTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTC

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 494–495 (genitalia Fig. 1249–1250), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR ZAM | ZAMORA 2000 M | IX-08 ], [ M. Simon colln. | MGCL Accession | #2011–13 ], [ DNA sample ID: | NVG-21048A04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24065C11 | c/o Nick V. Grishin ], [ genitalia | NVG241111–21 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Mucia castana | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Zamora-Chinchipe Province, Zamora, elevation 2000 m.

Etymology.

In Latin, castanea means chestnut, and the name of this species reflects its darker rusty colors similarly to the name of its sister M. rusta. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of southeastern Ecuador.

Comment.

Male genitalia of M. rusta NVG-21048A05 from Venezuela: Mérida, Monte Zerpa, 2 km N of La Hechicera, 5-Nov-1994, D. L. Lindsley [MGCL], are illustrated for comparison in Fig. 1251–1255.

Mucia strigemma Grishin, new species

https://zoobank.org/43B3928F-9D8A-46B4-9DC5-EBD3A3E68149

(Fig. 14 part, 496–497)

Definition and diagnosis.

Genomic analysis reveals that a uniquely patterned specimen from the Ecuadorian Andes is placed in Mucia Godman, 1900 (type species Mucia thyia Godman, 1900, a junior subjective synonym of Hesperia zygia Plötz, 1886) as sister to both Mucia castana, new species (type locality in Ecuador, Zamora-Chinchipe) and Mucia rusta Evans, 1955 (type locality in Venezuela) (Fig. 14), and therefore represents a new species of Mucia, differing from Mucia castana by 5.2% (34 bp) and from Mucia rusta by 6.1% (40 bp) in the COI barcode. This new species differs from all other Hesperiidae by a line of three silvery elongated spots in the middle of the postdiscal area of the ventral hindwing, between the veins M₁ and CuA₂. Otherwise, it is completely rusty-brown on both sides of the wings, no other spots, but paler towards the inner margin of ventral forewing. The stigma is brand-like, consists of two elements, one at the base of the CuA₁-CuA₂ cell, somewhat triangular, and the other is an elongated oval below the vein CuA₂ and is surrounded by darker than ground color scales. This species is not cryptic and is confidently recognized by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly276378.16.1:C54T, aly155.9.12:G99C, aly155.9.12:C106T, aly378.23.9:C33T, aly378.23.9:A57T, aly275206.11.1:G593G (not A), aly275206.11.1:C604C (not T), aly6841.44.6:T174T (not A), aly6841.44.6:G176G (not C), aly2487.49.2:A158A (not G); and COI barcode: T79C, A181T, T232A, C497T, T619C, .

Barcode sequence of the holotype.

Sample NVG-24045D07, GenBank PV972584, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGCGCTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGAATACTTCCACCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCCCTCTCTTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTCTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATATCTTTATTTGTATGATCTGTTGGAATTACTGCTTTATTACTACTTTTATCATTACCTGTATTAGCGGGAGCTATTACCATACTTCTTACTGATCGAAATTTAAATACATCCTTTTTTGATCCCGCAGGAGGGGGAGACCCTATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Nature Education Centre of the Jagiellonian University, Kraków, Poland (CEPUJ), illustrated in Fig. 496–497, bears the following four printed rectangular labels (2^nd green, 4^th red, others white: [ ECUADOR | Prov. Morona Santiago | Limon-Gualaceo road; | east | S 03°01’26” W | 78°35’07” | 2200 m, | 30.VIII.2003 | Leg. J. Wojtusiak ], [ CEP-DNA | 7329 | tissue | sample ], [ DNA sample ID: | NVG-24045D07 | c/o Nick V. Grishin ], and [ HOLOTYPE ♂ | Mucia strigemma | Grishin ].

Type locality.

Ecuador: Morona-Santiago Province, Gualaceo–Limón Road, east, elevation 2200 m, GPS −3.0239, −78.5853.

Etymology.

In Latin, striga means streak, tri-is for three, and gemma means gem: the name is given for a streak of three silvery spots on ventral hindwing unique to this species among all Hesperiidae worldwide. The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of southern Ecuador.

Vinius panamius Grishin, new species

https://zoobank.org/C38094DA-7084-42EA-AD61-DB068835429A

(Fig. 14 part, 498–501, 1256–1257)

Definition and diagnosis.

Genomic analysis of specimens from Panama initially identified as Vinius exilis (Plötz, 1883) (type locality in “California”, likely in South America, probably in Brazil) reveals that they are genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore they represent a new species. This new species keys to “Vinius exilis” (I.10.3(b)) in Evans (1955), but differs from it and other relatives by males lacking the hindwing underside marginal row of brown dome-shaped spots that is reduced to a submarginal row of spots present in some cells and a marginal line disappearing toward the tornus; a broader dark area at the dorsal hindwing apex; a broader discal band on the forewing; dark anal tufts of the hindwing; and the dark round spot in the middle of the ventral hindwing is not expressed and is reduced to spots of the same size as the rest. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1265.7.2:A105G, aly2874.13.3:A81T, aly84.16.14:C42T, aly2165.2.6:T51C, aly798.33.49:A64G; and COI barcode: T10C, T352C, T358C, T418C, A583G.

Barcode sequence of the holotype.

Sample NVG-23121D05, GenBank PV972585, 658 base pairs:

AACTTTATACTTTATTTTTGGAATTTGAGCCGGTATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCTCCTCTTTCCTCTAACATTGCCCATCAAGGATCTTCTGTTGATTTAGCAATCTTCTCCCTTCATTTAGCAGGAATCTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGACCAAATACCATTATTTGTTTGATCTGTAGGTATTACAGCACTATTATTACTCTTATCTTTACCCGTATTAGCAGGTGCTATTACAATACTTTTGACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 498–499 (genitalia Fig. 1256–1257), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PANAMA: 1000m. | Herrera, Cerro | Alto Higo | 28. Dec. 1984 | Gordon Small ], [ DNA sample ID: | NVG-23121D05 | c/o Nick V. Grishin ], [ genitalia | NVG250720–50 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Vinius panamius | Grishin ]. Paratype: 1♀ NVG-19016D09, USNMENT_01532321 the same data as the holotype but 27-Dec-1984 (Fig. 500–501).

Type locality.

Panama: Herrera Province, Cerro Alto Higo, elevation 1000 m.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Panama.

Cynea (Cynea) veneatra Grishin, new species

https://zoobank.org/E1B049D4-5500-4F71-8D62-6C4EC3723435

(Fig. 14 part, 502–503, 1258–1259)

Definition and diagnosis.

Genomic analysis of a specimen from Venezuela initially identified as Cynea (Cynea) megalops (Godman, 1900) (type locality in Mexico (Tabasco), Costa Rica, and Panama) reveals that it is genetically differentiated at the species level in the nuclear genome (Fig. 14); however, their COI barcodes do not differ strongly (0.6%, 4 bp), and therefore it represents a new species. This new species keys to C. megalops (L.7.11) in Evans (1955), but differs from it and other relatives by the following combination of characters: a better defined pale area by the ventral forewing tornus, not as in C. megalops; a terminally broader valva with an expanded and rounded ampulla giving it a bulb-shaped appearance; a larger ampulla; and a thinner, longer tooth of the harpe by the ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1454.4.4:T66C, aly166451.1.2:G81A, aly824.10.3:T111C, aly275215.13.5:A30G, aly275215.13.5:C63T, aly2250.14.1:T3303T (not C), aly5715.5.2:G255G (not A), aly1041.16.6:G63G (not A), aly1283.3.1:T427T (not A), aly1283.3.1:G583G (not A); and COI barcode: G200A, T220C, C343C, T403A, T613C.

Barcode sequence of the holotype.

Sample NVG-18119C12, GenBank PV972586, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATACTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTTCCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCTTCTAATATTGCTCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAACTTTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTTTAACAGATCGAAATTTAAATACTTCTTTTTTCGATCCTGCTGGAGGAGGAGATCCCATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 502–503 (genitalia Fig. 1258–1259), bears the following six rectangular labels (4^th handwritten, others printed), five white: [ VENEZUELA: Aragua; | Rancho Grande,1100m | 17–20 I 1978 | blacklight, cloud | forest,J.B.Heppner ], [ Cynea sp ], [ DNA sample ID: | NVG-18119C12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035C03 | c/o Nick V. Grishin ], [ genitalia | NVG241121–26 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cynea (Cynea) | veneatra Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Venezuela: Aragua, Rancho Grande, elevation 1100 m.

Etymology.

In Latin, ater means black, given to this dark-colored species from Venezuela. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Venezuela.

Cynea (Cynea) equatra Grishin, new species

https://zoobank.org/52BA5D9C-2FE4-46F8-8A02-D7D4BB243F6D

(Fig. 14 part, 504–505, 1260–1262)

Definition and diagnosis.

Genomic analysis of a specimen from Ecuador initially identified as Cynea (Cynea) megalops (Godman, 1900) (type locality in Mexico (Tabasco), Costa Rica, and Panama) reveals that it is genetically differentiated at the species level (Fig. 14); e.g., their COI barcodes differ by 0.9% (6 bp), and therefore it represents a new species. This new species keys to C. megalops (L.7.11) in Evans (1955), but differs from it and other relatives by the following combination of characters: a darker ventral forewing by the tornus without a defined paler area; the entire outer third of the ventral hindwing is slightly paler than the base; the valva is only slightly expanded towards the harpe and the harpe is somewhat broader than the valva and terminally flatter than in C. megalops; the harpe near the base has a small and sharp tooth in the middle of the internal margin; the tooth of the harpe near the ampulla is narrower than in C. megalops and more similar to the new species described above; and the ampulla is smaller. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly594.19.7:C102T, aly770.37.4:A617G, aly536.113.3:T126C, aly1489.16.1:G288A, aly2275.8.50:C240T, aly9349.6.1:G138G (not A); and COI barcode: T157C, A160A, T287C, C401T, A574T.

Barcode sequence of the holotype.

Sample NVG-18119D01, GenBank PV972587, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTTCCTCCTTCATTAATATTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCTCCTTTATCTTCTAATATTGCTCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAACTTTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCTTTTTTCGATCCTGCTGGAGGAGGAGATCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 504–505 (genitalia Fig. 1260–1262), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR Pichincha | Tandapi 1500m | 22 May ‘88 | S. S. Nicolay ], [ genitalia | ♂ slide/vial # | H1041 | Prep. S.S. Nicolay ], [ DNA sample ID: | NVG-18119D01 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531865 ], and one red [ HOLOTYPE ♂ | Cynea (Cynea) | equatra Grishin ].

Type locality.

Ecuador: Pichincha Province, Tandapi, elevation 1500m.

Etymology.

In Latin, ater means black, given to this dark-colored species from Ecuador. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of northern Ecuador.

Lectotype designation for Hesperia corisana Plötz, 1882

Hesperia corisana Plötz, 1882, the name attributed to Möschler (Möschl.) by Plötz in the original description, was described from an unstated number of syntypes from Suriname (Plötz 1882a) and is currently treated as a valid species of Cynea Evans, 1955 (type species Hesperia cynea Hewitson, 1876) (Mielke 2005). Pamphila corisana Möschler, 1883 was described from a single male, the holotype by monotypy (Möschler 1883), and is regarded as a junior subjective synonym of Cynea corisana (Plötz, 1882), thus being its junior secondary homonym. The descriptions of H. corisana and P. corisana are similar, and Möschler has reported sharing specimens with Plötz for identification (Möschler 1876). Because Plötz’s works presented identification keys for all Hesperiidae known to him (and not just described new species) and he specifically attributed the name corisana to Möschler, it is likely that Plötz did not mean to “describe” this species as new in a sense of adding his name to the species name (he was adding “Pl.” to the names of “his” species). Hence, he was merely including Möschler’s (yet to be described) species in his key, based on Möschler’s specimens. However, it remains unknown whether Plötz had other specimens at the time of the description that he considered to be this species.

Therefore, the future holotype of P. corisana Möschler was a syntype of H. corisana Plötz. To stabilize nomenclature and define the name H. corisana objectively, N.V.G. hereby designates the syntype in the MFNB collection, the male, which is also the holotype of Pamphila corisana Möschler, 1883, that bears the following nine labels (1^st purple, 2^nd green, 3^rd pink, others white; 2^nd–4^th and 7^th handwritten, others printed): [ Origin. ], [ Surinam | HswKl.78. ], [ Type | Verh.Z.b.Ges. Wien. | 1882.p.328 ], [ Corisana | Möschl: ], [ Coll. Möschl. ], [ Coll. | Staudinger ], [ Coll Staudinger | K. 674. ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 44a032 ], [ DNA sample ID: | NVG-18042G11 | c/o Nick V. Grishin ], as the lectotype of Hesperia corisana Plötz, 1882. Only the thorax on the pin is left from the lectotype, and the wings, head, and abdomen are missing. As a result of this lectotype designation, Pamphila corisana Möschler, 1883, a junior secondary homonym, also becomes a junior objective synonym of Hesperia corisana Plötz, 1882. The COI barcode sequence of the lectotype, sample NVG-18042G11, GenBank PV983802, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACCTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTTCCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCTCCTTTATCTTCTAATATTGCTCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAACTTTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTTT AACAGATCGAAATTTAAATACTTCTTTTTTCGATCCTGCTGGAGGAGGAGATCCCATTTTATACCAACATTTATTT

Cynea (Nycea) pindus Grishin, new species

https://zoobank.org/49A011AC-E08F-46C4-BF68-EF5DE969B6F0

(Fig. 14 part, 506–507, 1263–1265)

Definition and diagnosis.

Genomic analysis of specimens from Ecuador and Guyana identified as Cynea (Nycea) corisana (Plötz, 1882) (type locality in Suriname, lectotype sequenced as NVG-18042G11) reveals that they are not monophyletic with it and genetically differentiated at the species level (Fig. 14); e.g., their COI barcodes differ by 6.8% (45 bp), and therefore they represent a new species. This new species keys to “C. corisana” (L.7.7) in Evans (1955), which he misidentified, and may be this species that differs from its relatives by the following combination of characters: brown wings above and beneath; the ventral forewing with a broad and diffuse paler area towards the tornus; the hindwing with a central pale spot and a postdiscal row of such spots, all dot-like and may be vestigial; the aedeagus is terminally split, with one of the prongs being spine-shaped; the valva is bulbous; and the harpe is short and rounded, with a more robust tooth by the ampulla that is more strongly expanded dorsad. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly727.6.5:A61C, aly1651.28.2:T57A, aly1651.26.8:T60C, aly1651.26.8:T126C, aly1097.6.2:A1377T; and COI barcode: T118C, A127T, A334T, T442C, T547A, A622G.

Barcode sequence of the holotype.

Sample NVG-18119C09, GenBank PV972588, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATGTTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGAATACTTCCCCCATCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGTTGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCTCATCAAGGTAGATCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAACATACGAATTAGTAATATAACATTTGATCAAATACCTCTATTTGTATGATCAGTAGGTATTACAGCATTATTATTACTTTTATCATTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCGGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 506–507 (genitalia Fig. 1263–1265), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ GUYANA: Region 9 | Kanuku Mts., Nappi Creek | 500’-1000’ | 03°20.7’N 59°34.2’W | 21 Feb - 10 Mar 1999 | leg. S. Fratello, R. Hanner, | S. Hendricks, R. Williams. ], [ DNA sample ID: | NVG-18119C09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035C04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–27 | c/o Nick V. Grishin ], [ {QR Code} USNM ENT | 00232459 ], and one red [ HOLOTYPE ♂ | Cynea (Nycea) | pindus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂: NVG-18119C07, USNMENT 00232457 Guyana, Region 9, Kanuka Mts., Nappu Mt., 1000’–1500’, GPS 3.3250, −59.5583, 21-Feb-10-Mar-1999, S. Fratello, R. Hanner, S. Hendricks, R. Williams leg. [USNM] and NVG-18119D09, USNMENT 01531870 Ecuador, Napo, 4 km Tena-Pano Rd., 600 m, GPS −1.0333, −77.8333, 25-Sep-1990, S. S. Nicolay leg., genitalia H1087 [USNM].

Type locality.

Guyana, Kanuku Mountains, Nappi Creek, elevation 500’–1000’, GPS 3.345, −59.570.

Etymology.

The name refers to the Pindus mountains in Greece, where the Achelous River rises. The name is a masculine noun in apposition.

Distribution.

Currently known from Ecuador and Guyana.

Lectotype designation for Cobalus columbaria Herrich-Schäffer, 1870

Cobalus columbaria Herrich-Schäffer, 1870 (type locality in Brazil), presently a valid—and the type—species of Onophas Godman, 1900, was described from at least one female syntype (Herrich-Schäffer 1870), which we found in the MFNB collection. To stabilize nomenclature and define the name C. columbaria objectively, N.V.G. hereby designates the syntype in the MFNB collection, the female that bears the following seven labels (1^st purple, others white; 2^nd and 4^th handwritten, others printed): [ Origin. ], [ columbaria HS 78 | Tf. 540 ], [ Coll. H.–Sch. ], [ Coll. | Staudinger ], [ Columbaria | H-Sch ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 3226e3 ], [ DNA sample ID: | NVG-15035E01 | c/o Nick V. Grishin ], as the lectotype of Cobalus columbaria Herrich-Schäffer, 1870. The lectotype is missing both antennae and its right wing was torn off near the anal area and glued back to leave a gap between the de-attached segment and folded anal area. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15035E01, GenBank PV972589, 658 base pairs is:

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTCTAAGAATATTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTGCCCCCTTCATTAATATTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCATTATCTTCTAATATTGCCCACCAAGGTTCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCCATCTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATGTCATTTGATCAAATACCTTTATTTGTTTGATCCGTTGGAATTACTGCACTTTTATTACTTCTATCTTTACCTGTATTAGCAGGAGCTATTACCATATTATT AACAGATCGAAATTTAAATACCTCCTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Onophas distigma Bell, 1930 is a junior subjective synonym of Onophas columbaria (Herrich-Schäffer, 1870), but Onophas flossites (M. Butler, 1874) is a valid species

Genomic analysis of Onophas Godman, 1900 (type species Cobalus columbaria Herrich-Schäffer, 1870) reveals that the lectotype of Onophas columbaria (Herrich-Schäffer, 1870) (type locality in Brazil) is placed among specimens from Southeast and South Brazil, sister to a specimen from Rio de Janeiro and together with Onophas columbaria distigma E. Bell, 1930 (type locality in Brazil: Santa Catarina, holotype sequenced as NVG-18025G09) (Fig. 14). Therefore, we hypothesize that the type locality of O. columbaria might have been in Brazil: Rio de Janeiro (to be tested by sequencing of additional specimens), and that Onophas columbaria distigma E. Bell, 1930, is a new junior subjective synonym of Onophas columbaria (Herrich-Schäffer, 1870). Phenotypically, both the lectotype of O. columbaria (female) and the holotype of O. columbaria distigma (male) have a two-toned ventral hindwing with a yellowed base and warm brown distal half. Evans (1955) applied the name Onophas columbaria columbaria to a taxon with a more uniformly colored ventral hindwing and a stigma as a result of misidentification. The name of this taxon is Onophas flossites (M. Butler, 1874), reinstated status, (type locality in Brazil: Amazonas), which we propose to treat as a species distinct from Onophas columbaria (Herrich-Schäffer, 1870) due to genetic differentiation in the nuclear genome (Fig. 14a). However, their COI barcodes, together with entire mitochondrial genomes do not differ, except for variation (Fig. 14b).

Onophas flossus Grishin, new species

https://zoobank.org/1D2ACFDC-6F6C-4E9E-AB2D-D7374BF955BD

(Fig. 14 part, 508–509, 1266–1267)

Definition and diagnosis.

Genomic analysis of specimens from Costa Rica, Panama, and Colombia initially identified as Onophas flossites (M. Butler, 1874), reinstated status, (type locality in Brazil: Amazonas), which was previously a junior subjective synonym of Onophas columbaria columbaria (Herrich-Schäffer, 1870) (type locality in Brazil, likely Rio de Janeiro) as a result of misidentification, reveals that they are genetically differentiated from it at the species level in the nuclear genome (Fig. 14) (their COI barcodes do not differ), and therefore they represent a new species. This new species keys to O. columbaria columbaria (J.51.1(a)) in Evans (1955), which he misidentified and included the new species into it, but differs from it and other relatives by the following combination of characters: a more uniformly colored pale yellowish-brown beneath; a typically less extensive yellowish-brown area from the ventral forewing apex and an area of a darker-brown color extending outward and slightly anteriad from the pale discal patches; more robust and terminally not as rounded uncus arms that are more widely separated from each other with a V-shaped (rather than U-shaped) cleft between them, and longer, narrower harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1019.25.7:C75A, aly423.28.2:C87T, aly1370.21.5:A540G, aly322.21.1:G180A, aly361.12.2:C942T; and COI barcode does not distinguish species in this group.

Barcode sequence of the holotype.

Sample NVG-23116F09, GenBank PV972590, 658 base pairs:

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTCTAAGAATATTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAATATTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCATTATCTTCTAATATTGCCCACCAAGGTTCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCCATCTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATGTCATTTGATCAAATACCTTTATTTGTTTGATCCGTTGGAATTACTGCACTTTTATTACTTCTATCTTTACCTGTATTAGCAGGAGCTATTACCATATTATTAACAGATCGAAATTTAAATACCTCCTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 508–509 (genitalia Fig. 1266–1267), bears the following four rectangular printed (text in italics handwritten) labels, three white: [ Farfan, | Panama C. Z. | 8 Oct. ‘63 | S. S. Nicolay ], [ Onophas ♂ | columbaria | Det. H-S. | S.S. Nicolay ], [ DNA sample ID: | NVG-23116F09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Onophas flossus | Grishin ]. Paratypes: 8♂♂ and 2♀♀: 1♂ NVG22109C08, CASENT8568762 Costa Rica, Putarenas, Osa Peninsula, 3.5 mi S Rincon, GPS 8.6992, −83.4841, 28-Feb-12-Mar-1969, collection of S. D. MacNeill leg. [CAS]; Panama: 1♂ NVG-22111D08 Chiriqui, old [ca. 1900], Ribbe leg. [MFNB]; Veraguas, Isla Coiba, G. B. Small leg. [USNM]: 1♂ NVG-23116F11 Represa, 25-Feb1981 and 1♂ NVG-19023E09 (leg, DNA sequenced), NVG-23119F09 (abdomen, DNA stored), USNMENT 01532851 Río Chagres, GPS 7.50, −81.70, 15-Apr-1981, genitalia NVG250720–48; and Panamá: 1♂ NVG23116F10 Cerro Jefe, 2000’, 12-Apr-1971, G. B. Small leg.[USNM] and 1♀ NVG-22111D06 no locality details, old [ca. 1900], Ribbe leg. [MFNB]; and Colombia: 1♂ NVG-23116F12 Valle del Cauca, Buenaventura, 14-Oct1980 [USNM] and Magdalena, Holland collection [CMNH]: 1♂ NVG-23112E04 Minca, 2000 ft, June-old and Cacagualito, 1500 ft, May-old: 1♂ NVG-23112E05 and 1♀ NVG-23112E06.

Type locality.

Panama: Panamá Oeste Province, near Playa Farfán, formerly known as “Farfan, Canal Zone.”

Etymology.

The name formed from the name of the sister species O. flossites made shorter to indicate more northern distribution. The name is treated as a noun in apposition.

Distribution.

Costa Rica, Panama, and Colombia.

Onophas flos Grishin, new species

https://zoobank.org/B2EF0683-084C-481E-9CB5-C80F031014E7

(Fig. 14 part, 510–511, 1268–1269)

Definition and diagnosis.

Genomic analysis of specimens from Guatemala, Honduras, and Costa Rica initially identified as Onophas flossites (M. Butler, 1874), reinstated status, (type locality in Brazil: Amazonas), which was previously a junior subjective synonym of Onophas columbaria columbaria (Herrich-Schäffer, 1870) (type locality in Brazil, likely Rio de Janeiro) as a result of misidentification, reveals that they are not monophyletic with it, and instead form a clade sister to the new species described above, but are genetically differentiated from it at the species level in the nuclear genome (Fig. 14) (their COI barcodes do not differ), and therefore they represent a new species. This new species keys to O. columbaria columbaria (J.51.1(a)) in Evans (1955), which he misidentified and included the new species into it, but differs from it and other relatives by the following combination of characters: a more uniformly colored pale yellowish-brown beneath; a typically less extensive yellowish-brown area from the ventral forewing apex and an area of darker-brown color extending outward and slightly anteriad from the pale discal patches; smaller and terminally more rounded uncus arms that are closer to each other with a U-shaped (rather than V-shaped) cleft between them, and shorter, terminally broader. and more rounded harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2954.3.1:T408A, aly2954.3.1:T801A, aly84.89.2:A48G, aly84.89.2:A66G, aly6654.6.2:C110A; and COI barcode does not distinguish species in this group .

Barcode sequence of the holotype.

Sample NVG-23085A05, GenBank PV972591, 658 base pairs:

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTCTAAGAATATTAATTCGTACAGAATTAGGAAATCCAGGATTTTTAATTGGAGATGATCAAATTTATAACACCATTGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAATATTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCATTATCTTCTAATATTGCCCATCAAGGTTCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCCATCTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATATGTCATTTGATCAAATACCTTTATTTGTTTGATCCGTTGGAATTACTGCACTTTTATTACTTCTATCTTTACCTGTATTAGCAGGAGCTATTACCATATTATT AACAGATCGAAATTTAAATACCTCCTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 510–511 (genitalia Fig. 1268–1269), bears the following four rectangular labels (first two handwritten, others printed), three white: [ Honduras ], [ ♂ Onophas columbaria | HS.sec.G.S.in coll.Stg. | Honduras ], [ DNA sample ID: | NVG-23085A05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Onophas flos | Grishin ]. Paratypes: 1♂ and 3♀♀: Guatemala, Cayuga, old, Schaus and Barnes coll. [USNM]: 1♂ NVG-23116F06 Mar, 1♀ NVG-23116F08 Sep, and 1♀ NVG-23116F07 Oct and 1♀ NVG-24067B09 Costa Rica, Heredia, La Selva Biological Station, approx. GPS 10.4333, −84.0167, 16-Feb-2002, D. Wagner [MGCL].

Type locality.

Honduras.

Etymology.

The name formed from the name of the sister species O. flossus, new species, made shorter to indicate more northern distribution. The name is a treated as noun in apposition.

Distribution.

Mexico to Costa Rica.

Eutus costa Grishin, new species

https://zoobank.org/29EE48CA-AF64-4872-B19E-F8D136144009

(Fig. 14 part, 512–513, 1270)

Definition and diagnosis.

Genomic analysis of a specimen from Costa Rica initially identified as Eutus yesta (Evans, 1955) (type locality in Peru: Junín) reveals that it is genetically differentiated at the species level (Fig. 14); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore it represents a new species. This new species keys to Thoon yesta (J.48.8) in Evans (1955), but differs from it and other relatives by a slightly smaller stigma, a terminally narrower harpe ending in a point, and a broader valva with a smaller ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2379.11.16:C151T, aly2379.11.16:G186A, aly2012.38.15:A78G, aly2012.38.15:A96C, aly420.39.1:T76C, aly1651.41.7:C216C (not T), aly2258.4.68:C90C (not A), aly527.15.2:A84A (not T), aly1603.39.1:A383A (not G), aly9588.11.1:A149A (not T); and COI barcode: T38C, T74C, C90T, T145C, A328A, T478C.

Barcode sequence of the holotype.

Sample NVG-19044D07, GenBank PV972592, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACTTCCTTAAGTTTATTAATTCGTACTGAACTAGGAAATCCAGGCTTTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATCATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATACTATTAATCTCAAGAAGAATCGTGGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCTTTATCTTCTAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGTAACATATCATTTGATCAAATACCTTTATTTGTATGATCAGTAGGTATTACCGCTTTATTATTACTTTTATCCTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCCATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 512–513 (genitalia Fig. 1270), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ TURRIALBA,AIS | COSTA RICA,620m | 31.5.46 | HH & FM BROWN ], [ Collection | of F.M.Brown ], [ G1956 ], [ DNA sample ID: | NVG-19044D07 | c/o Nick V. Grishin ], [ {QR Code} | AMNH_IZC 00337990 ], and one red [ HOLOTYPE ♂ | Eutus costa | Grishin ].

Type locality.

Costa Rica: Cartago Province, Turrialba, elevation 620 m.

Etymology.

The name is derived from the country of the type locality and is a noun in apposition.

Distribution.

Currently known only from the holotype collected in central Costa Rica.

Comment.

The type locality of this species is also the type locality of Calephelis browni McAlpine, 1971 (Riodinidae).

Thoon dius Grishin, new species

https://zoobank.org/EBF335D2-4BD5-402F-9A61-C1966F3819EA

(Fig. 14 part, 514–515, 1271–1272)

Definition and diagnosis.

Genomic analysis of specimens from Mexico initially identified as Thoon modius (Mabille, 1889) (type locality in Panama: Chiriquí) reveals that they are genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore they represent a new species. This new species keys to T. modius (J.48.3) in Evans (1955) and was probably included by him in this species, but differs from it and other relatives by the following combination of characters: overall darker, with smaller spots (e.g., only a single small subapical hyaline spot on the forewing and smaller ventral hindwing cream spots); purplish (rather than yellowish) overtones of the ventral side of the wings; the valva less concave along the ventral margin; the harpe with three teeth along the outer margin and the margin between the dorsal and the top posterior teeth is concave, angled (not straight), and serrated; and the dorsal tooth of the harpe is narrower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly216.64.13:C136T, aly221.5.6:C134G, aly221.5.6:T157G, aly127.12.1:T87G, aly2582.23.3:C115T; and COI barcode: C483T, A511G, T529C, T562A, T619C.

Barcode sequence of the holotype.

Sample NVG-22109A10, GenBank PV972593, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTCTTAGTTTATTAATTCGTTCAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTATACCCCCCTCTTTCTGCTAATATTGCTCATCAAGGTTCATCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATTATTTGATCAAATACCTTTATTTGTTTGGTCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCAGTTTTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCCGCTGGAGGAGGGGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 514–515 (genitalia Fig. 1271–1272), bears the following ten rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), nine white: [ MEX.: Tamaulipas | Gomes Farias | XII-22–73 ], [ W. W. McGuire | Collector ], [ ] no text on this label, an antenna and a segment of leg are glued to it, [ Collection of | C.D.MacNeill ], [ Thoon | modius(mab.) | Det. C.D. MacNeill ‘97 ], [ DNA sample ID: | NVG-22109A10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015D12 | c/o Nick V. Grishin ], [ genitalia | NVG241114–07 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8568737 ], and one red [ HOLOTYPE ♂ | Thoon | dius Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 4♀♀ from Mexico: 1♀ NVG-22109A09, CASENT8568736 Tamaulipas, Gomez Farias, 23-Dec-1972, W. W. McGuire leg. [CAS]; 1♂ NVG-22109A11, CASENT8568738 Nayarit, San Blas, Playa Miramar, 24-Dec-1971, C. D. MacNeill leg. [CAS]; 2♀♀ Guerrero, Acahuizotla, T. Escalante leg. [MGCL]: NVG-23056C10 Nov-1960 and NVG-23056C11 Nov-1947; and 1♀ NVG-23056C12 Veracruz, Catemaco, Aug-1952, T. Escalante leg. [MGCL].

Type locality.

Mexico: Tamaulipas, Gómez Farías.

Etymology.

The name is formed from the name of its sister species, T. modius, made shorter for this more northern species. The name is trated as a noun in apposition.

Distribution.

Mexico, recorded from Tamaulipas, Veracruz, Guerrero, and Nayarit.

Thoon rondius Grishin, new species

https://zoobank.org/5D8E504B-0373-4CC7-BE2E-366C4DAA26EA

(Fig. 14 part, 516–517, 1273–1275)

Definition and diagnosis.

Genomic analysis of specimens from Mexico initially identified as Thoon modius (Mabille, 1889) (type locality in Panama: Chiriquí) reveals that they are genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore they represent a new species. This new species keys to T. modius (J.48.3) in Evans (1955) and was probably included by him in this species, but differs from it and other relatives by the following combination of characters in females: overall darker but with medium-sized spots (e.g., three small subapical hyaline spots on the forewing, the one in cell R₃-R₄ is minute and could be absent in some specimens, and smaller but well-defined and sharp ventral hindwing cream spots) and grayer violaceous (rather than purplish or yellowish) overtones of the ventral side of the wings. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly393.9.2:C76G, aly393.9.2:T78C, aly318.40.2:A33G, aly318.40.2:G55C, aly3194.3.1:T87G; and COI barcode: T115C, C184T, T523C, T565G, T595C, T619A.

Barcode sequence of the holotype.

Sample NVG-23056D05, GenBank PV972594, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGAACTTCTCTTAGTTTATTAATTCGTTCAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCATTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCCCTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTATACCCCCCTCTTTCTGCTAATATTGCTCATCAAGGTTCATCTGTTGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTGTCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATCACAGCTTTATTATTACTTTTATCTTTACCAGTTTTAGCTGGGGCTATTACTATACTTTTAACAGATCGAAACCTTAATACTTCTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 516–517 (genitalia Fig. 1273–1275), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ BRASIL: Rondônia | linea C-10 (at Rio | Pardo), off B-65 | 5 km S of Cacaulândia | 16 July 1995 | leg. O. Gomes ], [ TRAP # 6 | 2^nd growth ], [ > no text, a leg is glued to this label, [ DNA sample ID: | NVG-23056D05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24065E05 | c/o Nick V. Grishin ], [ genitalia | NVG241111–22 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Thoon rondius | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-23056D06 Brazil, Rondônia, B-65, 3 km N of C-20, 8 km N of Cacaulândia, 1-Nov-1990, G. T. Austin [MGCL].

Type locality.

Brazil: Rondônia, 5 km S of Cacaulândia, linea C-10 (at Rio Pardo), off B-65.

Etymology.

The name is formed from the name of its sister species, T. modius, fused with the name of the state of the type locality. The name is treated as a noun in apposition.

Distribution.

Currently known only from Rondônia, Brazil.

Alerema complex Grishin, new species

https://zoobank.org/A5A16E9B-945F-4636-8ED5-2845C13BEBE5

(Fig. 14 part, 518–519, 1276–1278)

Definition and diagnosis.

Genomic analysis of specimens from South Texas, USA, and Mexico initially identified as Alerema simplex (Bell, 1930) (type locality in Brazil: Santa Catarina) reveals that they are genetically differentiated from it at the species level (Fig. 14); e.g., their COI barcodes differ by 1.4% (9 bp), and therefore they represent a new species. This new species keys to “Tigasis simplex” (J.44.8) in Evans (1955), but differs from it and other relatives by the following combination of characters: slightly more prominent spots on the ventral forewing; stronger purplish gloss on the ventral side of the wings; the harpe has a rounded dorsal and posterior margin with a concave section in the ventral half, angled (with a rounded transition) between the ventral and posteroventral sections; the costa that is concave by the ampulla with a convex section anteriad; and the ventral margin of the valva is with a strongly concave section in the middle near the base of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1478.5.1:T252C, aly517.15.6:G123A, aly235.10.3:T117A, aly2532.7.4:T60C, aly1651.45.3:T141C; and COI barcode: A58G, T115C, T212C, T226C, A388G, G506A.

Barcode sequence of the holotype.

Sample NVG-7694, GenBank PV972595, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTCTTAGATTGTTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCACTTATACTTTTAATTTCAAGAAGAATCGTAGAAAATGGTGCTGGAACTGGTTGAACAGTTTACCCCCCCCTGTCATCAAATATTGCTCATCAAGGTTCATCTGTTGATTTGGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTGATCAAATACCTTTATTTATTTGATCTGTAGGTATTACAGCTTTATTACTACTTTTATCTCTTCCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 518–519 (genitalia Fig. 1276–1278), bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [ TEXAS | Hidalgo County: | Bentsen-Rio Grande | Valley State Park ], [ coll. | 2-IX-72 | W. W. McGuire ], [ FIRST | UNITED STATES | RECORD ], [ Conga ♂ | chydaea (Butler) | Det. VI–74 | W. W. McGuire ], [ HESPERIIDAE, | Hesperiinae: | Conga chydaea | (Butler, 1877) | ♂ det. R. O. Kendall | M. & B. No. 141 ], [ DNA sample ID: | NVG-7694 | c/o Nick V. Grishin ], [ genitalia | NVG170108–25 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Alerema complex | Grishin ]. Paratypes: 1♂ and 1♀ from Mexico: 1♀ NVG-19069A08 Tamaulipas, 1–4 km N of Gomez Farias, 22-Dec-1972, C. J. Durden leg. [TMMC] and 1♂ NVG-21014G10 Chiapas, 3 mi S of Simojovel, 3000’, 5-Sep-1989, J. Kemner leg., genitalia H-939 by H. A. Freeman (not located) [CMNH].

Type locality.

USA: Texas, Hidalgo County, Bentsen-Rio Grande Valley State Park.

Etymology.

The name is an antonym of the species epithet of its sister species, A. simplex. As a mnemonic, the letter c is before s in the alphabet for this more northern species. The name is treated as a noun in apposition.

Distribution. South Texas through Mexico.

Niconiades sor Grishin, new species

https://zoobank.org/F4388626-79C9-4A12-AE76-8E15A31C27E7

(Fig. 14 part, 520–521, 1279–1280)

Definition and diagnosis.

Genomic analysis of a specimen from Oaxaca, Mexico, initially identified as Niconiades derisor (Mabille, 1891) (type locality in Venezuela, syntype sequenced as NVG-18042G06) reveals that it is genetically differentiated at the species level (Fig. 14); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore it represents a new species. This new species keys to “Niconiades viridis vista” (a junior subjective synonym of N. derisor) (O.11.12(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: larger semihyaline spots, e.g., the lower discal cell spot on the forewing comes closer to the diamond-shaped spot in the cell CuA₁-CuA₂, and larger spots on the ventral hindwing with the spot in the cell M₁-M₂ being elongated, others round; three hyaline subapical spots on the forewing; the harpe with a concave ventrodistal margin, a small and rounded posterior tooth, and a larger and sharp, inwardly bending dorsal tooth; and a relatively straight (not concave) ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2284.4.2:T87C, aly595.11.3:T752A, aly127.61.11:T127A, aly531.24.2:G78A, aly3113.4.6:C93T, aly1398.3.2:G168G (not C), aly8048.6.3:C174C (not T), aly221.10.5:T213T (not C), aly274.6.1:T294T (not C), aly4333.6.3:G93G (not A); and COI barcode: T59T, A217G, A433G, T508T, T616C.

Barcode sequence of the holotype.

Sample NVG-19022C09, GenBank PV972596, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTCTTAGTTTATTAATCCGTACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCACCTGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCTTTAATATTATTAATTTCTAGAAGAGTTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCCCCCCTTTCTTCCAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATCTCATCAATTTTAGGGGCAATCAATTTTATTACTACAATTATTAATATACGAATTATAAATTTAACGTTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCACTTTTATTACTTTTATCATTACCAGTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAACTTAAATACTTCATTTTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 520–521 (genitalia Fig. 1279–1280), bears the following six rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), five white: [ Mex:Oax: rd.to Talea | de Castro - 19 May 1990 | John Kemner-el. 7500’ ], [ Niconiades ♂ | vista | Evans | Det. H.A. Freeman ], [ genitalia NO. | X-30 63 | J.M.Burns 1991 ], [ DNA sample ID: | NVG-19022C09 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532757 ], and one red [ HOLOTYPE ♂ | Niconiades | sor Grishin ].

Type locality.

Mexico: Oaxaca, Villa Talea de Castro, elevation 7500’.

Etymology.

The name is the last syllable of the name of its sister species N. derisor being shorter to indicate its more northern distribution. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Oaxaca, Mexico.

Moeris nana Grishin, new species

https://zoobank.org/B0356AED-1FB5-4748-8FB4-21AC1C3AC3E5

(Fig. 14 part, 522–523, 1281–1283)

Definition and diagnosis.

Genomic analysis of a specimen from South Brazil initially identified as Moeris anna (Mabille, 1898) (type locality in Bolivia) reveals that it is genetically differentiated at the species level (Fig. 14); e.g., their COI barcodes differ by 7% (46 bp), and therefore it represents a new species. This new species keys (incompletely) to Vidius nappa Evans, 1955 (type locality in Brazil: Paraná) (J.24.4) in Evans (1955), a species currently in Nastra Evans, 1955, but differs from it and other relatives by the following combination of characters in females: uniformly tan-brown in color on both sides of the wings; slightly paler and more ocherous beneath with a faint ray from the base to the outer margin near the anal area of the hindwing, but without the black spots of M. anna; and darker at the veins, especially dorsally and towards the wing margins. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6435.3.2:T185G, aly6435.3.2:A196G, aly216.3.2:A219G, aly113.6.1:A1836G, aly113.6.1:A3081T, aly1139.27.1:T159T (not C), aly1139.27.1:T196T (not C), aly6398.5.12:C75C (not T), aly2847.4.11:C110C (not T), aly1259.40.1:G757G (not A); and COI barcode: T10C, T337G, T376C, A469T, A556G.

Barcode sequence of the holotype.

Sample NVG-22108D12, GenBank PV972597, 658 base pairs:

AACTTTATACTTTATTTTTGGAATCTGAAGAGGAATATTAGGGACTTCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTGCCATTAATACTAGGTTCCCCTGATATGGCCTTTCCACGAATAAATAATATAAGATTTTGAATACTACCTCCTTCTTTAATGTTATTAACTTCAAGAAGAATTGTAGAAAATGGTGCCGGAACAGGATGAACAGTGTACCCCCCCCTTTCATCCAATATTGCCCATCAAGGATCCTCCGTTGATTTAGCAATTTTCTCCCTTCATCTTGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATAATATTTGATCAAATACCTCTTTTTGTATGATCAGTAGGAATTACAGCACTTTTATTACTTTTATCACTACCTGTGTTAGCAGGTGCTATTACAATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCCGCAGGAGGAGGTGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 522–523 (genitalia Fig. 1281–1283), bears the following nine rectangular labels (4^th handwritten, others printed), eight white: [ BRASIL: Parana, | Chapada, 1350 m., | 26° 34’ −51° 37’ ,Mar.63 ], [ Fritz Plaumann ], [ Collection of | C. D. MacNeill ], [ perigenes? ], [ DNA sample ID: | NVG-22108D12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015E01 | c/o Nick V. Grishin ], [ genitalia | NVG241114–08 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8568679 ], and one red [ HOLOTYPE ♀ | Moeris nana | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Paraná, Chapada, elevation 1350 m, GPS −26.5667, −51.6167.

Etymology.

The name is an anagram of the name of its sister species, M. anna. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in South Brazil.

Gallio tholos Grishin, new species

https://zoobank.org/EC191BC5-2A56-4AE0-9AA3-272971511D97

(Fig. 14 part, 524–525)

Definition and diagnosis.

This new species is sister to Gallio madius (Bell, 1941) (type locality in Brazil: Santa Catarina) (Fig. 14) and keys to Vehilius madius (J.28.11) in Evans (1955), but differs from it and other relatives by more blurred wing pattern of yellow spots and streaks, more weakly developed dorsal forewing spots, and the forewing discal cell either missing pale spots or with a small upper spot, better expressed on the ventral side. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly272.4.1:G35A, aly272.4.1:C71G, aly72.17.1:G55T, aly72.17.1:G158A, aly1146.28.6:G951A; and COI barcode: A55T, T169T, 220C, A544T, A637C.

Barcode sequence of the holotype.

Sample NVG-19019B05, GenBank PV972598, 658 base pairs:

TACTTTATATTTTATTTTTGGAATTTGATCAGGTATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTTCCATTAATATTAGGGGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAACGGTGCAGGTACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGCCCATCAAGGATCTTCAGTTGATCTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTATAAATTTATCTTTTGATCAAATACCATTATTTGTATGATCAGTAGGTATTACTGCATTATTATTATTACTTTCATTACCTGTATTAGCAGGTGCTATTACAATACTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 524–525, bears the following four printed rectangular labels, three white: [ GUYANA: Acarai Mts./ridge | Sipu R. 2500–3000’ | 31.X.-10.XI.2000 | 1°22.2’N 58°57.9’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-19019B05 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00179763 ], and one red [ HOLOTYPE ♂ | Gallio complex | Grishin ]. Paratype: 1♂ NVG-19019B11, USNMENT_01532563 Peru: Madre de Dios, Parque Manu, Pakitza, 400 m, −12.1167, −70.9667, 22-Sep-1989, R. K. Robbins leg. [USNM].

Type locality.

Guyana: Acarai Mts., Sipu River, elevation 2500’–3000’, GPS 1.370, −58.950.

Etymology.

In Greek, θολός (tholos) means blurred, cloudy, or muddy. The name refers to the wing pattern of this species that appears more blurred than in its relatives and is an adjective.

Distribution.

Currently known from Guyana and the Amazonian region of southern Peru.

Gallio pallidus Grishin, new species

https://zoobank.org/7DE98222-1DFC-4F5C-BAF6-317225CB83FE

(Fig. 14 part, 526–527, 1284–1286)

Definition and diagnosis.

This new species is sister to the clade of Gallio madius (Bell, 1941) (type locality in Brazil: Santa Catarina) (Fig. 14) and the previously described new species and keys to Vehilius madius (J.28.11) in Evans (1955), but differs from it and other relatives by having an upper spot in the forewing discal cell (a lower spot is additionally developed in one paratype), an indistinct spot at the end of the discal cell on the hindwing underside, a yellowish (without any violet tinge) underside background, and a paler appearance: more extensive yellow-olive overscaling on the dorsal side of the wings and stronger yellow patterns on the ventral side (the hindwing is nearly all yellow in one paratype). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6370.12.2:G138A, aly6370.12.2:C445T, aly1019.14.2:T219A, aly1019.14.2:C270T, aly2012.51.1:T651C; and COI barcode: A55A, T169T, 220A, A544T, A637C.

Barcode sequence of the holotype.

Sample NVG-19019B10, GenBank PV972599, 658 base pairs:

TACTTTATATTTTATTTTTGGAATTTGATCAGGTATATTAGGAACTTCTTTAAGATTATTAATTCGAACAGAGTTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTTCCATTAATATTAGGGGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGCCCATCAAGGATCTTCAGTTGATCTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTATAAATTTATCTTTTGATCAAATACCATTATTTGTATGATCAGTAGGTATTACTGCATTATTATTATTACTTTCATTACCTGTATTAGCAGGTGCTATTACAATACTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 526–527, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PERU Madre De Dios | Rio La Torre 300m | Tambopata Res. | 4 Oct.’86 | S. S. Nicolay ], [ DNA sample ID: | NVG-19019B10 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532562 ], and one red [ HOLOTYPE ♂ | Gallio pallidus | Grishin ]. Paratypes: 5♂♂ and 1♀ from Peru, Madre de Dios [USNM]: 1♂ NVG-23124B08 the same data as the holotype but 6-Oct-1986; 30 km SW of Puerto Maldonado, 300 m, S. S. Nicolay leg.: 1♂ NVG-23124B11 22-Oct-1983, 1♂ NVG-23124B10 27-Oct-1983, genitalia H793, 1♂ NVG-23124B09 1-May-1984, and 1♂ NVG-23124B07 10-May-1984, genitalia H968 (Fig. 1284–1286); and 1♀ NVG-23124B12 Parque Manu, Pakitza, 400 m, −12.1167, −70.9667, 19-Sep-1989, in cop, R. K. Robbins leg.

Type locality.

Peru: Madre de Dios Region, Tambopata National Reserve, Río La Torre, elevation 300 m.

Etymology.

This is the palest species of Gallio thus far and the name, which is an adjective, reflects that.

Distribution.

Currently known only from the Amazonian region of southern Peru.

Comment.

This new species is sympatric with the previous one in the Manu National Park, at Pakitza.

Mnasicles (Remella) wemex Grishin, new species

https://zoobank.org/BB367697-3025-4C71-AF4F-E9916488BF2B

(Fig. 15 part, 528–529, 1287–1289)

Figure 15.

Phylogenetic trees of selected Moncina (part 2) inferred from protein-coding regions in a) the Z chromosome, based on 297,639 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of a specimen from western Mexico initially identified as Mnasicles (Remella) remus (Fabricius, 1798) (type locality in French Guiana) reveals that it is genetically differentiated at the species level (Fig. 15); e.g., their COI barcodes differ by 5% (33 bp), and therefore it represents a new species. This new species keys to “Moeris remus” (J.33.1) in Evans (1955) and was likely included by him in this taxon, but differs from it and other relatives by the following combination of characters in males: the pale area on the ventral hindwing is more strongly overscaled with brown; the brown anal ray from the base to the outer margin is prominent, but narrower and the pale rays flanking it are weakly expressed and overscaled with brown; the ventral forewing with a diffuse dark band by the apex flanked with pale-brown (reddish tint, not purplish and not whitish) bands and the tornal area is not much paler than the ground color; the stigma is strongly expressed, tri-partite, with the middle section longitudinally elongated; the harpe is dorsally rounder, less protruding distad, with a broader dorsal tooth by the ampulla, which is smaller and narrower; the costa is nearly flat, not concave in the middle; and the uncus is more strongly humped in lateral view, with shorter arms. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly240.12.13:A90C, aly173.70.1:T475C, aly1500.7.8:T138C, aly536.96.1:A564G, aly13198.5.5:G30A, aly128.13.1:G300G (not A), aly4389.1.13:T84T (not A), aly4389.1.13:T609T (not C), aly1052.5.21:T96T (not C), aly1486.3.9:G75G (not A); and COI barcode: A1A, T115C, T121C, T400A, T490C.

Barcode sequence of the holotype.

Sample NVG-22056E10, GenBank PV972600, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTACCCCCCTCATTAATACTTTTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTCTATCCTCCTTTATCTTCTAATATTGCTCATCAAGGTTCATCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAGTAAGAAACTTATCATTTGACCAAATACCCTTATTTGTATGATCAGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGACCCAGCTGGAGGGGGGGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 528–529 (genitalia Fig. 1287–1289), bears the following six rectangular labels (3^rd handwritten, others printed, 2^nd and the last red, others white): [ Mexico: Oaxaca | 2 mi N Candelaria | 22,23,25.x.1988 | J. Kemner leg. #059 ], [ Texas Memorial | Museum –UTexas | JKemner Spec. | 419 ], [ 059 ], [ DNA sample ID: | NVG-22056E10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–30 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Mnasicles (Remella) | wemex Grishin ]. The numbers 419 and 059 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2^nd and 3^rd labels were original labels on the holotype.

Type locality.

Mexico: Oaxaca, 2 mi N of Candelaria Loxicha.

Etymology.

The name is given to indicate west Mexican distribution of this species: We[st]+ Mex[ico]. The name is treated as a noun in apposition.

Distribution.

Western Mexico.

Neotype designation for Cobalus centralis Herrich-Schäffer, 1869

Cobalus centralis Herrich-Schäffer, 1869 was described from an unspecified number of specimens of unstated provenance (Herrich-Schäffer 1869). The original description was given as an identification key, and we assemble and translate most relevant sections of the description as follows: “Upperside of all wings unmarked. Underside of the hindwings with sharply demarcated dark basal third. Underside of the forewings unmarked; underside of the hindwings with sharp black middle point,” that Herrich-Schäffer (1869) contrasted this with “Underside of the forewings with two diverging white costal spots; underside of the hindwings without middle spot” referring to Mnasicles (Remella) vopiscus (Herrich-Schäffer, 1869) (type locality in Venezuela), the only other species of the subgenus Remella Hemming, 1939 (type species Hesperia remus Fabricius, 1798) included in the key. About a decade after the original description, Plötz (1882a) listed the locality for C. centralis as “Central-Amerkia”, which may explain the name given to this species, and synonymized it with Mnasicles (Remella) remus (Fabricius, 1798) (type locality in French Guiana), a treatment maintained to date. To better understand the taxonomic identity of C. centralis, we searched for its syntypes in all collections listed in the Acknowledgments section. A particular focus was on the MFNB, BMNH, and ANSP collections, where specimens from the Herrich-Schäffer collection are preserved. No syntypes were found and we assumed that they were lost. There is an exceptional need for a neotype of C. centralis to define this taxon objectively, clarify its type locality, and ensure taxonomic stability in the application of this name, because the information available about this taxon is also consistent with a cryptic new species present among its relatives. Hereby, N.V.G. designates a male from Chiriquí, Panama, in MFNB, shown in Fig. 530–531 (DNA sample NVG-22111F05) as the neotype of Cobalus centralis Herrich-Schäffer, 1869.

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity and the type locality (not given in the original description) of C. centralis, which is necessary due to the presence of cryptic species; 75.3.2. The characters to differentiate this taxon from others are stated in the original description and given above, most importantly, the dorsal side of the wings is unmarked brown, the ventral side of the forewings is largely unmarked brown, and the ventral side of the hindwings with a sharply defined brown basal third, followed by the beige-cream colored area fusing with the brown marginal third, and a sharp central brown dot; 75.3.3. The neotype specimen is a male bearing the following four white labels (2^nd handwritten, others printed with handwritten text shown in italics; 2^nd round, others rectangular): [ Chiriqui | 96. Tr. ], ( Remus, Fab | =vopiscus HS | =justinoides | Butl. ), [ Coll. | Staudinger ], and [ DNA sample ID: | NVG-22111F05 | c/o Nick V. Grishin ], and shown in Fig. 530–531. According to its labels, the neotype was collected in 1896 by Trötsch; 75.3.4. We failed to find syntypes of C. centralis among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list), in particular, searching the Herrich-Schäffer collection specimens in MFNB, BMNH, and ANSP, and no syntypes have been reported in the literature; therefore, we believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. centralis in all characters, as evidenced by comparing the neotype shown in Fig. 530–531 with the characters of this taxon listed above; 75.3.6. The neotype is from Panama: Chiriquí, which becomes the new type locality, and the original type locality was not stated, later suggested to be “Central-Amerika” by Plötz (1882a), which is consistent both with the name centralis and the new type locality being in Central America; 75.3.7. The neotype is in the collection of the Museum für Naturkunde, Berlin, Germany (MFNB). The COI barcode sequence of the neotype, sample NVG-22111F05, GenBank PV972601, 658 base pairs, is:

TACTTTATATTTTATTTTTGGGATCTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGAATACTTCCTCCTTCATTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACAGGTTGAACCGTTTATCCTCCTTTATCTTCTAATATTGCTCATCAAGGATCATCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTAAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCCGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCGGCTGGAGGAGGAGACCCTATCTTATATCAACATTTATTT

Mnasicles (Remella) centralis (Herrich-Schäffer, 1869) is a valid species distinct from Mnasicles (Remella) remus (Fabricius, 1798)

Genomic analysis of the neotype of Cobalus centralis Herrich-Schäffer, 1869 (type locality in Panama: Chiriquí, sequenced as NVG-22111F05) places it away from South American specimens of Mnasicles (Remella) remus (Fabricius, 1798) (type locality in French Guiana) that form a separate clade (Fig. 15). The neotype of C. centralis is genetically differentiated from M. remus at the species level, e.g., their COI barcodes differ by 2.1% (14 bp). Therefore, we propose that Mnasicles (Remella) centralis (Herrich-Schäffer, 1869), reinstated status, is a valid species distinct from Mnasicles (Remella) remus (Fabricius, 1798).

Mnasicles (Remella) vembia Grishin, new species

https://zoobank.org/1FCD62E6-732B-44E9-88B5-3844C560AA25

(Fig. 15 part, 532–533, 1290–1292)

Definition and diagnosis.

Genomic analysis of specimens from Colombia and Venezuela initially identified as Mnasicles (Remella) remus (Fabricius, 1798) (type locality in French Guiana) reveals that they are not monophyletic with it and form a clade sister to Mnasicles (Remella) centralis (Herrich-Schäffer, 1869), reinstated status, (type locality in Panama: Chiriquí), and are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore they represent a new species. This new species keys to “Moeris remus” (J.33.1) in Evans (1955) and was included by him in this taxon, but differs from it and other relatives by the following combination of characters in males: the ventral hindwing with a broader and whiter area, larger than in M. centralis, not strongly overscaled with brown. with a prominent brown anal ray from the base to the outer margin, flanked with white that extends into the brown distal half of the wing beyond the rest of the white area. the central brown dot is smaller; the ventral forewing with a better defined darker brown band near the apex flanked with paler bands, whitish and may be with a purplish tint; the harpe is more robust, protrudes farther distad where it is more symmetrically rounded, with a larger and narrower dorsal tooth that protrudes slightly dorsad of the ampulla, which is larger, and the costa is weakly concave; the uncus is less humped in the lateral view, with longer (but still short) arms. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1916.9.2:A144T, aly536.192.5:A63C, aly320.2.20:G90A, aly1097.18.13:A45G, aly1097.18.13:C46T, aly2417.12.7:C192C (not T), aly1139.46.9:T135T (not A); and COI barcode: C5C, T212C, T334T, T367C, A376G.

Barcode sequence of the holotype.

Sample NVG-19016H04, GenBank PV972602, 658 base pairs:

TACTCTATATTTTATTTTTGGGATCTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGAATACTTCCTCCTTCATTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAATATTGCTCACCAAGGATCGTCTGTTGATTTAGCAATTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTAAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCCGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCAGCTGGAGGAGGAGACCCTATCTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 532–533 (genitalia Fig. 1290–1292), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ VENEZUELA: Barinas; | Rio Caparo Res.Station | 32kmE El Canton,b–light | 3–5 II 1978,seasonal | forest,J.B.Heppner ], [ A.S.Menke | L.Hollenberg | Collectors ], [ DNA sample ID: | NVG-19016H04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035E04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–33 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532359 ], and one red [ HOLOTYPE ♂ | Mnasicles (Remella) | vembia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-22111F06 Colombia, Rio San Juan, old [ca. 1900], Troetsch leg. [MFNB].

Type locality.

Venezuela: Barinas, 32 km east of El Canton, Río Caparo Research Station.

Etymology.

The name is a fusion of the names of the countries inhabited by this species: Ve[nezuela + Colo]mbia. The name is a noun in apposition.

Distribution.

Colombia and Venezuela.

Mnasicles (Remella) aca Grishin, new species

https://zoobank.org/EA56838C-839A-48F6-91CB-58DB642511E7

(Fig. 15 part, 534–535, 1293–1295)

Definition and diagnosis.

Genomic analysis of a specimen from Oaxaca, Mexico, initially identified as Mnasicles (Remella) rita (Evans, 1955) (type locality in Guatemala) reveals that it is genetically differentiated at the species level (Fig. 15); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore it represents a new species. This new species keys (incompletely) to “Moeris rita” (J.33.2) in Evans (1955), but differs from it and other relatives by the following combination of characters in males: the ventral hindwing with a narrow cream-colored band, its basal margin is irregular, the discocellular vein is white-scaled, flanked by two brown spots surrounded by white scales; the forewing underside with a prominent apical band of the same color as the cream ventral hindwing band and a paler triangle past the middle of the costal margin; the harpe is more rounded dorsally, narrower, and leaves a broader gap from the ampulla; the costa with a concave margin and a broader hump near its base; the uncus is flat in lateral view (slightly humped around the arms in M. rita), with extended arms. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1238.2.7:T135A, aly1238.2.7:T144C, aly166.1.2:G789A, aly166.1.2:G849A, aly1577.11.1:A78C, aly887.20.6:C30C (not T), aly887.20.6:T45T (not A), aly536.8.1:C576C (not A), aly903.2.19:T582T (not G), aly903.2.19:T432T (not C); and COI barcode: T190C, T220C, T271C, T529T, A586G.

Barcode sequence of the holotype.

Sample NVG-19016H08, GenBank PV972603, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGCAATTGATTAGTTCCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCCCCCTCATTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGCTCACCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTAAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACGGATCGAAATTTAAATACTTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 534–535 (genitalia Fig. 1293–1295), bears the following seven rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), six white: [ Mex:Oax: LaSoledad- | Buena Vista - 5 may 1990 | John Kemner-el.5000’ ], [ Remella ♂ | rita | (Evans) | Det. H.A. Freeman ], [ DNA sample ID: | NVG-19016H08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035E05 | c/o Nick V. Grishin ], [ genitalia | NVG241121–31 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532362 ], and one red [ HOLOTYPE ♂ | Mnasicles (Remella) | aca Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Mexico: Oaxaca, Sierra Madre del Sur, La Soledad – Buena Vista, elevation ca. 5000’.

Etymology.

The name is derived from the Mexican state of the type locality: [Oax]aca. The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected in Oaxaca, Mexico.

Comment.

Male genitalia of M. rita NVG-22056H05 from Guatemala: Atitlán, 5 mi E of Panajachel, 9-Feb-1988, J. Kemner leg., genitalia NVG241121–87 [TMMC], are illustrated for comparison in Fig. 1296–1297.

Mnasicles (Remella) ritama Grishin, new species

https://zoobank.org/2A405000-551D-4B34-8916-E54412375B40

(Fig. 15 part, 536–537, 1298–1300)

Definition and diagnosis.

Genomic analysis of specimens from Costa Rica and Panama initially identified as Mnasicles (Remella) rita (Evans, 1955) (type locality in Guatemala) reveals that they are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 2% (13 bp), and therefore represent a new species. This new species keys to “Moeris rita” (J.33.2) in Evans (1955), but differs from it and other relatives by the following combination of characters in males: the ventral hindwing with a narrow cream-colored band, its basal margin is smooth, the discocellular vein is white-scaled, with more diffuse and weakly defined spots on both sides of it; the forewing with a narrower apical band of the same color as the cream ventral hindwing band and a narrower pale triangle past the middle of the costal margin; the harpe is expanded dorsally, with a more prominent dorsal tooth, broader, and leaves a narrower gap from the ampulla; the costa with a concave margin and a narrower hump near its base; the uncus is flat in lateral view (slightly humped around the arms in M. rita), with extended, longer arms. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1265.17.1:G507A, aly536.78.1:G874A, aly276558.19.1:C452T, aly275209.2.7:C31T, aly275209.2.7:C66T; and COI barcode: T115C, A277G, T427C, A508G, T529C.

Barcode sequence of the holotype.

Sample NVG-19016H09, GenBank PV972604, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTACAATACTATCGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGTAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCTCCTTCGTTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGCCCACCAAGGTTCTTCTGTTGACTTAGCAATTTTTCCTTACATTTAGCAGGAATTTCATCTATCCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTAAGAAATTTATCATTTGATCAAATACCTTTATTTGTGTGATCTGTAGGTATTACTGCCTTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTCGACCCAGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 536–537 (genitalia Fig. 1298–1300), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Panama:Chiriqui | Santa Clara 1500m | 10.VII.1982 | G.B. Small ], [ DNA sample ID: | NVG-19016H09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035E06 | c/o Nick V. Grishin ], [ genitalia | NVG241121–32 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532363 ], and one red [ HOLOTYPE ♂ | Mnasicles (Remella) | ritama Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ in MGCL: 1♂ NVG-21046F10 Costa Rica, Alajuela Prov., Socorro de la Virgen, 13-Feb-1988, D. L. Lindsley leg. and 1♂ NVG-24078C04 Panama, Chiriqui, “Calif.” 5000’, 15-Dec-1972, H. L. King leg.

Type locality.

Panama: Chiriquí Province, Santa Clara, elevation 1500 m, approx. GPS 8.8167, −82.8333.

Etymology.

The name is a modified fusion of the names of its sister species and the country of the type locality: rita + [Pana]ma. The name is made longer to indicate more southern distribution and is a noun in apposition.

Distribution.

Costa Rica and Panama.

Comment.

Male genitalia of M. rita NVG-22056H05 from Guatemala: Atitlán, 5 mi E of Panajachel, 9-Feb-1988, J. Kemner leg., genitalia NVG241121–87 [TMMC], are illustrated for comparison in Fig. 1296–1297.

Lectotype designation for Mnasicles geta Godman, 1901

Mnasicles geta Godman, 1901 was described from an unstated number of specimens from eastern Mexico, Guatemala, Honduras, and Costa Rica (Godman 1901a). To stabilize nomenclature, clarify the type locality, and define the name M. geta objectively, N.V.G. hereby designates among the syntypes in the BMNH collection, the male that, according to one of its labels, was illustrated by Godman (1901a), and bears the following nine printed labels (first two round, others rectangular; first two with a red circle on one side, others white): ( Type ) and on the other side ( H | 2172 ), ( Type | H.T. ), [ Teapa, | Tabasco. | March. H.H.S. ], [ ♂ ], [ B.C.A.Lep.Rhop. | Mnasicles | geta, | Godm. ], [ Sp. figured. ], [ Godman-Salvin | Coll. 1913.—2. ], [ {QR Code} | NHMUK 012824234 ], and [ MOLECULAR | 0247281266 ] as the lectotype of Mnasicles geta Godman, 1901. The lectotype is a specimen in good condition, with the abdomen glued on, tilted to the right, and signs of glue around the bases of left wings and thorax. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of M. geta becomes Mexico: Tabasco, Teapa, approx. GPS 17.55, −92.95 (Selander and Vaurie 1962). The COI barcode sequence of the lectotype, sample NVG-18083F07, GenBank ON480169, 658 base pairs is:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCTCTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTCCCCCCCTCATTATTACTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCCCCCCTCTCCTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCGTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTAGGAAACTTATCATTTGATCAAATACCTCTATTTGTATGATCTGTAGGTATTACTGCCTTACTACTTCTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTT AACAGATCGAAATTTAAACACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Mnasicles (Mnasicles) nama Grishin, new species

https://zoobank.org/D88F6BB3-F774-41AE-B10C-55682B1DAAB1

(Fig. 15 part, 538–539, 1301–1302)

Definition and diagnosis.

Genomic analysis of specimens from Panama initially identified as Mnasicles (Mnasicles) geta Godman, 1901 (type locality in Mexico (Veracruz and Tabasco), Guatemala, Honduras, Costa Rica) reveals that they are genetically differentiated from it at the species level in the nuclear genome (Fig. 15a); however their COI barcodes do not differ strongly (0.6%, 4 bp), and therefore they represent a new species. This new species keys to M. geta (J.6.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: typically more weakly expressed pale area near the middle of the ventral hindwing costa; less clearly checkered fringes; weaker towards the costal margin discal paler band on the ventral hindwing; the harpe is more extended dorsad, protruding from the ampulla, which is also more expanded dorsad along the harpe and closely aligned with it and narrower; and the costa of the valva is less humped at the base. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1313.17.4:C105G, aly974.7.18:C33T, aly974.7.18:C39T, aly14709.2.1:T54A, aly755.6.2:T21C; and COI barcode: T274T, A421A, T500C, T601T, A619C.

Barcode sequence of the holotype.

Sample NVG-19017D06, GenBank PV972605, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCTCTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTATTACTTTTAATTTCAAGAAGTATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCCCCCCTCTCCTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTAGGAAACTTATCATTTGATCAAATACCTCTATTTGTATGATCTGTAGGTATTACTGCCTTACTACTTCTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCCGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 538–539 (genitalia Fig. 1301–1302), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA:CHIRIQUI | Santa Clara 1200m | 8°49’N 82°50’W | 7.IX.1981 | leg. G.B.Small ], [ DNA sample ID: | NVG-19017D06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035E07 | c/o Nick V. Grishin ], [ genitalia | NVG241121–35 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532403 ], and one red [ HOLOTYPE ♂ | Mnasicles (Mnasicles) | nama Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-19069D03, USNMENT_01559674 Panama, Chiriqui, El Volcan, 16-Apr-1973, S. S. Nicolay leg., genitalia vial H572 (by S. S. Nicolay).

Type locality.

Panama: Chiriquí Province, Santa Clara, elevation 1200 m, GPS 8.8167, −82.8333.

Etymology.

The name is derived from the country of the type locality, [Pa]nama, and is a noun in apposition.

Distribution.

Currently known only from western Panama.

Mnasicles (Mnasicles) doraon Grishin, new species

https://zoobank.org/4E048AA0-77B3-4890-A3CA-ABC253BD9B62

(Fig. 15 part, 540–541, 1303–1305)

Definition and diagnosis.

Genomic analysis of specimens from southern Ecuador initially identified as Mnasicles (Mnasicles) hicetaon Godman, 1901 (type locality in Mexico: Durango and Veracruz) reveals that they are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 1.5% (10 bp), and therefore represent a new species. This new species keys to M. hicetaon (J.6.2) in Evans (1955), but differs from it and other relatives by the following combination of characters: yellower, rather than purple, overtones of the ventral side of wings, with darker pale overscaling, the basal half of ventral forewing, although darker than the costal and the apical areas, not as prominent as in M. hicetaon, and the fringes are yellower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly499.78.3:C597T, aly6018.3.1:G114A, aly6018.3.1:T117C, aly709.15.3:T129G, aly709.15.3:C144T; and COI barcode: T25C, A160G, T367C, A433G, T463C.

Barcode sequence of the holotype.

Sample NVG-19017G02, GenBank PV972606, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGAGCTGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTACCCCCTTCATTAATACTTTTAATCTCAAGAAGTATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTACCCTCCTCTTTCTTCTAATATTGCTCACCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCAGGTATTTCATCTATTTTAGGGGCTATTAATTTTATTACTACAATTATTAACATACGAGTAAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTACTTCTTTTATCATTACCTGTACTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 540–541, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ Naranjal GUAYAS | ECUADOR 70m | 18 Sept.’76 | S. S. Nicolay ], [ DNA sample ID: | NVG-19017G02 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532429 ], and one red [ HOLOTYPE ♀ | Mnasicles (Mnasicles) | doraon Grishin ]. Paratype: 1♀ NVG-19017G01 (leg, DNA sequenced), NVG-22035G07 (abdomen, DNA stored), USNMENT 01532428, the same data as the holotype, genitalia NVG241121–36 (Fig. 1303–1305).

Type locality.

Ecuador: Guayas Province, Naranjal, elevation 70 m.

Etymology.

The name is a modified fusion of the names of the country of the type locality and its sister species, [Ecua]dor +[ hicet]aon. The name is treated as a noun in apposition.

Distribution.

Currently known only from the coastal area in southern Ecuador.

Mnasicles (Mnasicles) stollmeyeri (E. Bell, 1932) is a valid species distinct from Mnasicles (Mnasicles) hicetaon Godman, 1901

Genomic analysis of the holotype of Perimeles stollmeyeri Bell, 1932 (type locality in Trinidad, sequenced as NVG- 18026H04) places it away from the specimens of Mnasicles (Mnasicles) hicetaon Godman, 1901 (type locality in Mexico: Durango and Veracruz) that form a separate clade not even sister to M. hicetaon in the nuclear genome (Fig. 15). The holotype of P. stollmeyeri is genetically differentiated from M. hicetaon at the species level in the nuclear genome, however their COI barcode difference is modest (1.1%, 7 bp). Therefore, we propose that Mnasicles (Mnasicles) stollmeyeri (E. Bell, 1932), reinstated status, is a valid species distinct from Mnasicles (Mnasicles) hicetaon Godman, 1901.

Amblyscirtes (Amblyscirtes) prenda Evans, 1955 is a species distinct from Amblyscirtes (Amblyscirtes) tolteca Scudder, 1872

Genomic analysis of Amblyscirtes (Amblyscirtes) tolteca Scudder, 1872 (type locality Mexico: Oaxaca, Tehuantepec) reveals that Amblyscirtes (Amblyscirtes) tolteca prenda Evans, 1955 (type locality USA: Arizona, Pima Co., Tucson) is genetically differentiated from the nominate subspecies at the species level (Fig. 15); e.g., their COI barcodes differ by 3% (20 bp). Therefore, we propose that Amblyscirtes (Amblyscirtes) prenda Evans, 1955, new status, is a species-level taxon, distinct from Amblyscirtes (Amblyscirtes) tolteca Scudder, 1872, which becomes monotypic.

Amblyscirtes (Amblyscirtes) azteca Grishin, new species

https://zoobank.org/712D98AC-9B94-469F-8DB8-F0309F774A77

(Fig. 15 part, 542–545, 1306–1307)

Definition and diagnosis.

Genomic analysis of specimens from western and southern Mexico initially identified as Amblyscirtes (Amblyscirtes) tolteca Scudder, 1872 (type locality Mexico: Oaxaca, Tehuantepec) reveals that they are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 3.3% (22 bp), and therefore they represent a new species, likely sympatric with A. tolteca at least in Nayarit and Guerrero, Mexico. This new species keys to A. tolteca tolteca (N.2.11(b)) in Evans (1955), but differs from it and other relatives by the following combination of characters: larger cream spots on both sides of the wings, e.g., the forewing discal cell spot is usually single and not divided into upper and lower spots; the harpe is more robust, its distal margin is more strongly curved near the dorsal tooth, which is broader and overlaps the slightly more expanded ampulla; and the ventral margin of the valva is more concave in the middle near the base of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1254.3.1:C760A, aly1254.3.1:T792A, aly1497.3.7:C429T, aly1497.3.7:C1785T, aly1497.3.7:G1875A; and COI barcode: T187C, C205A, T212C, T499C, A628G.

Barcode sequence of the holotype.

Sample NVG-19042H02, GenBank PV972607, 658 base pairs:

AACTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGAAATTGATTAGTTCCATTAATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCATTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACCGGTTGAACAGTTTACCCACCTCTTTCCTCTAATATTGCTCATCAAGGTTCATCTGTTGATTTAGCAATCTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAACTTATCATTTGATCAAATACCCTTATTTGTTTGATCTGTAGGTATTACCGCCTTATTATTACTCTTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTCCTTACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 542–543, bears the following four rectangular labels (1^st handwritten, others printed), three white: [ Tepic. Nayarit | Mex. IX-64 | T. Escalante ], [ DNA sample ID: | NVG-19042H02 | c/o Nick V. Grishin ], [ {QR Code} | AMNH_IZC 00337903 ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Amblyscirtes) | azteca Grishin ]. Paratypes: 3♂♂ and 2♀♀ from Mexico: 1♂ NVG-19042H03, AMNH_IZC 00337904 Colima, Jun-1924 [AMNH]; Guerrero: 1♂ NVG-18063E12, USNMENT 01466194 Sierra de Guerrero, Jun-1915, R. Muller leg., genitalia X-2533 J.M.Burns 1988 (Fig. 1306–1307) [USNM] and 1♂ NVG-18094H06 no other data, old [ca. 1900] [MTD]; and Morelos, Cuernavaca: 1♀ NVG-18063F01, USNMENT 01466185 Jun-1906, collection Wm. Schaus, genitalia X-2536 J.M.Burns 1988 [USNM] and 1♀ NVG-19042G10, AMNH_IZC 00337899 old [ca. 1900] [AMNH] (Fig. 544–545).

Type locality.

Mexico: Nayarit, Tepic.

Etymology.

The name refers to the Aztecs, a Mesoamerican civilization in central Mexico during the late postclassic period (roughly 1300–1521 CE), similar to Toltecs (a sister species A. tolteca) who flourished there between the 9^th and 12^th centuries CE. The name is treated as a noun in apposition.

Distribution.

Western and southern Mexico.

Amblyscirtes (Amblyscirtes) cupreus Grishin, new species

https://zoobank.org/75CBF1AC-7746-41BF-8643-6F0C9865839F

(Fig. 15 part, 546–547, 1308–1309)

Definition and diagnosis.

Genomic analysis of specimens from south-central Mexico initially identified as Amblyscirtes (Amblyscirtes) aeratus Grishin, 2023 (type locality in Mexico: Oaxaca) reveals that they are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 4.0% (26 bp), and therefore they represent a new species. This new species keys to Amblyscirtes fluonia Godman, 1900 (type locality in Mexico: Guerrero) (N.2.7) in Evans (1955), but differs from it and other relatives by the following combination of characters: the wings are darker on both sides, above with more restricted cupreous overscaling and with smaller and vestigial paler spots, beneath with less extensive pale overscaling and weaker developed, more diffuse, and smaller paler spots on both wings; the distal margin of the harpe is rounder, the dorsal tooth is straighter, the costa-ampulla is nearly straight; and the ventral margin of the valva is only slightly concave in the middle. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1019.14.40:T91C, aly1019.14.40:G93A, aly127.71.1:T171C, aly322.55.7:C120T, aly322.55.7:T219G; and COI barcode: T38C, T59C, T259C, A412T, T533C.

Barcode sequence of the holotype.

Sample NVG-19042E11, GenBank PV972608, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTACTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTCCCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTCTGAATACTTCCTCCTTCATTATTACTTTTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCTCACCAAGGCTCATCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATCTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCTTTACTATTACTTTTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTCTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 546–547 (genitalia Fig. 1308–1309), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Jacala Mexico | Hidalgo Klm 250 | 8–5 1956 El 6000 | Stallings & Turner ], [ DNA sample ID: | NVG-19042E11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015E11 | c/o Nick V. Grishin ], [ genitalia | NVG241114–16 | c/o Nick V. Grishin ], [ {QR Code} | AMNH_IZC 00337876 ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Amblyscirtes) | cupreus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-19042E10, AMNH_IZC 00337875 Mexico, Nuevo Leon, Victoria, 15-Aug-1962, H. A. Freeman leg. [AMNH].

Type locality.

Mexico: Hidalgo, km 250 of Hwy 85, mountains south of Jacala, elevation 6000’.

Etymology.

In Latin, cupreus means made of copper and aeratus, which means covered or decorated with brass or bronze. The name reflects the similarity of this species to its sister species A. aeratus and is an adjective.

Distribution.

South-central Mexico.

Comment.

The type locality of this species is also the type locality of Agathymus remingtoni (D. Stallings and J. Turner, 1958).

Amblyscirtes (Mastor) fimbriora Grishin, new species

https://zoobank.org/2F1FE47D-4E1B-47CB-9406-DF4B7E37BA62

(Fig. 15 part, 548–549, 1310–1311)

Definition and diagnosis.

Genomic analysis of specimens from northeastern Mexico initially identified as Amblyscirtes (Mastor) fimbriata fimbriata (Plötz, 1882) (type locality in Mexico, syntype sequenced as NVG-18042G12) reveals that they are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 3.5% (23 bp), and therefore they represent a new species. This new species keys to A. fimbriata (N.2.23) in Evans (1955), but differs from it and other relatives by the following combination of characters: brightly orange fringes (except at the hindwing apex and tornus), head, and collar; usually narrower stigma in males and more strongly defined dark veins beneath; ventral and distal margins of the harpe are more irregular, not as smoothly curved, with a distal bend and a concavity ventrad of the tooth, which is slightly broader and terminally turning dorsad (rather than anterodorsad); and the ventral margin of the valva is strongly concave in the middle before the base of the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly28779.8.7:G868A, aly28779.8.7:T819C, aly1204.3.1:A600C, aly1204.3.1:G606T, aly3087.2.1:A204G; and COI barcode: T10C, A76G, A79G, A265G, T541G.

Barcode sequence of the holotype.

Sample NVG-19013B05, GenBank PV972609, 658 base pairs:

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTGGGGAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATGCTCCCTCCTTCCCTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTCGCAGGAATTTCTTCCATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCCCTATTTGTTTGATCTGTAGGTATTACTGCCTTATTATTACTGTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTCTTACTGATCGAAACTTGAATACCTCATTTTTTGATCCAGCTGGAGGAGGTGATCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 548–549, bears the following five printed (text in italics handwritten) rectangular labels, four white: [ MEXICO: Nuevo Leon | ca. 5 mi. (8 km) | SSW Cola de Cabillo | (horsetail falls) ], [ coll 18-III-77 | Roy O. Kendall | & C. A. Kendall ], [ HESPERIIDAE, | Hesperiinae: | Amblyscirtes fimbriata | (Plotz, 1882) | ♂ det. R. O. Kendall | M. & B. No. 250 ], [ DNA sample ID: | NVG-19013B05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Mastor) | fimbriora Grishin ]. Paratypes: 8♂♂ and 1♀ from Mexico: 1♂ NVG-23068E11 Coahuila, Arteaga, San Rafael, 6-Jul-1988, J. Kemner leg. [TMMC]; Tamaulipas: 1♂ NVG23068F02 4.5 km NW Gomez Farias, 3200’, 4-Aug-1969, genitalia NVG241121–37 (Fig. 1310–1311) [TMMC] and 1♀ NVG-22056F04 11 km NW of Gomez Farias, 6 km W of Rancho Cielo, 5200–5500’, 9-Jul-1965 [TMMC]; and Nuevo Leon: the same data as the holotype except as listed: 2♂♂ NVG-19013B04 and NVG-19013B06 18-Mar-1977 and 1♂ NVG-23069A10 22-Oct-1979 and Monterrey, Chipinque Mesa: 1♂ NVG-23068F01 21-Aug-1977, C. J. Durden leg. [TMMC] and 13-Aug-1967, James A. Scott leg. [AMNH]: 1♂ NVG-19043A06, AMNH_IZC 00337919 and 1♂ NVG-19043A07, AMNH_IZC 00337920.

Type locality.

Mexico: Nuevo León, ca. 8 km south-southwest of Cola de Caballo.

Etymology.

The name is formed from the name of its sister species, A. fimbriata, to indicate its more eastern distribution (In Latin, oriens means east): fimbri[ata] + or[iens] + a. The name is treated as a noun in apposition.

Distribution.

Northeastern Mexico (Coahuila, Nuevo León, Tamaulipas).

Amblyscirtes (Mastor) aspilus Grishin, new species

https://zoobank.org/EF61EADA-2760-4CE0-8BFF-79047FB73071

(Fig. 15 part, 550–551, 1312–1314)

Definition and diagnosis.

Genomic analysis of a specimen from Guerrero, Mexico, initially identified as Amblyscirtes (Mastor) novimmaculatus Warren, 1998 (type locality in Mexico: Jalisco) reveals that it is genetically differentiated at the species level (Fig. 15); e.g., their COI barcodes differ by 7.4% (49 bp), and therefore it represents a new species. This new species keys to Repens repta Evans, 1955 (type locality in Mexico: Jalisco) (J.21.2) in Evans (1955), a species misplaced by him (likely due to the poor condition of specimens) and currently in the genus Amblyscirtes Scudder, 1872 (type species Hesperia vialis W. Edwards, 1862), but differs from it and other relatives by the following combination of characters: somewhat less rounded wings, slightly larger brands, especially the section below the vein CuA₂; even further reduced or lacking paler spots on the ventral side (e.g., near the bases of the cell M₃-CuA₁ on both wings and of the forewing cell R₅-M₁); the harpe with a more uniformly curved and straighter distal margin and a dorsal tooth slightly protruding dorsad of the ampulla, which is straighter along the dorsal margin; the costa is nearly straight, not convex; and the ventral margin is less convex in the middle at the base of the harpe than in A. novimmaculatus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4966.6.6:A66C, aly4966.6.6:A75G, aly215.21.9:C84G, aly215.21.9:A104G, aly1204.3.1:A630G; and COI barcode: T59C, A76G, A334T, A388G, T595C.

Barcode sequence of the holotype.

Sample NVG-23108B09, GenBank PV972610, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTACTAATTCGTACAGAGTTGGGAAACCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGCAATTGATTAGTTCCCCTAATACTAGGGGCCCCTGACATAGCTTTCCCACGTATAAATAATATAAGATTTTGAATATTACCCCCATCACTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACAGGATGAACTGTATATCCCCCCCTTTCATCAAATATTGCCCATCAGGGGTCCTCTGTTGATTTGGCTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGGGCAATTAATTTTATCACTACAATTATTAACATACGAATTAGAAATTTATCTTTTGATCAAATACCCCTATTTGTTTGATCAGTTGGTATTACTGCTCTATTATTACTTCTATCTTTACCTGTATTAGCTGGAGCCATTACTATACTTCTTACTGATCGAAACTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 550–551, bears the following five rectangular labels (1^st handwritten, others printed with handwritten text shown in italics, 3^rd yellow, last red, and others white): [ Mex:Oaxaca | Triqui region | near Yosuyusi | 22 July 1992 ], [ PARATYPE ♂ | Amblyscirtes | novimmaculatus | A.D.Warren ], [ DNA sample ID: | NVG-23108B09 | c/o Nick V. Grishin ], [ HUGH AVERY FREEMAN | COLLECTION | Donated in 2000 | to Carnegie Museum | Accession 36.730 ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Mastor) | aspilus Grishin ]. The holotype, which is also a non-conspecific paratype of A. novimmaculatus, was collected by J. Kemner (Warren 1998) and its genitalia vial was not found in the collection. Paratype: 1♂ NVG-18063H03 (leg, DNA sequenced), NVG-23121B03 (abdomen, DNA stored), USNMENT 01466221 Mexico, Guerrero, Mpio. Tetipac, Arroyo las Damas, 1800 m, M. Mendez M. leg, 23-Aug-1986, genitalia NVG241121–39 (Fig. 1312–1314) [USNM]. The paratype is also a paratype of A. novimmaculatus.

Type locality.

Mexico: Oaxaca, Mixteca region, Mpio. Santiago Juxtlahuaca, Triqui community, near Yosoyuxi village.

Etymology.

In Greek, ἄσπιλος (áspilos) means spotless or stainless, like its sister species A. novimmaculatus, and refers to the immaculate appearance of this species. The name is treated as a noun in apposition.

Distribution.

Southern Mexico.

Amblyscirtes (Mastor) immaculatus Freeman, 1970 is a valid species distinct from Amblyscirtes (Mastor) patriciae (Bell, 1959)

Genomic analysis of the holotype of Amblyscirtes immaculatus Freeman, 1970 (type locality in Mexico: Colima), a taxon currently regarded as a junior subjective synonym of Amblyscirtes (Mastor) patriciae (Bell, 1959) (type locality in Guatemala), places it in a clade with specimens from Guerrero and Michoacan, Mexico, which is sister to several other species with A. patriciae among them (Fig. 15). Therefore, we propose that Amblyscirtes (Mastor) immaculatus Freeman, 1970, reinstated status, is a valid species distinct from Amblyscirtes (Mastor) patriciae (Bell, 1959).

Lectotype designation for Amblyscirtes folia Godman, 1900

Amblyscirtes folia Godman, 1900 was described on the basis of three specimens from western Mexico: Guerrero and Jalisco (Godman 1900a). To stabilize nomenclature, clarify the type locality, and define the name A. folia objectively, N.V.G. hereby designates the syntype in the BMNH collection, the male that, according to one of its labels, was illustrated by Godman (1900a), and bears the following nine printed labels (first two round, others rectangular; first two with a red circle on one side, others white): ( Type ) and on the other side ( H | 2160 ), ( Type | H.T. ), [ Chilpancingo, | Guerrero, 4600 ft. | June.H.H.Smith. ], [ ♂ ], [ B.C.A.Lep.Rhop. | Amblyscirtes | folia, | Godm. ], [ Sp. figured. ], [ Godman-Salvin | Coll. 1913.—2. ], [ {QR Code} | NHMUK 012824160 ], and [ MOLECULAR | 0247281652 ] as the lectotype of Amblyscirtes folia Godman, 1900. The lectotype is a specimen in good condition, missing its left antenna and with a narrow linear scratch across the right hindwing in the submarginal area. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of A. folia becomes Mexico: Guerrero, Chilpancingo, 4600 ft. The COI barcode sequence of the lectotype, sample NVG-18082G12, GenBank ON480090, 658 base pairs is:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCCTTAATACTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCACCTCTTTCTTCTAATATTGCCCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCATTCGATCAAATACCCTTATTTGTATGATCAGTAGGAATTACTGCTTTATTATTACTTTTATCTTTGCCCGTATTAGCAGGAGCTATTACTATACTCCTTACCGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Chapra marcus Strand, 1909 is a junior subjective synonym of Amblyscirtes (Mastor) folia Godman, 1900

Genomic analysis of the holotype of Chapra marcus Strand, 1909 (type locality in “Delagoa Bai”), a taxon currently regarded as a junior subjective synonym of Amblyscirtes (Amblyteria) exoteria (Herrich-Schäffer, 1869) (type locality not stated), reveals that they are not monophyletic and, instead, the holotype is placed with specimens of Amblyscirtes (Mastor) folia Godman, 1900 (type locality in Mexico: Guerrero), the latter all from Mexico (Fig. 15). Therefore, we propose that Chapra marcus Strand, 1909 is a new junior subjective synonym of Amblyscirtes (Mastor) folia Godman, 1900 and hypothesize that the type locality of the former taxon is in Mexico.

Amblyscirtes (Mastor) sonofolia Grishin, new species

https://zoobank.org/B3E622C0-0EC9-4022-BE6A-78F45135211F

(Fig. 15 part, 552–553, 1315–1316)

Definition and diagnosis.

Genomic analysis of specimens from northwestern Mexico initially identified as Amblyscirtes (Mastor) folia Godman, 1900 (type locality in Mexico: Guerrero) reveals that they are genetically differentiated from it at the species level (Fig. 15); e.g., their COI barcodes differ by 6.2% (41 bp), and therefore they represent a new species. This new species may be sympatric with A. folia in Jalisco, Mexico, and keys to A. folia folia (N.2.1(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: pale spots are typically larger, the ventral hindwing spots more elongated and not as sharply defined; bases of the wings on the dorsal side are more weakly overscaled with cupreous scales; a narrower valva with a less extended harpe, its distal margin is asymmetrical: straighter near the ventral side and more rounded near the dorsal side bearing the dorsal tooth, which is better separated from the harpe, longer, and extends dorsad of the ampulla; and the ampulla has a straighter dorsal margin leading to the nearly straight costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly116.20.1:T1900G, aly116.20.1:A1953T, aly116.20.1:A2161C, aly116.20.1:T2208C, aly116.20.1:G2211A; and COI barcode: A37G, T226C, T385C, T542C, T604C.

Barcode sequence of the holotype.

Sample NVG-19042D09, GenBank PV972611, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATGTTAGGAACTTCCTTAAGATTATTAATTCGAACAGAATTAGGAAATCCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTCGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATACTTTTAATTTCAAGAAGCATCGTTGAAAATGGTGCAGGAACAGGTTGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCTCACCAAGGATCTTCTGTTGACTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATCTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCATTTGATCAAATACCTCTATTTGTATGATCAGTAGGAATTACTGCTTTATTATTACTTCTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTCTCACTGATCGAAATTTAAATACCTCTTTTTTTGACCCAGCTGGAGGTGGAGACCCAATTCTATATCAACACCTATTC

Type material.

Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 552–553, bears the following four rectangular labels (1^st handwritten, others printed), three white: [ Ajijic, Jal. | Mex. IX-5–65 | Robert Wind ], [ DNA sample ID: | NVG-19042D09 | c/o Nick V. Grishin ], [ {QR Code} | AMNH_IZC 00337862 ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Mastor) | sonofolia Grishin ]. Paratypes: 4♂♂ and 3♀♀ from Mexico: Sonora: 1♀ 11-BOA-13383BrockB11 20 mi E of the Río Yaqui on Rt. 16, ex larva, eclosed 12-Jul-1992, Jim P. Brock leg. [JPB], 1♂ 11-BOA-13383BrockB10 Rt. 16, 13 mi E of Yecora, 26-Jul-1997, Jim P. Brock leg. [JPB], and 1♂ NVG-15041D01 17 mi E of Yecora, Río Maycoba, 26-Jul-1994, Richard A. Bailowitz leg. [MGCL]; 1♀ NVG-18063H12, USNMENT 01466230 Nayarit, 5 mi SW of Compostela, 2500’, 7-Aug-1989, John Kemner leg., genitalia X-2971 J.M.Burns 1990 [USNM]; and Jalisco: 1♂ NVG-18063H10, USNMENT 01466228 Guadalajara, old [ca. 1900], Coll. W. Schaus, genitalia X-2547 J.M.Burns 1988 (Fig. 1315–1316) [USNM] and Ajijic, Robert Wind leg. [AMNH]: 1♂ NVG-19042D08, AMNH_IZC 00337861 15-Aug-1966 and 1♀ NVG-19042D10, AMNH_IZC 00337863 2-Oct-1965.

Type locality.

Mexico: Jalisco, Ajijic.

Etymology.

The name for this northernmost species of the A. folia complex refers to the northernmost Mexican state of its range: Sono[ra] + folia. The name is treated as a noun in apposition.

Distribution.

Northwestern Mexico (Sonora, Nayarit, Jalisco).

Amblyscirtes (Mastor) verafolia Grishin, new species

https://zoobank.org/1DD7846E-6669-4E8D-A22B-A450E8744822

(Fig. 15 part, 1317–1318)

Definition and diagnosis.

Genomic analysis of specimens from eastern and southern Mexico initially identified as Amblyscirtes (Mastor) folia Godman, 1900 (type locality in Mexico: Guerrero) reveals that they form a clade sister to both the new species described above and A. folia (Fig. 15) and therefore represent a new species. This new species may be sympatric with A. folia in Veracruz, Mexico, and keys to A. folia folia (N.2.1(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: darker overall appearance, pale spots are smaller and sometimes vestigial, including the ventral hindwing spots that are elongated and weakly defined; the bases of wings on the dorsal side are not cupreous in color; a broader valva with a more extended harpe, its distal margin is symmetrical and rounded and extends distad more prominently, the dorsal tooth is slightly broader and nearly level with a broader ampulla; and the costa is slightly convex. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.105.1:G2491A, aly1968.18.1:T438C, aly8661.4.1:G1473A, aly1651.5.1:C1152T, aly1651.5.1:A1386T; and COI barcode does not distinguish this species from several others due to introgression.

Barcode sequence of the holotype.

Sample NVG-18063H07, GenBank PV972612, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCCTTAATACTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCACCTCTTTCTTCTAATATTGCCCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCATTCGATCAAATACCCTTATTCGTATGATCAGTGGGAATTACTGCTTTATTATTACTTTTATCTTTACCCGTATTAGCAGGAGCTATTACTATACTCCTTACCGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 554–555 (genitalia Fig. 1317–1318), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ MEXICO: CHIAPAS | El Aguacero | c. 2300 ft | 12-VII-1992 | J. Kemner ], [ DNA sample ID: | NVG-18063H07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-19121G03 | c/o Nick V. Grishin ], [ genitalia | NVG241121–38 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466225 ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Mastor) | verafolia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 4♂♂ and 2♀♀ from Mexico: 1♂ NVG-22102G08, CASENT 8567022 Tamaulipas, Villa Gomez Farias, 500 m, 25-Dec-1973, W. W. McGuire leg. [CAS]; Veracruz: 1♀ NVG-18063H09, USNMENT 01466227 Rinconada, old [ca. 1900], Coll. W. Schaus, genitalia X-2546 J.M.Burns 1988 [USNM] and 1♂ NVG-22102G09, CASENT 8567023 Soteapan, 17-Aug-1973, Peter Hubbell leg. [CAS]; and Chiapas: 1♂ NVG-23068F11 Ocozocoautla de Espinosa, El Aguacero, 27-Jul-1988, J. Kemner leg. [TMMC], 1♂ NVG-15041C11 ca. 10 mi N of Amatenango, 7-Aug-1988, J. Kemner leg. [MGCL], and 1♀ NVG-19042D05, AMNH_IZC 00337858 Las Delicias, 60 km SW of Comitán, 700 m, Jun-1969, P. Hubbell leg. [AMNH].

Type locality.

Mexico: Chiapas, Ocozocoautla de Espinosa, El Aguacero, elevation ~2300’.

Etymology.

The name is derived from the state near the center of the range of this A. folia relative: Vera[cruz] + folia and is treated as a noun in apposition.

Distribution.

Eastern and southern Mexico (Tamaulipas, Veracruz, Chiapas).

Amblyscirtes (Mastor) nayafolia Grishin, new species

https://zoobank.org/F653EB4B-4D99-4548-B893-1AF0814F88B8

(Fig. 15 part, 556–557, 1319–1320)

Definition and diagnosis.

Genomic analysis of specimens from western Mexico initially identified as Amblyscirtes (Mastor) folia Godman, 1900 (type locality in Mexico: Guerrero) reveals that they form a clade sister to all other species in the A. folia complex (Fig. 15) and therefore represent a new species. This species may be sympatric with Amblyscirtes sonofolia, new species, in Nayarit and Jalisco, Mexico, and with A. folia in Jalisco. This new species keys to A. folia folia (N.2.1(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: pale spots are typically medium-sized, the ventral hindwing spots more elongated and not as sharply defined; the bases of wings on the dorsal side are more weakly overscaled with cupreous scales; medium-width valva with less extended harpe, its distal margin is symmetrical, rounded and not strongly protruding distad, the dorsal tooth, which is more weakly separated from the harpe and nearly level with a broader ampulla; and the costa is slightly concave. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly173.29.12:C73A, aly173.61.1:A157G, aly173.61.1:A1318C, aly903.2.4:T648A, aly903.2.4:C1188T; and COI barcode does not distinguish this species from several others due to introgression.

Barcode sequence of the holotype.

Sample NVG-18063H11, GenBank PV972613, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCCTTAATACTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCACCTCTTTCTTCTAATATTGCCCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTCGATCAAATACCCTTATTTGTATGATCAGTAGGAATTACTGCTTTATTATTACTTTTATCTTTGCCCGTATTAGCAGGAGCTATTACTATACTCCTTACCGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 556–557 (genitalia Fig. 1319–1320), bears the following six rectangular labels (first three handwritten, others printed), five white: [ Mex:Nayarit:5mi.SW. | Compostela–7 Aug.1989 | John Kemner-el.2500’ ], [ H-965 ], [ Amblyscirtes ♂ | folia | Godman | det.H.A.Freeman ], [ DNA sample ID: | NVG-18063H11 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01466229 ], and one red [ HOLOTYPE ♂ | Amblyscirtes (Mastor) | nayafolia Grishin ]. Paratypes: 1♂ and 2♀♀ from Mexico: Nayarit: 1♂ NVG-22056D09 5 mi SW of Compostela, 2500’, 7-Aug-1989, John Kemner leg. (abdomen missing) [TMMC] and 1♀ NVG-15041C12, MGCL/FLMNH 35853 3 mi SE of Zapata, 900 m, 22-Aug-1973, L. D. and J. Y. Miller leg. [MGCL] and 1♀ NVG-19042D02, AMNH_IZC 00337855 Jalisco, 7 mi S La Cumbre de Autlan, 3200’, 1966, Peter Hubbell leg. [AMNH].

Type locality.

Mexico: Nayarit, 5 mi southwest of Compostela.

Etymology.

The name is derived from the type locality of this A. folia relative: Naya[rit] + folia and is treated as a noun in apposition.

Distribution.

Western Mexico (Nayarit and Jalisco).

Vidius calacato Grishin, new species

https://zoobank.org/3760BA20-03CF-4FFC-B2E7-780EE9F19439

(Fig. 16 part, 558–559, 1321–1322)

Figure 16.

Phylogenetic trees of selected Moncina (part 3) inferred from protein-coding regions in a) the Z chromosome, based on 293,334 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of specimens from Southeast Brazil initially identified as Vidius catocala (Herrich-Schäffer, 1869) (type locality not given, likely in the Guianas as suggested by the genomic sequencing of the lectotype NVG-15036G03) reveals that they are genetically differentiated from it at the species level (Fig. 16); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore they represent a new species. This new species keys to “Cobalopsis catocala” (J.37.11) in Evans (1955), but differs from it by the following combination of characters: paler scaling along the veins on the ventral hindwing characteristic of V. catocala is more weakly expressed or vestigial; smaller or missing pale and semihyaline spots on the dorsal forewing; the ventral forewing lacks or has weaker submarginal spots between the veins M₁ and M₃; and a narrower hump on the ventral margin of the harpe, which is narrower in the middle and slightly more curved. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3512.6.3:A114G, aly671.15.6:T96A, aly1603.65.1:T504C, aly945.9.4:A282G, aly945.9.4:A287G; and COI barcode: T49C, T59C, A298T, T548C, T634C.

Barcode sequence of the holotype.

Sample NVG-22011C01, GenBank PV972614, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCCGGAATATTAGGAACATCCTTAAGTTTACTAATTCGAACAGAATTAGGTAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAGTATTATTAATTCAAGTAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTGTACCCCCCCCTTTCATCTAATATTGCCCACCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATCTCTTCAATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAACTTATCATTTGACAAATACCTTTATTTGTATGATCAGTTGGAATTACAGCTTTATTATTACTTTTATCTCTACCTGTACTAGCAGGAGCTATTACAATACTTTTAACTGATCGAAACTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Naturalis Biodiversity Center, Leiden, Netherlands (RMNH), illustrated in Fig. 558–559, bears the following five rectangular labels (1^st handwritten, others printed), four white: [ Hard. d. Dreneuf | Porto Real | Prov. Rio de Janeiro | Brazilia acq.1890 ], [ Museum | Leiden ], [ ] no text on this label, genitalic valva is glued to it, [ DNA sample ID: | NVG-22011C01 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Vidius calacato | Grishin ]. The holotype was collected by M. F. Hardy du Dréneuf (of Turnhout, Belgium), as stated in the first line of its first label. Paratype: 1♂ NVG-21013F08 (leg, DNA sequenced), NVG-23108B06 (abdomen, DNA stored) Brazil, Sao Paulo, Sao Sebastiao, 3-Dec-1901, A. Hempel leg., genitalia NVG241121–40 (Fig. 1321–1322) [CMNH].

Type locality.

Brazil: Rio de Janeiro, Porto Real.

Etymology.

The name is an anagram of the name of its sister species, V. catocala, and is treated as a noun in apposition.

Distribution.

Southeast Brazil.

Cobalopsis tys Grishin, new species

https://zoobank.org/3E614719-36AF-406C-BD91-9C56D60FD072

(Fig. 16 part, 560–561, 1323–1325)

Definition and diagnosis.

Genomic analysis of a specimen from Oaxaca, Mexico, initially identified as Cobalopsis dictys (Godman, 1900) (type locality in Mexico (Veracruz), Guatemala, Costa Rica, and Panama, illustrated specimen from Guatemala) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., its COI barcodes differ by 1.4% (9 bp), and therefore it represents a new species. This new species keys to “Papias dictys” (J.36.6) in Evans (1955), but differs from it and other relatives by the following combination of characters in females: no hyaline spot in the forewing cell R₅-M₁; purplish rather than reddish tint on the ventral side of the wings; the ventral hindwing with a postdiscal arc of slightly elongated small pale spots and a paler diffuse spot in the middle; and the ventral forewing with paler veins towards the margins. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly207.9.7:T123C, aly1041.10.2:T144C, aly6517.4.2:T666C, aly2096.12.1:T16G, aly2423.1.1:C85T, aly587.21.2:T207T (not A), aly4305.18.3:G111G (not T), aly318.39.1:C203C (not T), aly2627.21.4:A93A (not G), aly4333.9.2:T108T (not G); and COI barcode: T64C, T421T, 508T, A535T, T536C.

Barcode sequence of the holotype.

Sample NVG-22111A04, GenBank PV972615, 658 base pairs:

AACTTTATACTTCATCTTTGGAATCTGAGCCGGAATATTAGGAACTTCTTTAAGATTATTAATCCGAACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTAATACTTGGTGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGAATACTACCACCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGTACTGGTTGAACTGTATATCCCCCTCTTTCTTCTAATATTGCACATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTATTTGATCAGTTGGAATTACAGCTTTACTTCTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACAATACTTCTTACTGATCGAAATTTAAATACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATCTATTT

Type material.

Holotype: ♀ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 560–561 (genitalia Fig. 1323–1325), bears the following eight rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), seven white: [ Candelaria Loxicha | Oax. 18 July 1969 | E.C.Welling ], [ Collection of | C.D.MacNeill ], [ Papias | sobrinus (Schs.) | Det. C.D. MacNeill ‘97 ], [ DNA sample ID: | NVG-22111A04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015E02 | c/o Nick V. Grishin ], [ genitalia | NVG241114–09 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8568827 ], and one red [ HOLOTYPE ♀ | Cobalopsis | tys Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Mexico: Oaxaca, Candelaria Loxicha.

Etymology.

The name is the last syllable of the name of its relative, C. dictys, made shorter to indicate its more northern distribution. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Oaxaca, Mexico.

Artonia darienia Grishin, new species

https://zoobank.org/F902E726-72CD-42CD-B30D-9DBCD98994C2

(Fig. 16 part, 562–563, 1326–1328)

Definition and diagnosis.

Genomic analysis of a specimen from Panama initially identified as Artonia artona (Hewitson, 1868) (type locality in Brazil: Rio de Janeiro) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore it represents a new species. This new species keys to “Vettius artona” (J.45.13) in Evans (1955), but differs from it and other relatives by the following combination of characters: darker wings, hindwing underside is less overscaled with white scales, with a very small and inconspicuous two spots (a single conspicuous upper spot in A. artona) in the forewing discal cell; white streaks on the hindwing are narrower (not oval as in A. artona); the distal margin of the harpe is straighter, demarcated from the ventral margin by an angular bend; the dorsal process of the harpe is larger, separated from the ampulla by a concavity; and the ampulla is more heavily sclerotized. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly84.90.4:A270G, aly84.90.4:G313T, aly2124.3.90:G117A, aly2124.3.90:T135C, aly2250.11.6:C181A, aly537.27.1:A609A (not T), aly537.27.1:T615T (not C), aly349.38.4:G192G (not A), aly349.38.4:T193T (not C), aly304.13.1:G221G (not C); and COI barcode: C74T, T589C, T607C, T634C, T646C.

Barcode sequence of the holotype.

Sample NVG-19022F07, GenBank PV972616, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGGGCCCCCGATATAGCATTCCCCCGAATAAACAATATAAGATTTTGAATACTTCCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACTGTATATCCCCCCCTTTCTTCTAATATTGCCCACCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTCATTACTACAATTATTAATATACGAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTGTGTGATCTGTTGGAATTACAGCCTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACCATACTTTTAACAGACCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 562–563 (genitalia Fig. 1326–1328), bears the following six printed rectangular labels, five white: [ PANAMA: Darien | Cana 750m | 23.VII.1981 | Leg. G. B. Small ], [ DNA sample ID: | NVG-19022F07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121B04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–41 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532787 ], and one red [ HOLOTYPE ♂ | Artonia | darienia Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Darién Province, Cana, elevation 750 m.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Artonia guiania Grishin, new species

https://zoobank.org/0A9596EA-EEE3-4D61-A4E8-FD6FA02AFCF3

(Fig. 16 part, 564–565, 1329–1331)

Definition and diagnosis.

Genomic analysis of specimens from Venezuela and Guyana initially identified as Artonia artona (Hewitson, 1868) (type locality in Brazil: Rio de Janeiro) reveals that they are genetically differentiated from it at the species level (Fig. 16); e.g., their COI barcodes differ by 2.7% (18 bp), and therefore they represent a new species. This new species keys to “Vettius artona” (J.45.13) in Evans (1955) and was included by him in this species, but differs from it and other relatives by the following combination of characters: darker wings, hindwing underside is less overscaled with white scales, with two conspicuous hyaline spots (a single upper spot in A. artona) in the forewing discal cell; white streaks on the hindwing are narrower (not oval as in A. artona); the distal margin of the harpe is more rounded and smoothly curved towards the ventral margin; the dorsal process of the harpe is smaller and connected to a mostly straight ampulla without a concavity; and the ampulla is weakly sclerotized. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1970.2.1:T208A, aly537.27.1:A609T, aly537.27.1:T615C, aly349.38.4:G192A, aly349.38.4:T193C; and COI barcode: T250C, T472C, T505C, T589T, T607C.

Barcode sequence of the holotype.

Sample NVG-19022F05, GenBank PV972617, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAACTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGGGCCCCCGATATAGCATTCCCCCGAATAAATAACATAAGATTTTGAATACTTCCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACTGTATATCCCCCCCTTTCTTCTAATATTGCCCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTCATTACTACAATTATTAATATACGAATCAAAAATTTATCTTTTGATCAAATACCTTTATTCGTGTGATCTGTTGGAATTACAGCCTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACCATACTTTTAACAGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 564–565 (genitalia Fig. 1329–1331), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ GUYANA: Two Hat Mt, | E.Kanukus, S.Rupununi, | S. Slope 850–1200’ | 21–28.IX.2000 | 3° 6.8’N 59° 5.9’W | Leg. S.Fratello et al ], [ DNA sample ID: | NVG-19022F05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121B05 | c/o Nick V. Grishin ], [ genitalia | NVG241121–42 | c/o Nick V. Grishin ], [ {QR Code} | USNM ENT 00178962 ], and one red [ HOLOTYPE ♂ | Artonia | guiania Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ from Venezuela: NVG-17111A05 Yuracay, Hacienda Tropicale ca.10 km S of San Felipe, 100–400 m, GPS 10.2917, −68.6667, 26-Jan-23-Feb-1993, Kareofelas and Witham leg. [LACM] and NVG-19022F04, USNMENT 01532785 Margarita Is., La Sierra, 2000’, 28-Feb-1989, J. F. G. Clarke and N. L. McIntyre leg. [USNM].

Type locality.

Guyana: Eastern Kanuku Mountains, Two Hat Mountain south slope summit, elevation 850’– 1200’, GPS 3.1133, −59.0983.

Etymology.

The name is derived from the type locality in the Guianas and is treated as a noun in apposition.

Distribution.

Currently known from Venezuela and Guyana.

Corra panka Grishin, new species

https://zoobank.org/17FC274F-3481-451E-95BF-3E63C57055B6

(Fig. 16 part, 566–567, 1332–1334)

Definition and diagnosis.

Genomic analysis of a specimen from Panama initially identified as Corra conka conka (Evans, 1955) (type locality in Guatemala) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 3% (20 bp), and therefore it represents a new species. This new species keys to “Vettius coryna conka” (J.46.20(a)) in Evans (1955) and was included by him in this species, but differs from it and other relatives by the following combination of characters: the ventral hindwing is more weakly scaled with orange along the outer margin; the ventral hindwing orange rays are narrower with a wider silver area between them around the discal cell; and the harpe is nearly straight, not curving dorsad, broader, with several small teeth at the dorsal margin and weakly separated from the ampulla, which is smaller. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly318.9.2:G520A, aly876.6.1:C72T, aly1651.26.3:T72C, aly88.2.1:A222T, aly887.9.1:A99T, aly159.13.1:A364A (not C), aly11685.2.6:C54C (not T), aly6654.7.3:T198T (not C), aly276665.22.6:C72C (not T), aly4305.24.3:T39T (not C); and COI barcode: A85G, T193C, T352C, T478C, T601C.

Barcode sequence of the holotype.

Sample NVG-19022G09, GenBank PV972618, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCTGGAATACTAGGAACATCTTTAAGATTATTAATTCGAACAGAATTAGGTAACCCGGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGGGCCCCCGATATAGCATTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACTGGTTGAACAGTTTATCCCCCTCTTTCCTCTAATATTGCCCACCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAACATACGAATTAGTAACTTATCATTTGATCAAATACCTTTATTTGTCTGATCAGTTGGAATTACAGCTTTACTATTACTTTTATCTCTTCCTGTATTAGCAGGTGCTATTACAATACTTTTAACTGATCGAAATTTAAACACTTCTTTTTTTGACCCTGCCGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 566–567 (genitalia Fig. 1332–1334), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Panama:Chiriqui | Cerro Colorado | 1450m 9.VIII.1979 | G.B. Small ], [ DNA sample ID: | NVG-19022G09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG23121B06 | c/o Nick V. Grishin ], [ genitalia | NVG241121–43 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532799 ], and one red [ HOLOTYPE ♂ | Corra panka | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Chiriquí Province, Cerro Colorado, elevation 1450 m., approx. GPS 8.533, −81.783.

Etymology.

The name is a fusion of the name of the country of the type locality and the species epithet of its sister species: Pan[ama] + [con]ka . The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Cymaenes bahiensis Grishin, new species

https://zoobank.org/E745BB6B-925F-4CFA-AB17-494F3B3533A8

(Fig. 16 part, 568–569, 1335–1337)

Definition and diagnosis.

Genomic analysis of a specimen from Bahia, Brazil, initially identified as Cymaenes alumna (Butler, 1877) (type locality in Brazil: Amazonas) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 4.6% (30 bp), and therefore it represents a new species. This new species keys to C. tripunctata alumna (J.27.3(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: forewing pale spots are beige and large like in Cymaenes cavalla Evans, 1955 (type locality in Peru: Amazonas); the hindwing is more ocherous in hue, patterned as in C. alumna, with the second postdiscal band of dark spots barely traceable, without an isolated spot in cell Sc+R₁-Rs present in Cymaenes gisca Evans, 1955 (type locality in Paraguay), and the spots in cells M₁-M₂ and M₂-M₃ not conspicuously larger than the other spots, the discal dark spots are darker, nearly black, and the submarginal dark line follows the contour of the outer margin, weakening towards the tornus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly208.47.5:T223C, aly923.4.2:G1098C, aly694.1.1:C274T, aly694.1.1:G450C, aly275215.16.11:T54A, aly1139.82.5:T63T (not A), aly164.11.4:T108T (not C), aly26.6.3:T216T (not C), aly923.4.2:T369T (not G), aly536.167.2:C1321C (not A); and COI barcode: C31A, T223C, T328A, C500C, T586C.

Barcode sequence of the holotype.

Sample NVG-19018H09, GenBank PV972619, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCCGATATAGCCTTTCCACGAATAAATAATATAAGATTCTGAATATTACCCCCCTCTTTAATATTATTAATCTCAAGAAGAATCGTAGAAAATGGTGCAGGTACTGGATGAACTGTTTATCCCCCACTTTCTTCTAATATTGCCCATCAAGGAGCTTCAGTTGACTTAGCAATTTTTTCCCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCATTTGATCAAATACCTCTATTTGTATGATCAGTTGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACCGATCGAAATTTAAATACTTCTTTTTTCGATCCTGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 568–569 (genitalia Fig. 1335–1337), bears the following six printed rectangular labels, five white: [ BRAZIL:BA 1200m | Morro do Chapeu | 11O33’S 41O10’W | 24 Apr 1991 | Robbins & Becker ], [ DNA sample ID: | NVG-19018H09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG22035G09 | c/o Nick V. Grishin ], [ genitalia | NVG241121–44 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532540 ], and one red [ HOLOTYPE ♀ | Cymaenes | bahiensis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Bahia, Morro do Chapéu, elevation 1200 m, GPS −11.550, −41.167.

Etymology.

The name is derived from the Brazilian state of the type locality and is an adjective.

Distribution.

Currently known only from the holotype collected in Bahia, Brazil.

Cymaenes guianensis Grishin, new species

https://zoobank.org/07012EE7-2568-4F2B-A64A-077D08359510

(Fig. 16 part, 570–571, 1338–1340)

Definition and diagnosis.

Genomic analysis of specimens from the Guianas initially identified as Cymaenes alumna (Butler, 1877) (type locality in Brazil: Amazonas) reveals that they are genetically differentiated from it at the species level (Fig. 16); e.g., their COI barcodes differ by 5% (33 bp), and therefore they represent a new species. This new species keys to C. tripunctata alumna (J.27.3(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: weakly expressed forewing pale spots, missing on the ventral side except vestigial subapical dots; the hindwing underside is more yellowish in hue, patterned somewhat differently from C. alumna: the discal spots are more different from each other in size—a large central spot (formed by two fused spots in cells M₁-M₂ and M₂-M₃), two smaller ones towards the inner margin, and several small spots out of alignment with these three—the spots are darker, nearly black, there is no prominent isolated spot in cell Sc+R₁-Rs, the postdiscal dark band is strongly defined and less irregular, following the contour of the outer margin, consists of less diffuse and nearly black elements, and the space between the bands (discal and postdiscal) is not paler, the submarginal dark line is moderately well-defined, weaking towards the tornus; the harpe is terminally more robust and more strongly bent, with larger teeth; the valva is less expanded anteriad; and the tegumen is shorter. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly5027.1.1:A111G, aly5027.1.1:A446G, aly276922.3.1:T183G, aly84.60.4:G283A, aly84.60.4:A352T; and COI barcode: T64C, T206C, T220C, A433G, T601C.

Barcode sequence of the holotype.

Sample NVG-19018F02, GenBank PV972620, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATACTAGGAACATCTTTAAGTTTATTAATCCGAACAGAATTAGGAAACCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCCATCATAATTGGAGGATTTGGTAACTGATTAGTTCCACTAATATTAGGAGCCCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATATTACTAATCTCAAGAAGAATCGTAGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCACTTTCTTCTAATATTGCCCATCAAGGAGCTTCAGTTGATTTGGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGGGCTATTAATTTTATTACTACAATTATTAACATACGAATTAGAAATTTATCATTTGATCAAATACCCCTATTTGTTTGATCAGTTGGAATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAACACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 570–571 (genitalia Fig. 1338–1340), bears the following six printed rectangular labels, five white: [ FRENCH GUIANA: | Saul, 200–450m | 3° 37’N 53° 43’W | 18 November 1993 | leg. D.J.Harvey ], [ DNA sample ID: | NVG-19018F02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035G10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–45 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532510 ], and one red [ HOLOTYPE ♂ | Cymaenes | guianensis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Guyana, Eastern Kanuku Mts., Two Hat Mountain south slope summit, 850–1200’, GPS 3.1133, −59.0983, 21–28-Sep-2000, S. Fratello et al. leg. [USNM]: 1♂ NVG-19018G01, USNMENT 00179698 and 1♀ NVG-19018E10, USNMENT 00178630.

Type locality.

French Guiana: Saul, elevation 200–450m, GPS 3.6167, −53.7167.

Etymology.

The name is derived from the distribution of this species in the Guianas and is an adjective.

Distribution.

The Guianas.

Cymaenes paraibes Grishin, new species

https://zoobank.org/3131B53E-3C3E-4809-8D30-F116750A2D81

(Fig. 16 part, 572–573, 1341–1343)

Definition and diagnosis.

Genomic analysis of a specimen from Paraíba, Brazil, initially identified as Cymaenes alumna (Butler, 1877) (type locality in Brazil: Amazonas) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore it represents a new species. This new species keys to C. tripunctata alumna (J.27.3(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: strongly expressed forewing pale spots, which are beige and larger; the hindwing underside is more towards reddish in hue, patterned as in C. alumna, without a prominent isolated spot in cell Sc+R1-Rs, but the discal dark spots are darker, the postdiscal darker band is strongly defined, diffuse, and less irregular, following the contour of the outer margin, and the space between the bands (discal and postdiscal) is distinctly paler, the submarginal line is weakly expressed; the harpe is terminally smaller and straighter with fewer and smaller teeth; the valva is more strongly expanded anteriad; and the tegumen is longer. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2202.28.2:G897A, aly2202.28.2:C903T, aly2087.29.1:A69G, aly1577.12.1:T747C, aly1577.12.1:G876A, aly84.60.4:G283G (not A), aly84.60.4:A352A (not T), aly1475.13.1:T90T (not C), aly536.180.3:G99G (not A), aly536.180.3:T120T (not C); and COI barcode: T5C, T121C, T202C, C232A, A514C.

Barcode sequence of the holotype.

Sample NVG-19018F04, GenBank PV972621, 658 base pairs:

AACTCTATATTTTATTTTTGGAATTTGAGCCGGAATATTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATCATAATTGGAGGATTTGGTAACTGATTAGTCCCACTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATATTACTAATCTCAAGAAGAATCGTAGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCACTTTCTTCTAATATTGCCCATCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCATTTGATCAAATACCCCTATTTGTTTGATCCGTTGGAATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 572–573 (genitalia Fig. 1341–1343), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ Collection of | S. S. Nicolay | Joao Pessoa | Paraiba,Brazil | 10 April 1954 ], [ Cymaenes | idria ♂ | Det. E. | S.S. Nicolay ], [ DNA sample ID: | NVG-19018F04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035G11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–46 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532512 ], and one red [ HOLOTYPE ♂ | Cymaenes | paraibes Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Paraíba, João Pessoa.

Etymology.

The name is derived from the Brazilian state of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in east-coastal Brazil.

Cymaenes theogenis (Capronnier, 1874) is a species distinct from Cymaenes tripunctus (Herrich-Schäffer, 1865)

Genomic analysis of Cymaenes tripunctus (Herrich-Schäffer, 1865) (type locality in Cuba, syntype sequenced as NVG-15035A08) specimens throughout the range reveals that they partition into two clades genetically differentiated at the species level (Fig. 16); e.g., COI barcodes of the specimens from Brazil: Rio de Janeiro and Cuba differ by 1.8% (12 bp) (although there is mitochondrial introgression between the clades). The two clades correspond to two subspecies. The clade with specimens from Cuba (including the syntype) represents the nominate subspecies, including specimens from the Caribbean Islands, Panama, and Colombia. The second clade encompasses specimens from the Guianas and Brazil (including a specimen from Rio de Janeiro) and corresponds to Cymaenes tripunctus theogenis (Capronnier, 1874) (type locality in Brazil: Rio de Janeiro). Therefore, we propose that Cymaenes theogenis (Capronnier, 1874), reinstated status, is a species distinct from Cymaenes tripunctus (Herrich-Schäffer, 1865), which becomes monotypic.

Cymaenes sulla (Möschler, 1879) is a valid species distinct from Cymaenes theogenis (Capronnier, 1874)

Genomic analysis of the holotype of Apaustus sulla Möschler, 1878 (type locality in Colombia, sequenced as NVG-18043G07) places it in a clade far removed from either Cymaenes theogenis (Capronnier, 1874), reinstated status, (type locality in Brazil: Rio de Janeiro) or Cymaenes tripunctus (Herrich-Schäffer, 1865) (type locality in Cuba) and is not closely related to any other species of Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), except the new one described below (Fig. 16). Therefore, we propose that Cymaenes sulla (Möschler, 1879), reinstated status, is a valid species distinct from Cymaenes theogenis (Capronnier, 1874).

Cymaenes taboga Grishin, new species

https://zoobank.org/B5970EE2-129D-49DE-A686-FC024C72F704

(Fig. 16 part, 574–575)

Definition and diagnosis.

Genomic analysis of a specimen from Panama identified by H. A. Freeman as Nastra guianae (Lindsey, 1925) (type locality in Guyana), presently a junior subjective synonym of Papias amyrna (Mabille, 1891) (type locality in Venezuela), reveals that it belongs to Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), is sister to Cymaenes sulla Möschler, 1878, reinstated status, (type locality in Colombia) and genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 2% (13 bp), and therefore it represents a new species. This new species keys (incompletely) to “N. guianae” (J.26.5) in Evans (1955), but differs from it and other relatives, in particular, from its sister species C. sulla by the following combination of characters: smaller or vestigial spots on the forewing; and the ventral hindwing with more weakly defined darker discal spots (entirely missing in Papias amyrna and relatives) and a vestigial paler postdiscal band, but no trace of postdiscal dark spots on the hindwing underside. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1405.25.1:A72G, aly2202.28.2:G852C, aly9313.1.1:G90A, aly9313.1.1:C108T, aly3157.6.7:A66T, aly671.27.13:G501G (not A); and COI barcode: A100G, T106C, C154T, T337C, T596C.

Barcode sequence of the holotype.

Sample NVG-22044B06, GenBank PV972622, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATACTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGTTCTTTAATTGGGGATGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTCTGAATATTACCCCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGTTGAACTGTCTACCCCCCACTTTCTTCTAATATTGCTCATCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCATTATTTGTTTGATCAGTTGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Cornell University Insect Collection, Ithaca, New York, USA (CUIC), illustrated in Fig. 574–575, bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Taboga Id. | PANAMA | 8 Apr. ‘20 ], [ Cornell U.| Lot.607 | Sub. 21 ], [ Cornell U.| Lot.703 | Sub.212 ], [ Nastra ♂ | guianae | (Lindsey) | Det. H.A. Freeman ], [ DNA sample ID: | NVG-22044B06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Cymaenes | taboga Grishin ]. The end of the abdomen is missing in the holotype, possibly due to dermestid damage.

Type locality.

Panama: Panamá Province, Taboga Island.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected on Taboga Island in Panama.

Cymaenes sacchariphila (Dyar, 1917) is a valid species distinct from Cymaenes alumna (Butler, 1877)

Genomic analysis of a syntype of Vehilius sacchariphila Dyar, 1917 (type locality Guyana: Georgetown), currently treated as a junior subjective synonym of Cymaenes alumna (Butler, 1877) (type locality in Brazil: Amazonas), reveals that together with another specimen it forms a clade in the rapid radiation of Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865) and is not closely related to C. alumna (Fig. 16). Therefore, we propose that Cymaenes sacchariphila (Dyar, 1917), reinstated status, is a species distinct from Cymaenes alumna (Butler, 1877).

Pamphila ancus Möschler, 1879 is a junior subjective synonym of Cymaenes tripunctus (Herrich-Schäffer, 1865)

Pamphila ancus Möschler, 1878 was described from an unstated number of specimens from Colombia (Möschler 1878). Since Draudt (1923), P. ancus has been regarded as a junior subjective synonym of Cymaenes tripunctus (Herrich-Schäffer, 1865) (type locality in Cuba). Genomic analysis of one P. ancus syntype (sequenced as NVG-15036E08, see Fig. 16) revealed that it is a species of the subgenus Morys Godman, 1900 (type species Morys valerius valda Evans, 1955) in the genus Lerema Scudder, 1872 (type species Papilio accius Smith, 1797) that Evans (1955) misidentified as “Morys valerius valerius,” but Apaustus valerius Möschler, 1878 (type locality in Colombia) is a valid species of Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, which is treated as a junior subjective synonym of Hesperia autumna Plötz, 1882) and Euroto potaro Williams and Bell, 1931 (type locality in Guyana) is its junior subjective synonym (Zhang et al. 2022b). Therefore, based on the taxonomic identity of the sequenced syntype, Zhang et al. (2022b) applied the name Lerema (Morys) ancus Möschler, 1878 to this species.

Genomic analysis of another P. ancus syntype (by now sequenced as NVG-21126G03, see Fig. 16) reveals that it is placed within specimens of C. tripunctus (syntype sequenced as NVG-15035A08) in agreement with the historical treatment of the name in essentially all works (Mielke 2005). To maintain stable for about a century application of the name P. ancus and define it objectively, N.V.G. hereby designates the syntype in the MFNB collection, the female that bears the following ten labels (1^st and 3^rd purple, 2^nd green, others white; 2^nd, 3^rd, 5^th, and 7^th handwritten, others printed): [ Origin. ], [ Columbien | Sth. 76 ], [ Type. | Verholg. Zool. | bot. Gesellschft. | 1878.p.214. ], [ Coll. Möschl. ], [ ancus Mösch ], [ 967. ], [ Cobalus (?) | Tripuncta, H.-S. ], [ Coll. | Staudinger ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 3226a9 ], [ DNA sample ID: | NVG-21126G03 | c/o Nick V. Grishin ], as the lectotype of Pamphila ancus Möschler, 1879. The lectotype is missing the tornal area of the left hindwing and its left forewing has linear scratches near its apex above. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-21126G03, GenBank PV972623, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGTCTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCCCCCGATATAGCATTCCCACGAATAAATAATATAAGATTTTGAATGTTACCTCCTTCTTTAATGCTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCTCTTTCCTCTAATATTGCTCACCAAGGAGCTTCAGTTGACTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCCATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTTGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Lerema (Morys) valerianus Grishin, new species

https://zoobank.org/45F14B8D-AE1B-4EEF-97AF-BFD23242D600

(Fig. 16 part, 576–577)

Definition and diagnosis.

This is the species Evans (1955) misidentified as “Morys valerius valerius”, see Zhang et al. (2022b) for discussion, and is conspecific with one of the former syntypes of Pamphila ancus Möschler, 1878 (type locality in Colombia) (Fig. 16). Zhang et al. (2022b) proposed to use the name Lerema ancus for this species, however, one of the former syntypes that we designated as the lectotype above (to better follow historical treatment of the name) is conspecific with Cymaenes tripunctus (Herrich-Schäffer, 1865) (type locality in Cuba). Therefore, this species is left without an available name and is new. This new species keys to “Morys valerius valerius” (J.40.1(b)) in Evans (1955) and is this species due to misidentification, thus all the characters in the key refer to this species. In brief, it differs from others by the following combination of characters: prominent stigma of three elements (the upper one along the discal cell between the origins of veins CuA₁ and CuA₂ and two parallel bars below the vein CuA₂), forewing with larger hyaline spots in cells M₃-CuA₁ and CuA₁-CuA₂, an upper spot in the discal cell, and an opaque spot near the middle by the inner margin, the ventral forewing with a prominent paler area towards the tornus, and the hindwing with a curved row of small pale postdiscal spots. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly251.11.2:C78T, aly251.11.2:G123A, aly731.15.4:C105T, aly3263.11.23:C177T, aly3263.11.23:C180A; and COI barcode: T38C, T202C, T361C, T385C, T406C.

Barcode sequence of the holotype.

Sample NVG-18013A08, GenBank PV972624, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCGCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGAATATTACCCCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACTGTTTACCCTCCTTTATCCTCTAATATCGCTCACCAAGGAGCTTCAGTTGACTTAGCAATTTTTCTCTTCACTTAGCAGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTGTGATCTGTTGGAATTACTGCATTATTATTATTATTATCTTTACCTGTATTAGCGGGAGCTATTACTATACTTTT AACTGATCGAAATCTTAATACTTCTTTCTTTGACCCTGCAGGAGGGGGAGATCCAATTTTATACCAACACTTATTC

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 576–577, bears the following four printed rectangular labels, three white: [ FRENCH GUIANA: | Montravel | 4°55’N 52°16’W | 7 December 1993 | leg. D.J.Harvey ], [ DNA sample ID: | NVG-18013A08 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450356 ], and one red [ HOLOTYPE ♂ | Lerema (Morys) | valerianus Grishin ]. Paratypes: 3♂♂ and 2♀♀: 1♀ NVG-15036E08, http://coll.mfn-berlin.de/u/44a000 (a paralectotype of Pamphila ancus Möschler, 1879) Colombia, 18-Feb-1905, Staudinger leg. [MFNB]; Venezuela: 1♂ NVG-18013A07, USNMENT 01450355 Margarita Is., La Sierra, 2000’, 2-Mar-1989, J. F. G. Clarke and N. L. McIntyre leg. [USNM] and 1♀ NVG-24074G05 Aragua, Pozo del Diablo, N of Maracay, 420–440 m, 22-Jul-1981, Lee D. Miller leg., genitalia vial SRS-4098 by S. R. Steinhauser [MGCL]; and Guyana: 1♂ NVG-18115D01, USNMENT 00178562 Eastern Kanuku Mts, Two Hat Mountain, Rupununi Savannah near Shea Rock, 600’, GPS 2.9500, −59.1483, 15-Sep-4-Oct-2000, S. Fratello et al. leg. [USNM] and 1♂ NVG-24074G07, UF FLMNH MGCL 1058753 Essequibo, Cipo, Ireng River, 2000 ft, Nov-1993, S. Fratello leg., genitalia vial SRS-4625 by S. R. Steinhauser [MGCL].

Type locality.

French Guiana: Montravel, GPS 4.9167, −52.2667.

Etymology.

The name is a modified version of the name valerius that Evans applied to this species due to misidentification. The name is treated as a noun in apposition.

Distribution.

Mostly the Amazonian region.

Saturnus oaxacus Grishin, new species

https://zoobank.org/F99504ED-F02A-4FFE-B6A6-0AB391937C15

(Fig. 16 part, 578–581, 1344–1346)

Definition and diagnosis.

Genomic analysis of specimens from Oaxaca, Mexico, initially identified as Saturnus obscurus (Bell, 1941) (type locality in Panama: Chiriquí) reveals that they are genetically differentiated from it at the species level (Fig. 16); e.g., their COI barcodes differ by 3.3% (22 bp), and therefore they represent a new species. This new species keys to Saturnus tiberius obscurus (L.1.4(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters in males: the ventral hindwing mostly warm brown color with an irregular and broad orange-yellow discal band (separated into spots in the posterior half) and overscaling of the same color along some veins, darker than in S. obscurus, but paler than in Saturnus obscurior Grishin, 2023 (type locality in Panama); the dorsal hindwing with a trace of postdiscal orange spots; a narrower valva; the harpe is more angled between the straighter ventral margin and the curved inward and dorsad process, which is as long as the harpe and mostly straight in lateral view; and a longer saccus. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1149.5.1:T27A, aly5715.3.16:G105A, aly600.9.1:C189T, aly2284.27.5:G87A, aly939.9.8:C48T; and COI barcode: T136C, C271T, T304C, T421C, T490C.

Barcode sequence of the holotype.

Sample NVG-19024A11, GenBank PV972625, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCACGCATTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGTTTTGGTAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGAATACTACCTCCCTCATTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGTACTGGTTGAACAGTTTACCCCCCTCTTTCTGCTAATATTGCACATCAAGGAGCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGACCAAATACCTTTATTTGTATGATCAGTCGGTATTACTGCATTACTTTTACTTTTATCCTTACCTGTTTTAGCAGGGGCTATTACTATACTCTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCAGGAGGAGGGGACCCAATCCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 578–579 (genitalia Fig. 1344–1346), bears the following seven rectangular labels (first two handwritten, others printed), six white: [ Mex:Oaxaca:2mi. N. | Candelaria-22 Oct.1988 | John Kemner ], [ Saturnus ♂ | obscurus | (Bell) | det.H.A.Freeman ], [ DNA sample ID: | NVG-19024A11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121B08 | c/o Nick V. Grishin ], [ genitalia | NVG241121–48 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532898 ], and one red [ HOLOTYPE ♂ | Saturnus | oaxacus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ from Mexico, Oaxaca: 1♂ NVG-22111A07, CASENT 8568830 Candelaria Loxicha, 4-Aug-1971, E. C. Welling leg. [CAS] (Fig. 580–581) and 1♂ NVG-23071G09 Pluma Hidalgo, 30-Jan-1988, J. Kemner leg. [TMMC].

Type locality.

Mexico: Oaxaca, 2 mi north of Candelaria Loxicha.

Etymology.

The name is derived from the Mexican state of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Oaxaca in Mexico.

Saturnus jaguarundi Grishin, new species

https://zoobank.org/C8F2B967-DE49-4F93-8869-04EB2C3F537E

(Fig. 16 part, 582–583, 1347–1349)

Definition and diagnosis.

Genomic analysis of a specimen from southeastern Peru initially identified as Saturnus jaguar (Steinhauser, 2008) (type locality in Guyana) reveals that it is genetically differentiated at the species level (Fig. 16), although the COI barcodes do not distinguish this species, and it represents a new species. This new species keys to Saturnus metonidia (Schaus, 1902) (L.1.3) in Evans (1955), but differs from it and other relatives by the following combination of characters: larger forewing yellow spots, e.g., the spot in the cell CuA₁-CuA₂ is diamond-shaped, broader than the spot in the cell M₃-CuA₁; the ventral hindwing with yellow veins and only two distinct yellow spots, those between the veins M₃ and CuA₂; the process at the base of the uncus is longer and narrower; and the valva is narrower, with a longer harpe that is less angled. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly363.13.1:G114A, aly363.13.1:C144A, aly6954.12.9:C1227T, aly6954.12.9:T1242A, aly1146.46.4:T267A, aly577.41.1:A39A (not G), aly420.35.1:C498C (not T), aly141.4.2:T138T (not C), aly188.2.11:C138C (not T), aly767.11.3:G134G (not A); and COI barcode does not distinguish this species from S. jaguar.

Barcode sequence of the holotype.

Sample NVG-19024A09, GenBank PV972626, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCTGGAATATTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACTGCCCATGCCTTTATTATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTACCACCCTCATTAATATTACTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCATCTAATATTGCACACCAAGGTGCATCCGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTAGCATTTGATCAAATACCTTTATTTGTTTGATCAGTCGGTATTACAGCACTATTATTACTTTTATCTTTACCCGTTTTAGCAGGAGCAATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 582–583 (genitalia Fig. 1347–1349), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU 300m | 30 Km S.W. | Pto. Maldonado | 27 Oct. ’83 | S. S. Nicolay ], [ genitalia | ♂ slide/vial # | H799 | Prep. S.S. Nicolay ], [ Saturnus ♂ | metonidia | Det. Schaus | S.S. Nicolay ], [ DNA sample ID: | NVG-19024A09 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532896 ], and one red [ HOLOTYPE ♂ | Saturnus | jaguarundi Grishin ].

Type locality.

Peru: Madre de Dios Region, 30 km southwest of Puerto Maldonado, elevation 300 m.

Etymology.

The name is formed from the name of its relative, S. jaguar, made longer to indicate the more southern distribution of this species. The name is a noun in apposition.

Distribution.

Currently known only from the holotype collected in southeastern Peru.

Streakus unisolus Grishin, new genus and new species

https://zoobank.org/82827DA8-B209-4D25-84D6-726DE34E7433 (new genus)

https://zoobank.org/91238927-F72F-400D-8E6D-87F029AB3A10 (new species)

(Fig. 16 part, 584–585, 1350–1351)

Definition of the new genus.

Genomic analysis of a specimen from southern Peru reveals that it forms a lineage in the deep diversification of the group including several genera, being sister to Saturnus Evans, 1955 (type species Papilio saturnus Fabricius, 1787 and Parphorus Godman, 1900 (type species Phlebodes storax Mabille, 1891), and therefore represents a new genus (Fig. 16). This new genus differs from related genera by the following combination of characters: the forewing apex is not produced, the outer margin is mostly convex, the hindwing margin slightly concave around the vein CuA₂; a narrow brand between the bases of the forewing veins CuA₁ and CuA₂; the harpe is the same length as the rest of the valva, distally rounded, with a broad dorsal tooth that protrudes dorsad from the ampulla for about 1/3 of the valva width, merged with the ampulla, which is not defined; the costa has a concavity in the middle and the valva is slightly expanded anteriad; uncus arms are convergent, longer than tegumen; gnathos is well-developed, longer than uncus, also with convergent arms; and the saccus is as long as the valva. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly535.10.1:A654G, aly535.10.1:G691A, aly535.10.1:T155A, aly535.10.1:C459T, aly1727.7.1:C97T, aly27.7.1:A495A (not T), aly770.6.9:C58C (not A), aly770.6.9:A63A (not G), aly127.22.1:T72T (not C), aly3512.5.7:C258C (not T).

Type species.

Streakus unisolus Grishin, new species.

Species included in the genus.

Only the type species.

Parent taxon for the genus.

Subtribe Moncina A. Warren, 2008

Definition of the new species.

Entirely chocolate dark brown with vestigial beige spots near the bases of the dorsal forewing cells R₅-M₁ and M₃-CuA₁, the ventral forewing is unspotted, and the ventral hindwing has a trace of small postdiscal beige-orangish spots, the palpi are dark gray beneath with some beige scales, and the abdomen is beige beneath. In DNA, a combination of the following base pairs is diagnostic in the COI barcode: A37G, T259C, A334C, A415T, T523C.

Barcode sequence of the holotype.

Sample NVG-19023H04, GenBank PV972627, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGGGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGAATATTACCCCCCTCATTAATACTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACCGTTTATCCCCCTCTTTCCTCTAATATTGCTCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTTGGTATCACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCGGGAGCTATTACTATACTTTTAACTGATCGAAATCTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 584–585 (genitalia Fig. 1350–1351), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU:Cuzco1450 m. | San Pedro Lodge | Cosnipata Rd 1220 | 29-I-2010 Kinyon ], [ DNA sample ID: | NVG-19023H04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23119D08 | c/o Nick V. Grishin ], [ genitalia | NVG241121–49 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532879 ], and one red [ HOLOTYPE ♂ | Streakus unisolus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Cuzco Department, Cosñipata Road, San Pedro Lodge, elevation 1450 m.

Etymology.

The name of the genus indicates a streak-shaped form of the stigma and is treated as a masculine noun in the nominative singular. The species epithet indicates uniqueness of this species with a sole streak instead of the fully developed stigma and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southern Peru.

Comment.

The caudal part of aedeagus was broken off in the holotype, possibly by someone attempting a “dry dissection” on this specimen.

Vistigma (Penicula) cometa Grishin, new species

https://zoobank.org/8B817D1F-136D-4DA4-81F0-3ECA1414C96B

(Fig. 16 part, 586–587, 1352–1353)

Definition and diagnosis.

Genomic analysis of specimens from eastern Colombia initially identified as Vistigma (Penicula) bryanti (Weeks, 1906) (type locality in Venezuela) reveals that they may be not monophyletic with it and are genetically differentiated from it at the species level (Fig. 16); e.g., their COI barcodes differ by 3.6% (24 bp), and therefore they represent a new species. This new species keys to Penicula bryanti (L.10.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: forewings with smaller and fewer spots, e.g., no subapical spots, the three hyaline spots between the veins M₂ and CuA₂ are shorter than wide (usually longer in V. bryanti), and the ventral hindwing with only vestigial and diffuse postdiscal spots; the valva with a longer process at its base directed posterodorsad; and the harpe is narrower in the middle and bent dorsad ending in a slightly broader tooth reaching above the level of the basal process. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3087.2.1:T708C, aly798.5.3:T327C, aly525.7.1:A135G, aly499.27.19:G168C, aly499.27.19:G171T; and COI barcode: G98A, T133C, T445C, A433G, A607C.

Barcode sequence of the holotype.

Sample NVG-19024D10, GenBank PV972628, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGTTTATTAATTCGTACCGAATTAGGAGCCCCTGGTTCATTAATTAGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAATATTATTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGTACTGGATGAACTGTATATCCTCCTCTTTCTTCTAATATCGCTCACCAGGGAGCATCTGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCTTCTATTTTAGGGGCTATTAATTTCATTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCTGTTGGTATTACTGCTCTATTATTATTACTATCATTACCTGTTTTAGCAGGGGCTATTACTATGCTTTTAACAGATCGAAATTTAAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 586–587 (genitalia 1352–1353), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ COLOMBIA: Meta | Rio Negro, 800 m. | 13 Jan.’71 | leg. S. S. Nicolay ], [ DNA sample ID: | NVG-19024D10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121B10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–50 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532929 ], and one red [ HOLOTYPE ♂ | Vistigma (Penicula) | cometa Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-23095A06 Colombia, Upper Rio Negro, 800 m, old, coll. Fassl [ZfBS].

Type locality.

Colombia: Meta Department, Río Negro, elevation 800 m.

Etymology.

The name is a fusion indicating the species type locality: Co[lombia] + Meta. The name is a noun in apposition.

Distribution.

Currently known from eastern Colombia.

Phlebodes trapinex Grishin, new species

https://zoobank.org/F8BA3D8A-52FE-4202-BA62-9A0190F61132

(Fig. 16 part, 588–589, 1354–1356)

Definition and diagnosis.

Genomic analysis of a specimen from Guyana initially identified as Phlebodes pertinax (Stoll, 1781) (type locality in Suriname) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore it represents a new species. This new species keys (incompletely) to P. pertinax (L.2.2) or to Phlebodes notex Evans, 1955 (type locality in Brazil: Amazonas) (L.2.4) in Evans (1955), but differs from it and other relatives by the following combination of characters in females: smaller forewing spots, e.g., those in cells M₃-CuA₁ and CuA₁-CuA₂ are separated from each other by about the size of the former spot; one upper discal cell spot, stronger and bluer (rather than purplish) flush of the ventral side of wings; a single prominent semihyaline spot near the anterior side of the forewing discal cell and ventrally a second pale spot near the posterior side (absent in P. pertinax); a single well-defined round pale spot in the discal area of the ventral forewing anteriad of the vein 1A+2A without a paler area around and distad of this spot; the lamella postvaginalis about twice as broad as long, with a vestigial central notch in the middle of its distal margin, more heavily sclerotized around the notch and concave on both sides of the central sclerotized hump with the notch; the antrum is about two times longer than the lamella; and the ductus bursae smoothly transitions into very extended corpus bursae armed with numerous dark-brown signa over most of its surface and ending in a weakly sclerotized sac separated from the section with signa by a narrower tract. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2250.13.1:A20G, aly2250.13.1:A60T, aly2250.13.1:G78T, aly430.5.1:A136G, aly430.5.1:A164G, aly322.14.2:A411A (not C), aly322.14.2:A438A (not G), aly499.7.3:T2601T (not C), aly2508.10.1:T207T (not G), aly119.2.7:T297T (not A); and COI barcode: T38C, A166G, A229G, T463C, T548C.

Barcode sequence of the holotype.

Sample NVG-19023C12, GenBank PV972629, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACATCTTTAAGATTACTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATGGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCTCCTTCCCTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGTTGAACTGTTTATCCCCCACTTTCTTCTAATATTGCTCATCAAGGTTCTTCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCGGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAACATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTTGGTATTACAGCTTTACTATTACTTTTATCTCTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 588–589 (genitalia Fig. 1354–1356), bears the following six printed rectangular labels, five white: [ GUYANA: Region 9 | Kanuku Mts., Nappi Creek | 2700’ - 3300’ | 03°18.8’N 59°32.9’W | 21 Feb - 10 Mar 1999 | leg. S. Fratello, R. Hanner, | S. Hendricks, R. Williams. ], [ DNA sample ID: | NVG-19023C12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035H10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–51 | c/o Nick V. Grishin ], [ {QR Code} USNM ENT | 00232517 ], and one red [ HOLOTYPE ♀ | Phlebodes | trapinex Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Guyana, Kanuku Mountains, Nappi Creek, elevation 2700’–3300’, GPS 3.3133, −59.5483.

Etymology.

The name was formed by anagramming the specific epithet of its sister species P. pertinax. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Guyana.

Phlebodes punto Grishin, new species

https://zoobank.org/1FCAFA60-4A3C-4DD4-B1B7-8D8AD6991CDD

(Fig. 16 part, 590–591, 1357–1359)

Definition and diagnosis.

Genomic analysis of a specimen from Peru initially identified as Phlebodes sifax Evans, 1955 (type locality in Brazil: Amazonas) reveals that it is not monophyletic with it and is sister to several other species, being genetically differentiated from them at the species level (Fig. 16); e.g., their COI barcodes differ by 6.4% (42 bp), and therefore it represents a new species. This new species keys to Phlebodes campo sifax (L.2.3(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters in females: a lower discal cell spot on the forewing; the paler ventral side of wings, e.g., the entire hindwing and the apical quarter of the forewing are pale-lavender with streak-shaped postdiscal spots between paler veins; a single semihyaline spot near the posterior side of the forewing discal cell; a single well-defined round pale spot in the discal area of the ventral forewing anteriad of the vein 1A+2A without a paler area around and distad of this spot; the lamella postvaginalis is about twice as long as wide, nearly straight at its distal margin, only slightly concave without a central notch; the antrum is about the same length as the lamella; and the ductus bursae smoothly transitions into very extended corpus bursae armed with numerous brown signa on the ventral side and ending in a weakly sclerotized balloon-shaped sac separated from the section with signa by a narrower tract. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly216.68.2:A178C, aly216.68.2:G223A, aly216.65.4:A30G, aly216.65.4:G93A, aly276558.4.10:A1479G, aly1222.15.9:A1680A (not T), aly890.58.2:A36A (not C), aly85.9.1:A508A (not G), aly85.9.1:T571T (not A), aly349.2.4:T39T (not A); and COI barcode: A58T, A139C, T376C, T520C, T601C.

Barcode sequence of the holotype.

Sample NVG-19024C01, GenBank PV972630, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGACTTCTAATTCGAACAGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCAGACATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTACCTCCCTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTATACCCACCTCTTTCTTCTAATATTGCTCATCAAGGATCCTCTGTTGATTTAGCAATTTTCTCCCTTCATTTAGCAGGTATCTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTTGGCATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAACACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 590–591 (genitalia Fig. 1357–1359), bears the following seven rectangular labels (2^nd handwritten, others printed), six white: [ PERU. SAN MARTIN: km 18 | TarapotoYurimaguas, 1250m, | 06°27’S 76°17’W 13.XI.1998 | Leg.Robbins, Lamas & Grados ], [ Phlebodes | campo | ssp. ], [ DNA sample ID: | NVG-19024C01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036A11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–52 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532909 ], and one red [ HOLOTYPE ♀ | Phlebodes | punto Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: San Martín Region, km 18 of Tarapoto–Yurimaguas Road, elevation 1250 m, GPS −6.4500, −76.2833.

Etymology.

The name refers to the small white spot near the inner margin of ventral forewing and is a noun in apposition.

Distribution.

Currently known only from the holotype collected in Peru.

Phlebodes maransis Grishin, new species

https://zoobank.org/9F640106-43CB-466A-BADE-F21E090B4BE8

(Fig. 16 part, 592–593, 1360–1361)

Definition and diagnosis.

Genomic analysis of a specimen from central Ecuador initially identified as Phlebodes duplex Grishin, 2023 (type locality in Guatemala) reveals that it is genetically differentiated at the species level (Fig. 16); e.g., their COI barcodes differ by 1.5% (10 bp), and therefore it represents a new species. This new species keys (incompletely) to Phlebodes campo campo (L.2.3(b)) in Evans (1955), but differs from it and other relatives by the following combination of characters: smaller spots, some missing or vestigial, e.g., no subapical or discal cell forewing spots, a rounded (not diamond-shaped) hyaline spot in the forewing cell CuA₁-CuA₂, and smaller and vestigial postdiscal spots on the ventral hindwing, which has paler veins; the ventral forewing has a diffuse tornal beige spot brighter towards the wing’s middle; the valva is narrower in the middle, the harpe with a narrower transition to the upturned portion that is broader at its base and distally rounder; and the dorsal tooth of the harpe is farther from the ampulla, which lacks a prominent tooth directed dorsad. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1297.6.1:T46A, aly1585.12.1:A69C, aly2532.10.1:A1911T, aly887.25.2:G36T, aly4645.9.3:C24T, aly322.16.9:T351T (not C), aly1603.42.6:A210A (not G), aly1603.42.6:A222A (not G), aly1872.7.3:A687A (not G), aly2672.2.3:T33T (not A); and COI barcode: A85T, C106C, C292T, T304C, T457C, T652C.

Barcode sequence of the holotype.

Sample NVG-8046, GenBank PV972631, 658 base pairs:

AACTTTATACTTTATTTTCGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGACTACTAATTCGTACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAACACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGAATACTTCCCCCTTCTTTAATACTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCCTCTAATATCGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATCATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCCGCTGGTGGAGGAGATCCAATTCTCTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 592–593 (genitalia Fig. 1360–1361), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR:Pastaza | 1° 34’S, 78° 02’W | 10km SW Puyo 1000m | 17 September 1990 | S S Nicolay leg ], [ DNA sample ID: | NVG-8046 | c/o Nick V. Grishin ], [ genitalia | NVG170208–31 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321886 ], and one red [ HOLOTYPE ♂ | Phlebodes | maransis Grishin ].

Type locality.

Ecuador: Pastaza Province, 10 km southwest of Puyo, elevation 1000 m, GPS −1.5667, −78.0333.

Etymology.

The Greek word μάρανσις (maransis) is derived from the verb μαραίνομαι (maraínomai), which means to wither, fade, or decay and refers to the diffuse and faded pale area by the inner margin of ventral hindwing in the new species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected just east of the Andes in central Ecuador.

Metiscus gothic Grishin, new species

https://zoobank.org/ADA7377B-7C42-4CB3-AD63-2E0F2B7A2C25

(Fig. 17 part, 594–595, 1362–1364)

Figure 17.

Phylogenetic trees of selected Moncina (part 4), Anthoptina, and Falgina inferred from protein-coding regions in a) the Z chromosome, based on 337,254 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of specimens from Panama and Colombia initially identified as Metiscus goth Grishin, 2022 (type locality in Costa Rica) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 1.7% (11 bp), and therefore they represent a new species. This new species keys to “Enosis angularis infuscata” (K.4.10(a)) in Evans (1955) and was probably included in it by him, because Evans misidentified Hesperia infuscata Plötz, 1882 (type locality in Brazil: Rio de Janeiro), currently a junior subjective synonym of Mnaseas derasa derasa (Herrich-Schäffer, 1870) (type locality in Brazil) (Zhang et al. 2022b). Northern populations of the species that Evans misidentified as “Enosis angularis infuscata” were recently described as Metiscus goth, while this new species encompasses more southern populations, possibly overlapping with M. goth in Central America and differing from it and other Metiscus Godman, 1900 species by the following combination of characters: a smaller brand with the upper section thinner and the lower section shorter, nearly dot-like; females have only one clearly expressed hyaline spot near the base of the forewing cell M3-CuA1, larger and more elongated than in M. goth; the ventral side is darker with the ventral hindwing mostly dark-brown basad of a paler submarginal area and typically without the slightly paler postdiscal area of M. goth; the harpe has a concavity near the ventral side of the posterior margin, a small tooth directed dorsoposteriad near the dorsal side, and a large dorsal tooth fused with the ampulla; and the costa is concave in the middle between a slightly humped ampulla and the base. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly145.10.3:T1029A, aly506.11.2:G720A, aly770.26.2:A73C, aly1259.43.1:C51T, aly16.20.5:A69G; and COI barcode: C271T, C421T, C539C, T542C, C634C.

Barcode sequence of the holotype.

Sample NVG-22035G04, GenBank PV972632, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGCTCTTTAATCGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGAATATTGCCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCTTCTAACATTGCCCATCAAGGATCTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAGATTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTATTACTACTATCTTTACCTGTATTAGCTGGAGCTATCACCATACTTCTTACTGACCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGTGGAGGAGACCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 594–595, bears the following five printed (text in italics handwritten) rectangular labels, four white: [ JAN. 18 1985 | Cali. Pance, 3000’ | Valle, Colombia | J. Bolling Sullivan ], [ genitalia Vial | SRS-4339 ], [ Enosis | infuscata ♂ | det. S. R. Steinhauser ], [ DNA sample ID: | NVG-22035G04 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Metiscus | gothic Grishin ]. Paratypes: 2♂♂ and 1♀ from Panama: 1♂ NVG-22109E03, CASENT 8568778 Barro Colorado Island, 24-Jul-1963, D. Q. Cavagnaro and M. E. Irwin leg. [CAS] and 1♀ NVG-19023G07, USNMENT 01532871 Colón, Santa Rita, 1500’, 4-Feb-1970, S. S. Nicolay leg. [USNM] and 1♂ NVG-22035G03 Colombia, Valle del Cauca, Cali, Pance, 3000’, 6-Jan-1985, J. Bolling Sullivan leg., unnumbered genitalia vial attached to the same pin as the specimen (genitalia Fig. 1362–1364) [USNM].

Type locality.

Colombia: Valle del Cauca, Cali, Pance, elevation 3000’.

Etymology.

The name is formed from the species epithet of its sister, goth, made longer to indicate more southern distribution of this new species. The name is a treated as noun in apposition.

Distribution.

Panama and Colombia.

Lychnuchus (Enosis) philos Grishin, new species

https://zoobank.org/D74A6E4E-1E60-44D5-AB18-0DB401AEF68A

(Fig. 17 part, 596–597, 1365–1367)

Definition and diagnosis.

Genomic analysis of a specimen from Panama initially identified as Lychnuchus (Enosis) aphilos (Herrich-Schäffer, 1869) (type locality not specified, possibly in Venezuela) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore it represents a new species. This new species keys to Enosis aphilos (K.4.2) in Evans (1955), but differs from it and other relatives by the following combination of characters in males: larger forewing hyaline spots; a third tiny subapical spot in addition to two others; larger posterior segments of the stigma; the aedeagus with a smaller spiculate process in the distal quarter; the harpe is shorter, its dorsal part with teeth is shorter and more stout; the ampulla is nearly flat at the dorsal margin, not concave; and the costa has a broader and less prominent hump in the middle. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1019.12.4:C127A, aly525.41.2:C103T, aly4646.5.1:C147A, aly4646.5.1:C157T, aly2284.26.9:A87G, aly2096.44.1:T462T (not C), aly10226.7.5:T144T (not C), aly6654.9.11:C135C (not T), aly1155.15.1:T348T (not C), aly619.21.3:A132A (not G); and COI barcode: T49C, T88C, A199G, A466G, T562C.

Barcode sequence of the holotype.

Sample NVG-19023F11, GenBank PV972633, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACCTCCTTAAGATTATTAATTCGTACAGAATTAGGAAACCCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTGGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTACCCCCCTCCTTAATATTATTAATTTCAAGAAGAGTTGTAGAAAATGGTGCAGGTACAGGATGAACCGTATACCCTCCTCTATCTTCTAACATTGCCCATCAAGGCTCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATGCGAATTAAAAATATATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACAGCTTTACTGTTACTTTTATCATTGCCTGTTTTAGCCGGAGCTATCACAATACTTCTTACTGATCGAAACTTAAATACTTCATTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 596–597 (genitalia Fig. 1365–1367), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA: Darien | Cana 1550m | 6.IV.1983 | leg. G.B.Small ], [ DNA sample ID: | NVG-19023F11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22036A04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–53 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532863 ], and one red [ HOLOTYPE ♂ | Lychnuchus (Enosis) | philos Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Panama: Darién Province, Cana, elevation 1550 m.

Etymology.

The name removes the negating prefix a- from its sister species epithet aphilos making it shorter to indicate more northern distribution of the new species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Mit albitornus Grishin, new species

https://zoobank.org/CD65D856-3DE2-4E7D-A05E-46651DD74640

(Fig. 17 part, 598–601, 1368–1373)

Definition and diagnosis.

Genomic analysis of specimens from the Amazonian region placed in the USNM collection together with Cobalus virbius (Cramer, 1777) (type locality in Suriname) reveals that they belong to the genus Mit Grishin, 2022 (type species Mnasitheus badius Bell, 1930) and are not closely related to any known species (Fig. 17). Therefore, they represent a new species that keys (incompletely) to C. virbius (K.22.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: brown wings with a white hindwing tornus above and white fringes in the posterior part of the hindwing on both sides; a cream-white distal third of the ventral hindwing with brown spots fused into a band along the outer margin except the tornal area which is white; and male genitalia characteristic of Mit with a terminally bifid harpe that has broad nearly triangular lobes and is fused with the ampulla. This species is not cryptic and is reliably identified by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly276890.6.3:T57C, aly525.42.2:G240A, aly216.2.1:T135G, aly216.2.1:T175C, aly3712.2.6:C753T; and COI barcode: T157C, C220G, A238C, T457C, A556G.

Barcode sequence of the holotype.

Sample NVG-18112A10, GenBank PV972634, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTACTAATTCGTACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATCATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCGCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTACCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTCTCTCTTCTAATATTGCTCATCAAGGTTCTTCAGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAACTTTATTACTACAATCATTAATATACGAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTGTTAGCAGGTGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGGGGAGATCCTATTCTTTATCAACACTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 598–599, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ ECUADOR: Napo Prov | 4 km Tena–Pano Rd. | 1O 02’S, 77 O 50’W | 27 Sept 1990 600m | DH Ahrenholz leg | SS Nicolay curator ], [ DNA sample ID: | NVG-18112A10 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531357 ], and one red [ HOLOTYPE ♀ | Mit albitornus | Grishin ]. Paratypes: 5♂♂ and 5♀♀: 1♂ NVG-18098F11, H26819 French Guiana, M. Benmesbah leg. [BHC]; Ecuador, Napo: data as the holotype except as specified: 1♀ NVG-23122C01 25-Sep-1990 and 1♂ NVG-23121D03, genitalia NVG241121–54 (Fig. 600–601, 1368–1370); 1♂ NVG-23122A08 Puerto Napo, 650 m, 7-Nov-1988, genitalia NVG241121–54, S. S. Nicolay leg. [USNM]; 14 km E of Puerto Napo, 470 m, −1.050, −77.683, S. S. Nicolay leg. [USNM]: 1♂ NVG-23122B11 29-Sep-1991 and 1♀ NVG-23122B12 6-Oct-1991; 1♀ NVG-23122C02 Jatun Sacha Biological Station, 450 m, −1.067, −77.600, 4-Oct-1991, S. S. Nicolay leg. [USNM]; and 1♀ NVG-21078E04 (leg, DNA sequenced), NVG-23059D01 (abdomen, DNA stored) Napo, Río Napo jct. with Río Misahualli, Misahualli Amazon Lodge, 400 m, GPS −1.0344, −77.6633, 5–12-Sep-1998, T. C. Emmel leg., genitalia NVG241018–09 (Fig. 1371–1373) [MGCL]; and Peru, Madre de Dios Region, 30 km SW of Puerto Maldonado, 300 m, S. S. Nicolay leg. [USNM]: 1♀ NVG-23122A09 1-May-1984 and 1♂ NVG-23122A10 29-Oct-1984.

Type locality.

Ecuador: Napo Province, km 4 of Tena-Pano Road, elevation 600 m, GPS −1.033, −77.833.

Etymology.

The name refers to the whitish tornal area of hindwing and is treated as a noun in apposition.

Distribution.

The Amazonian region.

Callimormus turnus Grishin, new species

https://zoobank.org/E965EDD6-3A34-4836-9533-E488CE133B00

(Fig. 17 part, 602–605, 1374–1375)

Definition and diagnosis.

Genomic analysis of specimens from Mexico initially identified as Callimormus saturnus (Herrich-Schäffer, 1869) (type locality in Venezuela) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 3.2% (21 bp), and therefore they represent a new species. This new species keys to C. saturnus (J.2.8) in Evans (1955) and was included by him in this species, but differs from it and other relatives by the following combination of characters: forewing yellow spots are typically smaller and with more diffuse margins and no spot in the discal cell; the ventral side usually has magenta rather than yellow tint; the discal hindwing band is conspicuous and more angled in the middle; the harpe is strongly rounded along the ventroposterior margin, slightly bulging posteriad and concave before the dorsal process of the harpe, which is blade-shaped, as long as the harpe width, overlaps with the ampulla; and the ampulla is strongly expanded posterodorsad (more so than in relatives), lobe-like, and protrudes dorsad beyond the harpe process. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly707.12.5:C54T, aly1987.1.3:A904C, aly1987.1.3:A864G, aly1651.8.4:T123C, aly1651.8.4:A600G; and COI barcode: A88C, A181T, T287C, T400C, A565G.

Barcode sequence of the holotype.

Sample NVG-22057D05, GenBank PV972635, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATACTTGGTACTTCATTAAGTTTATTAATTCGTACAGAATTAGGAAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTGACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTCTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATACTTCCACCATCTTTAATACTTCTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCTCATCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCCTTACATCTTGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTCATTACTACAATTATTAATATGCGAGTTAGAAATCTTTCTTTTGATCAAATACCATTATTTGTGTGATCAGTAGGAATTACAGCTTTACTTTTACTTTTATCTTTACCAGTATTAGCTGGGGCTATTACCATACTCTTAACAGATCGTAATCTTAATACCTCATTTTTTGATCCTGCTGGTGGAGGAGATCCAATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 602–603, bears the following seven rectangular labels (4^th handwritten, others printed with handwritten text shown in italics), six white: [ MEXICO: | Tamaulipas: | Sierra Cucharas | Quintero cave ], [ coll. | 20 Jan 1974 | Roy O. Kendall | & C. A. Kendall ], [ CHROMOSOMES: | Kendall Log- | H-23 -M | N=none co. ], [ Callimormus ♂ | saturnus | (H-S.) | det.H.A. Freeman ], [ HESPERIIDAE, | Hesperiinae: | Callimormus | saturnus | (Herr.-Schaf., 1869) | det. R. O. Kendall | ♂ M. & B. No. 128 ], [ DNA sample ID: | NVG-22057D05 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Callimormus | turnus Grishin ]. Paratypes: 2♂♂ and 1♀ from Mexico: 1♂ NVG-19012F10 (leg, DNA sequenced), NVG-22057D04 (abdomen, DNA stored) Tamaulipas, Ciudad Mante, Los Arcos Ct., 18-Dec-1973, Roy O. Kendall and C. A. Kendall leg., genitalia NVG241121–55 (Fig. 1374–1375) [TAMU]; 1♀ NVG-22108B09, CASENT 8568652 Nayarit, 5 mi S of Matanchen (v. San Blas), 26-Dec-1976, C. D. MacNeill leg. [CAS] (Fig. 604–605); and 1♂ NVG-19012F09, TAMUICEGR-0055 Jalisco, Puerto Vallarta, 29-Dec-1991, Andrew D. Warren leg. [TAMU].

Type locality.

Mexico: Tamaulipas, Sierra Cucharas, Quintero cave.

Etymology.

The name is formed from its sister species epithet saturnus truncated to indicate a more northern distribution of this species. The name is treated as a noun in apposition.

Distribution.

Widely distributed throughout Mexico.

Callimormus saturnicus Grishin, new species

https://zoobank.org/E38FE7F4-CEE3-40D5-9123-257E0B751987

(Fig. 17 part, 606–607, 1376–1377)

Definition and diagnosis.

Genomic analysis of a specimen from Mato Grosso, Brazil initially identified as Callimormus saturnus (Herrich-Schäffer, 1869) (type locality in Venezuela) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 3% (20 bp), and therefore it represents a new species. This new species keys to C. saturnus (J.2.8) in Evans (1955) and was included by him in this species, but differs from it and other relatives by the following combination of characters: forewing pale spots are more orange than yellow, larger and the discal spot is present; the ventral hindwing is mostly nonpatterned tan, finely striated and has a weakly developed diffuse central darker spot; the harpe is curved and rounded along the ventroposterior margin, not bulging posteriad and only slightly concave before and after the central small tooth directed posteriad; and the dorsal process of the harpe is blade-shaped, as long as the harpe width, overlaps with the ampulla, which is triangular and distinctly shorter than the harpe process. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1931.14.8:C60T, aly660.1.2:T60C, aly536.173.1:C142A, aly26.19.3:A138G, aly1432.8.1:A63G, aly6370.6.2:C196C (not T), aly423.16.4:T357T (not A), aly904.16.5:A18A (not T), aly904.16.5:T72T (not A), aly4456.14.11:G63G (not C); and COI barcode: T55C, A88A, T292C, A556G, T619A.

Barcode sequence of the holotype.

Sample NVG-19016G08, GenBank PV972636, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATACTTGGTACTTCATTAAGCTTATTAATTCGTACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCACCATCTTTAACACTTTTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCCCCCCTTTCTTCTAATATCGCCCATCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACCACAATTATCAATATACGAGTTAGAAATCTTTCTTTTGATCAAATACCTTTATTTGTATGATCAGTAGGAATTACAGCTTTACTTTTACTTTTATCTTTACCAGTGTTAGCTGGAGCTATTACTATACTTTTAACAGATCGTAATCTTAATACCTCATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 606–607 (genitalia Fig. 1376–1377), bears the following six printed rectangular labels, five white: [ BRASIL: Mato Grosso | Diamontino,350–400m | Alto Rio Arinos | 14°13’S 56°12’W | 3 February 1992 | Leg. E. Furtado ], [ DNA sample ID: | NVG-19016G08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035D11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–56 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532351 ], and one red [ HOLOTYPE ♂ | Callimormus | saturnicus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Mato Grosso, Diamontino, Alto Rio Arinos, elevation 350–400m, GPS −14.2167, −56.2000.

Etymology.

The name is formed from its sister species epithet saturnus made longer to indicate a more southern distribution of this species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Mato Grosso, Brazil.

Lento tolus Grishin, new species

https://zoobank.org/CA91869C-810A-449D-86CF-0884518BB90B

(Fig. 17 part, 608–609, 1378–1379)

Definition and diagnosis.

Genomic analysis of a specimen from French Guiana initially identified as Lento lotus (Bell, 1947) (type locality in Brazil: Rio de Janeiro) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 6.5% (43 bp), and therefore it represents a new species. This new species keys (incompletely) to Lento flavocostata (Plötz, 1884) (L.3.10) in Evans (1955), which he misidentified and is L. lotus, but differs from it and other relatives by the following combination of characters: more extensive orange-yellow pattern above; three costal spots between the basal ray and the apex; less extensive orange-yellow pattern beneath, e.g., the forewing discal band is narrower and the elongated brown spot from the discal cell and beyond is not broken into two spots; the harpe is terminally rounded not pointed; and the process of the ampulla is longer than the valva and about two times longer than the harpe, narrower, terminally pointed. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.107.1:T126A, aly168.11.1:G147A, aly706.5.6:T459C, aly1283.26.2:T267C, aly2101.8.1:A585G, aly1603.59.2:C91C (not A), aly3016.3.1:T60T (not G), aly6847.3.6:C162C (not T), aly5715.3.18:G54G (not T), aly537.9.3:C45C (not T); and COI barcode: T38C, T127C, T358C, T382A, G468A.

Barcode sequence of the holotype.

Sample NVG-21012F01, GenBank PV972637, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATACTAGGTACTTCATTAAGATTATTAATTCGTACTGAACTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCTCCTTCTTTAACACTCTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCCCTTTCATCAAACATTGCACATCAGGGAGCTTCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACCACCATTATTAATATAAAAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTGTATGATCTGTTGGTATTACAGCTTTACTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 608–609 (genitalia Fig. 1378–1379), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Pied Saut. | Oyapok River, | Fr. Guiana. | S. M. Klages, | C. M. Acc. 6173. ], [ March, | 1918 ], [ DNA sample ID: | NVG-21012F01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23108B04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–57 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Lento tolus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

French Guiana: Oyapock River, Piedsaut.

Etymology.

The name is an anagram of the sister species name, L. lotus, and is treated as a noun in apposition. Distribution.

Currently known only from the holotype collected in French Guiana.

Lento amazo Grishin, new species

https://zoobank.org/9EC15F19-0B02-48C3-B595-1250ADDD1383

(Fig. 17 part, 610–611)

Definition and diagnosis.

Genomic analysis of a specimen from the lower Amazonian region initially identified as Lento lotus (Bell, 1947) (type locality in Brazil: Rio de Janeiro) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 4.9% (32 bp), and therefore it represents a new species. This new species keys (incompletely) to Lento flavocostata (Plötz, 1884) (L.3.10) in Evans (1955), which he misidentified and is L. lotus, but differs from it and other relatives by the following combination of characters in males: more extensive orange-yellow areas on both sides of wings, e.g., the central parts of both wings above are orange-yellow, on the forewing with traces of brown rays and a butterfly-shaped brown spot distad of the discal cell; and the ventral forewing is mostly orange-yellow with brown submarginal rectangles in every cell, a brown oblong spot distad of the discal cell and a tripartite brown spot anteriad of it and smaller size with more rounded wings. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly5021.16.7:C63A, aly5021.16.7:A72T, aly862.11.2:A100C, aly862.11.2:G114A, aly128.8.3:A120G, aly363.37.1:A3180A (not C), aly1585.15.2:T804T (not C), aly1585.15.2:T816T (not A), aly4091.5.1:G1287G (not T), aly669.15.1:A2724A (not G); and COI barcode: T91A, A217G, A295T, A538G, T542C.

Barcode sequence of the holotype.

Sample NVG-22091G10, GenBank PV972638, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATATTAGGTACTTCATTAAGATTATTAATTCGTACTGAATTAGGAAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGGGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCTTTAACCCTCCTCATTTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCATTACATTTAGCCGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACCACTATTATTAATATACGAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTGTGTGATCTGTTGGTATTACAGCTTTATTATTGTTACTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGGGATCCTATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 610–611, bears the following four rectangular labels (1^st handwritten, others printed), three white: [ Amaz. inf. | Hnl. ], [ Coll. | Staudinger ], [ DNA sample ID: | NVG-22091G10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Lento amazo | Grishin ]. Interpreting the 1^st label, the holotype was collected by Paul Hahnel (1843–1887) in the lower Amazonian region, most likely in present day Brazil: Pará.

Type locality.

Brazil: Pará.

Etymology.

The name is derived from the type locality in the Amazon and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the lower Amazonian region.

Neotype designation for Apaustus imerius Plötz, 1884

Apaustus imerius Plötz, 1884 was described from an unspecified number of specimens from Brazil (Plötz 1884a). The original description was given as an identification key, and the translation of its last section is: “Fringes reddish-yellow, on the forewings checkered with brown. The band of the forewings runs through cell 1 and along the posterior margin of the discal cell in narrow stripes toward the base; the costal margin is reddish-yellow along two-thirds of its length. Hindwings above reddish-yellow with a brown border. Beneath, the forewings are reddish-yellow in the central area; in the hindwings, the brown ground color appears in partially interrupted stripes, and at the tornus as a larger patch. Thorax above with yellow hairs, abdomen above reddish-yellow with a brown longitudinal stripe.” This species was illustrated by Plötz on the unpublished t[afel]. 765, and Godman’s (1907) copy of it is in the library of BMNH. Moreover, Godman selected a specimen in his collection which, in his opinion, agreed best with Plötz’s original drawing. This specimen was later designated as the holotype of Lento listo Evans, 1955 (type locality unknown). It is unclear why Evans ignored the identification of this specimen as A. imerius and described this taxon as a new species. The original description, Godman’s copy of Plötz’s drawing, and Godman’s specimen, which are consistent with each other, offer a guide to how this species looks.

To better understand the taxonomic identity of A. imerius, we searched for its syntypes in all collections listed in the Acknowledgments section. A particular focus was on the MFNB and ZSMC collections, where the type specimens of many Plötz’s names are preserved. No syntypes were found and we assumed that they were lost. There is an exceptional need for a neotype of A. imerius to define this taxon objectively and to ensure taxonomic stability in the application of this name, because the information available about this taxon from literature and collections is inconsistent and this species has been misidentified by Evans (1955). Because undescribed species are present in the group, a neotype is necessary. We found a specimen that agrees best with the original description, Godman’s copy of Plötz’s drawing of A. imerius, Godman’s specimen, and was identified as A. imerius by Mabille (based on the handwriting on the label). Hereby, N.V.G. designates the male from South America, in RMNH, shown in Fig. 612–613 (DNA sample NVG-22014H01) as the neotype of Apaustus imerius Plötz, 1884.

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of A. imerius, which is necessary because this species was misidentified and due to the presence of cryptic species among its relatives; 75.3.2. The characters to differentiate this taxon from others are stated in the original description and given above and rephrased here: both sides of wings are orange, the dorsal side has widely brown margins, forewing with two arrowhead brown stripes: the larger one through the discal cell with the widest part a bit distad of, and the smaller one posterior to the discal cell from around the middle to the base, the ventral side has brown stripes and spots between veins in the submarginal area, and on the hindwing over the entire wing, also with larger brown spots past the forewing discal cell and around the tornus on both wings; 75.3.3. The neotype specimen is a male bearing the following four white labels (first two handwritten, others printed; 1^st round, others rectangular): ( vWalchr. | Am. mér. ), [ Padraona | imerius | Pl.765. ], [ Museum | Leiden ], and [ DNA sample ID: | NVG-22014H01 | c/o Nick V. Grishin ], and shown in Fig. 612–613. Judging from the handwriting on the identification label, it was written by P. Mabille, referring to the unpublished Plötz’s drawing 765; 75.3.4. We failed to find syntypes of A. imerius among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list), in particular, MFNB and ZSMC, where most Plötz’s types are preserved, and no syntypes have been reported in literature; therefore, we believe that they were lost; 75.3.5. The neotype closely agrees with the original description of A. imerius in all characters, as evidenced by comparing the neotype shown in Fig. 612–613 with the characters of this taxon listed above; 75.3.6. The neotype is from South America, which becomes the new type locality, and the original type locality was Brazil, which is in South America. The type locality will be further refined by genomic sequencing of additional specimens from better defined localities and is most likely to be in Brazil: Rio de Janeiro as evidenced by another historical specimen of this species collected there (Fig. 17); 75.3.7. The neotype is in the collection of the Naturalis Biodiversity Center, Leiden, Netherlands (RMNH). The COI barcode sequence of the neotype, sample NVG-22014H01, GenBank PV972639, 658 base pairs, is:

AACATTATATTTTATCTTTGGAATTTGGGCAGGAATATTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTGGTCCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGAATATTACCCCCCTCATTAATAATTTTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACAGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTTCTAATTTATCTTTTGATCAGATACCTTTATTTGTTTGATCAGTTGGTATCACAGCATTACTTTTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGACCCCGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Lento listo Evans, 1955 is a junior subjective synonym of Lento imerius (Plötz, 1884)

Evans (1955) misidentified Lento imerius (Plötz, 1884) (type locality in Brazil) and re-described it under the name Lento listo Evans, 1955 (type locality not given) selecting as its holotype the specimen that Godman (1907) identified as the closest match in his collection to the original, and now lost, Plötz’s drawing of Apaustus imerius. Images of the L. listo holotype photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The holotype was identified as “imerius, Plotz” by Godman and bears a label “Compared with Plotz’s drawing of imerius, Plötz”, which he placed on specimens selected for the best agreement with Plötz’s drawings. Above, we agreed with Godman’s conclusion that this species is most likely to be Plötz’s L. imerius and selected its neotype accordingly. Therefore, we propose that Lento listo Evans, 1955, new synonym, is a junior subjective synonym of Lento imerius (Plötz, 1884).

Lento flecha Grishin, new species

https://zoobank.org/687DE1BA-9ECF-4647-853A-35BF251E6F6B

(Fig. 17 part, 614–615, 1380–1381)

Definition and diagnosis.

Genomic analysis of specimens from southeastern Peru initially identified as Lento imerius (Plötz, 1884) (type locality in Brazil) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 9.5% (63 bp), and therefore they represent a new species. This new species keys to L. imerius (L.3.8) in Evans (1955), which he misidentified, and is this species. Therefore, Evans’s key gives diagnostic characters for it, summarized here as follows: orange-yellow wings on both sides; the dorsal forewing is with a broad brown border, an arrowhead spot from it through the discal cell narrowing basad, and a ray below the discal cell; the dorsal hindwing is with a narrow brown border, wider towards the tornus and brown costal area; the ventral forewing has submarginal brown streaks in every cell, a large tornal spot, a streak from and distad of the discal cell, smaller streaks around it, and a brown area below the discal cell towards the base; the ventral hindwing is with dark streaks and rays in most cells. This species is not cryptic and is diagnosed reliably by its phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly4305.15.10:A255C, aly322.14.2:T418C, aly275184.4.5:T48G, aly806.3.1:C127G, aly216.63.1:A99T; and COI barcode: T10C, T46C, A184T, A238C, T428C.

Barcode sequence of the holotype.

Sample NVG-19016C10, GenBank PV972640, 658 base pairs:

TACATTATACTTTATTTTCGGTATTTGAGCAGGAATATTAGGTACCTCATTAAGTTTATTAATTCGTACTGAACTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAACTGACTAGTTCCTTTAATACTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTGCCCCCTTCATTAACCCTTCTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCGCCCCTTTCCTCTAATATTGCACATCAAGGATCTTCTGTTGATTTGGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATCAGAAATTTATCTTTTGATCAAATACCATTATTTGTATGATCAGTAGGAATTACAGCACTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACCATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTCTTTATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 614–615 (genitalia Fig. 1380–1381), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ PERU 300m | 30 Km S.W. | Pto. Maldonado | 30 Apr ‘84 | S. S. Nicolay ], [ Lento ♂ | imerius | Det. Plotz | S.S. Nicolay ], [ DNA sample ID: | NVG-19016C10 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121B11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–58 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532310 ], and one red [ HOLOTYPE ♂ | Lento flecha | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 1♀: 1♂ NVG-23052F09 Venezuela, Aragua, Portochuelo Pass, Parque Nacional Henri Pittier (Rancho Grande), 24-Jul-1981, L. D. Miller [MGCL]; 1♀ NVG-21046D02 Brazil, Rondônia, 3 km W of Candeias on BR364, 1 km S on dirt road to Rio Preto, 4-Nov-1995, G. T. Austin leg. [MGCL]; and 1♂ NVG-23121B12 Peru, Madre de Dios, 39 km SW of Puerto Maldonado, 21-Oct-1983, S. S. Nicolay leg., genitalia H835 by S. S. Nicolay [USNM].

Type locality.

Peru: Madre de Dios Region, 30 km southwest of Puerto Maldonado, elevation 300 m.

Etymology.

In Spanish, flecha means arrow. Given for arrow-shaped marks, and narrow mark on the dorsal forewing that is the most obvious difference of this species from imerius. The name is treated as a noun in apposition.

Distribution.

Currently known from Venezuela, western Brazil, and southeastern Peru.

Virga cometho (Godman, 1901) is a valid species distinct from Virga virginius (Möschler, 1883)

Mnestheus cometho Godman, 1901 (type locality in Mexico: Tabasco) is regarded as a junior subjective synonym of Virga virginius (Möschler, 1883) (type locality in Suriname). Genomic analysis of the holotype of V. virginius (sequenced as NVG-15036B05) reveals that it is a species sister to Virga austrinus (Hayward, 1934) (type locality in Argentina: Misiones), and that specimens from Mexico initially identified as V. virginius are not monophyletic with it, being in a clade sister to several species of Virga Evans, 1955 (type species Apaustus virginius Möschler, 1883) (Fig. 17). These Mexican specimens agree with the original description of M. cometho and with its syntypes photographed by B. Hermier and shown on the Butterflies of America website (Warren et al. 2024), and we identify them as this taxon. Therefore, we propose that Virga cometho (Godman, 1901), reinstated status, is a valid species distinct from Virga virginius (Möschler, 1883).

Virga radiolius Grishin, new species

https://zoobank.org/FD38F4F3-377F-46A6-8919-624924DB0D4A

(Fig. 17 part, 616–617, 1382–1383)

Definition and diagnosis.

Genomic analysis of specimens from Ecuador and Peru initially identified as Virga virginius (Möschler, 1883) (type locality in Suriname, holotype sequenced as NVG-15036B05) reveals that they are not monophyletic with it and instead form a clade sister to Virga cometho Godman, 1901, reinstated status, (type locality in Mexico: Tabasco) but are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 1.8% (12 bp), and therefore they represent a new species. This new species keys to V. virginius (J.4.1) in Evans (1955) and was likely included by him in it, but differs from it and other relatives by the following combination of characters: darker wings on both sides; the dorsal forewing is with smaller and diffuse orange-yellow spots; the dorsal hindwing is with several long streaks along the veins in the middle; the ventral forewing is without well-developed subapical and submarginal spots, only with two spots near the middle; the ventral hindwing lacks a well-defined band or spots, just with yellow veins; the harpe is with a more pronounced concavity along the ventral margin, a distal knob-like ventral lobe, and a sharp, elongated dorsal tooth merged with the ampulla, which is humped and serrated; and the costa is more strongly concave. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly86.8.5:G60A, aly770.28.3:C144T, aly1468.24.2:T336C, aly1468.24.2:T606C, aly420.39.2:A24T; and COI barcode does not distinguish this species from the one described next.

Barcode sequence of the holotype.

Sample NVG-18012F12, GenBank PV972641, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGGGCAGGATTATTAGGAACATCTTTAAGATTATTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTTATATTAGGGGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTACCCCCTTCATTATCACTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTATATCCTCCTTTATCTTCTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATTTATCATTTGACCAATTACCTTTATTCGTGTGATCTGTAGGTATTACAGCATTATTATTAATTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCCGCTGGAGGGGGAGATCCTATTCTTTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 616–617 (genitalia Fig. 1382–1383), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ ECUADOR Pastaza | Puyo 1000m | 24 May ‘88 | S. S. Nicolay ], [ Virga | virginius | Det. | S.S. Nicolay ], [ DNA sample ID: | NVG-18012F12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035E11 | c/o Nick V. Grishin ], [ genitalia | NVG241121–59 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450315 ], and one red [ HOLOTYPE ♂ | Virga radiolius | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-21044B10 Peru, Loreto, Explorama Lodge, 50 mi downstream Amazon from Iquitos, 20-Mar-1981, J. Y. Miller leg., genitalia SRS-1483 [MGCL].

Type locality.

Ecuador: Pastaza Province, Puyo, elevation 1000 m.

Etymology.

The name refers to the short, separated streaks on dorsal hindwing and is treated as a noun in apposition.

Distribution.

Ecuador and Peru.

Virga marmolius Grishin, new species

https://zoobank.org/0A10A67D-AF0A-4C59-82C8-4A994B31308B

(Fig. 17 part, 618–619, 1384–1385)

Definition and diagnosis.

Genomic analysis of specimens from Rondônia, Brazil initially identified as Virga virginius (Möschler, 1883) (type locality in Suriname, holotype sequenced as NVG-15036B05) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 1.7% (11 bp), and therefore they represent a new species. This new species keys to V. virginius (J.4.1) in Evans (1955) and was likely included by him in it, but differs from it and other relatives by the following combination of characters: larger spots on both sides; the dorsal forewing is with larger and better defined orange-yellow spots, including subapical and submarginal (vestigial); the dorsal hindwing is with a central orange-yellow patch and yellow veins in and around it; the ventral forewing is with well-developed cream subapical and submarginal spots and two orange-yellow spots near the middle; the ventral hindwing is with cream spots and bands and narrow yellow framing along veins; the harpe has a slight concavity along the ventral margin, a broader distal ventral lobe, and a dull, broader dorsal tooth merged with the ampulla, which is humped, broader, and serrated; and the costa is less concave. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1249.4.3:A81G, aly824.21.1:C477T, aly84.88.2:T402C, aly838.7.6:G1062A, aly166.1.2:A819G, aly5264.3.2:A117A (not G), aly2101.11.2:T1122T (not C), aly11945.4.1:G2188G (not C), aly917.4.5:C156C (not T), aly1468.24.2:T336T (not C); and COI barcode does not distinguish this species from the described above.

Barcode sequence of the holotype.

Sample NVG-8018, GenBank PV972642, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGGGCAGGATTATTAGGAACATCTTTAAGATTATTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTTATATTAGGGGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATACTACCCCCTTCATTATCACTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTATATCCTCCTTTATCTTCTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATTTATCATTTGACCAATTACCTTTATTCGTGTGATCTGTAGGTATTACAGCATTATTATTAATTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCCGCTGGAGGGGGAGATCCTATTCTTTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 618–619 (genitalia Fig. 1384–1385), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ BRAZIL:Rondônia | Ariquemes, 150m | 9O36’S 63O16’W | 7Apr 1990 | leg.E. Furtado ], [ DNA sample ID: | NVG-8018 | c/o Nick V. Grishin ], [ genitalia | NVG170208–03 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321858 ], and one red [ HOLOTYPE ♂ | Virga marmolius | Grishin ]. Paratype: 1♂ NVG-24082D05 Brazil, Rondonia, 62 km S Ariquemes, Fazenda Rancho Grande, 180 m, 17-Mar-1989, G. T. Austin leg. [MGCL].

Type locality.

Brazil: Rondônia, vic. of Ariquemes, elevation 150 m, GPS −9.600, −63.267.

Etymology.

The name refers to the marble-like pattern of ventral hindwing with paler blotches and streaks, and is treated as a noun in apposition.

Distribution.

Currently known only from Rondônia, Brazil.

Mnestheus itta Grishin, new species

https://zoobank.org/C8A2D3C6-5010-40CF-A344-5A5D6D0CECF7

(Fig. 17 part, 620–621, 1386–1387)

Definition and diagnosis.

Genomic analysis of specimens from Panama and Colombia initially identified as Mnestheus ittona (Butler, 1870) (type locality in Venezuela) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 6.5% (43 bp), and therefore they represent a new species. This new species keys to M. ittona (J.11.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: yellow-white (not pure white) areas on the ventral hindwing, narrower and more restricted, e.g., narrowing towards and not expanded at the vein 1A+2A by the outer margin in males (but a white ray along 1A+2A broadest at the margin and narrowing towards the white basal area in females), and more restricted yellow-white streak at the base of the inner hindwing margin. In male genitalia, the ampulla is larger and broader, and so is the harpe, which is less rounded terminally. Due to poorly explored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.45.7:A111G, aly2487.8.1:C100G, aly2487.8.1:C120T, aly1585.6.1:A297G, aly580.12.4:G72A; and COI barcode: T56C, T349C, T448C, A470G, T604C.

Barcode sequence of the holotype.

Sample NVG-23124D03, GenBank PV972643, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGTACTTCATTAAGACTATTAATTCGTACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATGTTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGAATATTACCTCCCTCATTAGTGCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTATACCCCCCCCTCTCTTCTAATATTGCTCATCAAGGATCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATCACTACTATCATTAATATACGAGTTTCAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCTGTTGGTATTACAGCCTTATTATTACTTTTATCATTACCTGTTCTAGCAGGTGCTATTACCATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCTGCGGGAGGGGGGGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 620–621 (genitalia Fig. 1386–1387), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ Cerro Campana, I | Panama | V-11–63 | G. B. SMALL ], [ DNA sample ID: | NVG-23124D03 | c/o Nick V. Grishin ], [ genitalia | NVG250720–53 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Mnestheus | itta Grishin ]. Paratypes: 4♂♂ and 3♀♀ in USNM: Panama: data as the holotype, except as indicated: 1♀ NVG-23124D05 11-May-1963, 1♂ NVG-23124D04 30-Aug-1963, 1♀ NVG-23124D06 S. S. Nicolay leg., 1-Feb-1968, and 1♂ NVG-23124D07 17-Mar-1973 and 1♀ NVG-19017E07, USNMENT 01532429 Panamá, Cerro Jefe, 900 m, 9.2333, −79.3667, 13-May-1977m, G. B. Small leg. and Colombia, Meta, Río Negro, S. S. Nicolay leg.: 1♂ NVG-23124D08 2400’, 25-Jan-1972 and 1♂ NVG-23124D09 800 m, 7–15-Jan-1971.

Type locality.

Panama: Panamá Oeste Province, Cerro Campana, approx. GPS 8.6833, −79.9167.

Etymology.

The name is formed from the name of its relative, M. ittona, made shorter to indicate more northern distribution of this species and is treated as a noun in apposition.

Distribution.

Panama and Colombia.

Comment.

Male genitalia of M. ittona NVG-23124D11 from Venezuela: Aragua, Rancho Grande, 1100 m, 19-May-1985, S. S. Nicolay leg., genitalia NVG250720–54 [USNM], are shown for comparison in Fig. 1388–1389.

Mnestheus ittonica Grishin, new species

https://zoobank.org/62BA4C4A-0C08-425E-83B7-D6B88023C223

(Fig. 17 part, 622–623, 1390–1391)

Definition and diagnosis.

Genomic analysis of specimens from southern Peru initially identified as Mnestheus ittona (Butler, 1870) (type locality in Venezuela) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 2.6% (17 bp), and therefore they represent a new species. This new species keys to M. ittona (J.11.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: slightly yellow-tinted (not pure white) and broader pale areas on the ventral hindwing, e.g., narrowing and then expanding towards the vein 1A+2A by the outer margin in males; more extended white streak at the base of the inner hindwing margin, usually occupying the whole cell; and a rounder and more diffuse anterior edge of the dark-brown postdiscal area, which is approximately the same color around the edges of the white area (rusty framing and some traces of rusty spots inside the brown area are present in M. ittona). In male genitalia, the ampulla is intermediate, i.e., smaller than in the new species described above, but larger and wider, and more rounded than in M. ittona, and so is the harpe, which is more angled in lateral view; and the hump on the uncus is dorsally more pointed. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly8937.6.2:A68G, aly3881.2.3:C25T, aly3881.2.3:A179T, aly3616.14.2:T24C, aly1689.9.5:T237C; and COI barcode: A28G, T67C, T472C, T500C, T595C.

Barcode sequence of the holotype.

Sample NVG-23124E03, GenBank PV972644, 658 base pairs:

AACATTATATTTTATTTTTGGTATTTGGGCAGGTATATTAGGTACTTCATTAAGATTATTAATTCGCACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGGGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTACCCCCTTCATTAGTACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTGTACCCCCCACTTTCTTCTAATATTGCCCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCATTGCATTTAGCTGGAATTTCTTCTATTTTAGGAGCCATTAATTTTATTACCACTATCATTAATATGCGAATCTCAAATCTATCTTTTGATCAAATACCCCTATTTGTTTGATCTGTTGGTATTACAGCTTTATTATTACTTTTATCATTACCCGTCTTAGCTGGTGCTATTACTATACTTTTAACTGATCGAAACTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 622–623 (genitalia Fig. 1390–1391), bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PERU:Cuzco, 1050m | Quitacalzón | Cosnipata Valley 4073 | 05-V-2015 Kinyon ], [ DNA sample ID: | NVG-23124E03 | c/o Nick V. Grishin ], [ genitalia | NVG250720–55 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Mnestheus | ittonica Grishin ]. Paratypes: 3♂♂ from Peru [USNM]: Cuzco, Cosñipata Valley: 1♂ NVG-8027 Quitacalzón, 1050 m, 20-May-2012, S. Kinyon leg., genitalia vial NVG170208–12 and 1♂ NVG-23124E04, USNMENT 01586904, San Pedro, 1373 m, −13.05, −71.55, 9–10-Nov-2008, B. Harris leg. and 1♂ NVG-23124E05 no other data but “Peru”, old, coll. W. Schaus.

Type locality.

Peru: Cuzco Region, Cosñipata Valley, Quitacalzón, 1050 m.

Etymology.

The name is formed from the name of its relative, M. ittona, made longer to indicate more southern distribution of this species and is treated as a noun in apposition.

Distribution.

Currently known only from southern Peru.

Comment.

Male genitalia of M. ittona NVG-23124D11 from Venezuela: Aragua, Rancho Grande, 1100 m, 19-May-1985, S. S. Nicolay leg., genitalia NVG250720–54 [USNM], are shown for comparison in Fig. 1388–1389.

Ludens lombens Grishin, new species

https://zoobank.org/1FA8D414-64F3-47BF-B233-68A38005D7B7

(Fig. 17 part, 624–625)

Definition and diagnosis.

In Evans (1955), this new species keys to Ludens ludens (Mabille, 1891) (type locality in Panama, a syntype sequenced as NVG-15036B04) (J.7) that included Ludens petrovna (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) as its synonym; and in the genomic trees (Fig. 17) it is distant sister to Ludens labens Grishin, 2024 (type locality in Panama: Darien) (COI barcodes differ by 6.2%, 41 bp) differing from the latter species by the lack of forewing discal cell spot, the presence of a small yellow spot right below the forewing cell CuA₁-CuA₂ semihyaline spot, more extensive orange scaling around the middle of dorsal hindwing, and more extensive yellow scaling along the veins and the outer margin of ventral forewing, thus being more similar to L. ludens and L. petrovna, from which it differs by the lack of postdiscal spots that connect yellow veins on ventral hindwing (as L. labens). Due to the cryptic nature of this species, unexplored individual variation, and the lack of the abdomen in the holotype, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2954.1.1:G96A, aly2954.1.1:C114T, aly10226.17.12:G216C, aly322.41.27:A85T, aly2612.15.2:A1206G, aly1011.5.3:A188A (not G), aly1011.5.3:T192T (not C), aly4645.7.1:G354G (not A), aly2487.45.1:C124C (not T), aly903.2.3:A75A (not G); and COI barcode: T16C, A55T, A199G, A241T, T421C, A550G.

Barcode sequence of the holotype.

Sample NVG-23081G12, GenBank PV972645, 658 base pairs:

AACATTATATTTTATCTTTGGAATTTGAGCAGGAATATTAGGTACATCATTAAGTATATTAATTCGTACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCAATTATAATTGGTGGGTTTGGTAATTGATTGGTGCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGAATACTACCCCCATCATTAACACTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCACTCTCATCTAATATTGCCCATCAAGGATCATCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCATTGCCTGTTTTAGCAGGAGCTATTACTATACTTTTAACAGACCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGTGACCCCATCTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 624–625, bears the following four rectangular labels (2^nd handwritten, others printed), three white: [ 5406 ], [ Columb. } Karst ], [ DNA sample ID: | NVG-23081G12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Ludens lombens | Grishin ]. The number on the first label is the specimen lot number in the ancient collection catalog in Berlin. This entry 5406 in the catalog lists one specimen from “Columbia” collected by Karsten, referring to German naturalist Karl Hermann Gustav Wilhelm Karsten (1817–1908). Karsten reportedly collected in Colombia in 1852–1856 (Carrillo-Briceño et al. 2016), hence this specimen should have been collected during these years and definitely before 1876, because the collection catalog was handwritten by Carl Heinrich Hopffer (1810–1876). The abdomen is missing in the holotype.

Type locality.

Colombia.

Etymology.

The name is a fusion, [Co]lomb[ia] + [lab]ens: country of the type locality and the sister species name. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Colombia.

Rigga spanglata Grishin, new species

https://zoobank.org/E287C002-309E-4802-9452-5FCB28D86053

(Fig. 17 part, 626–627, 1392–1393)

Definition and diagnosis.

Genomic analysis of a specimen from southern Peru initially identified as Rigga spangla (Evans, 1955) (type locality in Ecuador) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 4% (26 bp), and therefore it represents a new species. This new species keys to “Mnasitheus spangla” (J.32.10) in Evans (1955), but differs from it and other relatives by the following combination of characters: better developed and with sharper edges yellow spots on both sides in the forewing cells R₅-M₁, M₃-CuA₁, and CuA₁-CuA₂ (usually absent or vestigial, at least on the ventral side, in R. spangla); terminally narrower harpe with a longer serrated surface on the posterior side; and a larger, more rounded ampulla. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly172.9.5:A36G, aly1205.1.14:C37A, aly1205.1.14:A46T, aly1281.2.4:T346C, aly525.7.2:T117C, aly2694.17.5:A262A (not C), aly345.15.1:G159G (not A), aly506.8.2:C836C (not T), aly506.8.2:A898A (not G), aly1603.78.2:A305A (not G); and COI barcode: A23G, T59C, A217G, T523C, A622G.

Barcode sequence of the holotype.

Sample NVG-20012E09, GenBank PV972646, 658 base pairs:

AACTTTATATTTTATTTTTGGTGTCTGAGCAGGTATATTAGGAACCTCATTAAGATTACTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTCCCTTTAATATTAGGGGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTATTACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCCGGCACTGGTTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGCACATCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATCAATTTTATTACTACTATTATTAATATACGAGTTAGAAACTTATCATTTGATCAAATACCTCTATTTGTTTGATCAGTAGGTATCACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTCTCACTGACCGAAATTTAAATACTTCTTTTTTTGACCCTGCGGGAGGAGGAGACCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ currently in the Dempwolf collection (Austin, Texas, USA), to be deposited in the Museo de Historia Natural, Lima, Peru (MUSM), illustrated in Fig. 626–627 (genitalia Fig. 1392–1393), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Peru: Cuzco Dept, 1970m | Cosnipata Valley, Rocotal | 13° 06’ S, 71° 34’ W | June 24, 2019 | Leg: W. Dempwolf ], [ DNA sample ID: | NVG-20012E09 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22055B10 | c/o Nick V. Grishin ], [ WRD 15,535 ], and one red [ HOLOTYPE ♂ | Rigga spanglata | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Cuzco Department, Cosñipata Road, Rocotal, elevation 1970 m, GPS −13.1000, −71.5667. Etymology. The name is formed from the sister species epithet spangla made longer for a more southern relative. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in southern Peru.

Rigga bia Grishin, new species

https://zoobank.org/64B986BD-994B-4C91-86B4-BAD3F54F1E50

(Fig. 17 part, 628–629, 1394–1396)

Definition and diagnosis.

Genomic analysis of specimens from western Colombia initially identified as Rigga ira (Butler, 1870) (type locality not given, probably in Venezuela) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 1.7% (11 bp), and therefore they represent a new species. This new species keys (incompletely) to “Parphorus ira” (J.34.11) in Evans (1955), but differs from it and other relatives by the following combination of characters: more evenly colored dorsal hindwing, overscaled with orange over most of its surface and without prominent orange-yellow rays of R. ira; slightly narrower forewing orange-yellow semihyaline spots and ventral hindwing rays along the veins; and similar to R. ira in having a more prominent (but narrower) ray from the base of the hindwing along the vein M₁. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly686.3.6:C95G, aly536.117.1:A714G, aly536.117.1:G727A, aly276558.19.1:A48C, aly276558.19.1:G475A, aly235.7.6:C48C (not T), aly998.4.8:A992A (not G), aly998.4.8:A1004A (not T), aly1370.5.2:A176A (not C), aly14286.1.2:T152T (not G); and COI barcode: T59T, T169A, T212T, C581C, T610T.

Barcode sequence of the holotype.

Sample NVG-21047G02, GenBank PV972647, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTATATTAATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCCCTTATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATGCTTCCCCCTTCTTTAACACTTTTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGTACTGGTTGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCTCATCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCCCTTCATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAACTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTCTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGTGGAGGAGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 628–629 (genitalic valva Fig. 1394), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ COLOMBIA: Valle del Cauca; | Rio Cali 1500 m. | 11 / I /1976 | No.C H-1372 Coll. | by S.R. y L.M. Steinhauser ], [ Parphorus auristriga ? | Draudt ♂ | Det: S.R.Steinhauser ], [ A. C. Allyn | Acc. 1976–3 ], [ Genit. Prep. | SRS-1622 ], [ DNA sample ID: | NVG-21047G02 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Rigga bia | Grishin ]. Paratype: 1♂ NVG-24073A08 the same data as the holotype, genitalia NVG241111–33 (Fig. 1395–1396).

Type locality.

Colombia: Valle del Cauca, Río Cali, elevation 1500 m.

Etymology.

The name is derived from the country of the type locality: [Colom]bia. The name is treated as a noun in apposition.

Distribution.

Currently known only from the type locality in western Colombia.

Subtribe Anthoptina A. Warren, 2009

Racta iria Grishin, new species

https://zoobank.org/9D7A0E8E-04F3-4C01-8ECE-14468299AA0F

(Fig. 17 part, 630–631, 1397–1398)

Definition and diagnosis.

Genomic analysis of a specimen from northern Ecuador initially identified as Racta chiria Evans, 1955 (type locality in Peru: Chirimayo) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 3.2% (21 bp), and therefore it represents a new species. This new species keys to R. chiria (I.14.4) in Evans (1955), but differs from it and other relatives by the following combination of characters in females: brown above with orange-yellow postdiscal bands on both wings narrower than the brown area distad of them towards the outer margin; a discal cell spot on the hindwing and a rusty orange area darker than the bands along the costa from the base to the end of the vein R₁ and at the base of the forewing; on the hindwing upperside, the vein 1A+2A is narrowly orange yellow from the postdiscal band to the outer margin; the bands, the spots, and the area are expressed on the ventral side, which has more developed rusty orange scaling through the forewing apical third and over the entire hindwing; the hindwing has darker brown spots in an irregular discal band and extensive dark-brown overscaling towards the tornus mostly in the cell 1A+2A-3A on the ventral side. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly349.1.1:A132T, aly349.1.1:A156G, aly536.160.1:A42G, aly536.160.1:G73A, aly412.4.1:G63A, aly499.10.2:G210G (not A), aly349.18.2:A195A (not C), aly1849.7.1:G66G (not A), aly1454.3.7:C123C (not A), aly725.19.3:G93G (not A); and COI barcode: T133C, T172C, A208G, T400C, T601C.

Barcode sequence of the holotype.

Sample NVG-18012B01, GenBank PV972648, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGATTGCTTGGAACTTCATTAAGATTACTAATTCGAACAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATCGTAACAGCCCATGCTTTCATTATAATTTTTTTTATAGTAATGCCAATCATAATTGGAGGTTTTGGAAACTGATTAGTTCCTTTGATACTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATGCTTCCCCCATCATTAACATTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATCGCACACCAAGGTTCTTCTGTGGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCAATCAATTTCATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCAGTAGGAATCACAGCTTTACTATTACTCTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAACACTTCTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 630–631 (genitalia Fig. 1397–1398), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR Napo | Baeza 2000m | 6 July ‘80 | S. S. Nicolay ], [ DNA sample ID: | NVG-18012B01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22035B10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–60 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450266 ], and one red [ HOLOTYPE ♀ | Racta iria | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Ecuador: Napo Province, Baeza, elevation 2000 m.

Etymology.

The name is formed from the name of its sister species R. chiria truncated to indicate its more northern distribution. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of northern Ecuador.

Subtribe Falgina Grishin, 2019

Lectotype designation for Mnasinous patage Godman, 1900

Mnasinous patage Godman, 1900 was described from three specimens from Mexico (Veracruz) and Panama (Godman 1900c). To stabilize nomenclature, clarify the type locality, and define the name M. patage objectively, N.V.G. hereby designates the syntype in the BMNH collection that, according to its label, was illustrated by Godman (1900c), and bears the following six printed labels (first two round, others rectangular; first two with a red circle on one side, others white) and a genitalia minislide No. 851 pinned together with labels: ( Type | H.T. ), ( Type ) and on the other side handwritten ( H | 2206 ), [ Orizaba | H. H. S. & F. D. G. | Dec. 1887. ], [ Sp. figured. ], [ B.C.A.Lep.Rhop. | Mnasinous | patage, | Godm. ], and [ Godman-Salvin | Coll. 1914.—5. ], as the lectotype of Mnasinous patage Godman, 1900. According to its label, the lectotype was collected by H. H. Smith and F. D. Godman, but according to the original description, the collectors were F. D. Godman and H. J. Elwes (Godman 1900c). The lectotype has scales fully removed from the right forewing, lacks its right antenna, and has some scratches on the left hindwing. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of M. patage becomes Mexico: Veracruz, Orizaba, 4029 feet, approx. GPS 18.85, −97.10 (Selander and Vaurie 1962).

Mnasinous (Mnasinous) patagopsis Grishin, new species

https://zoobank.org/10B184A8-1371-4A4B-8FA3-893D7130ACED

(Fig. 17 part, 632–633, 1399–1400)

Definition and diagnosis.

Genomic analysis of specimens from Costa Rica and Panama initially identified as Mnasinous (Mnasinous) patage Godman, 1900 (type locality in Mexico: Veracruz) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 6.2% (41 bp), and therefore they represent a new species. This new species keys to Mnasinous patage (J.31) in Evans (1955) and was likely included by him in this species, but differs from it and other relatives by the following combination of characters in males: a slightly more developed anal lobe; the dorsal tooth of the harpe is directed dorsad, not anterodorsad; the concave surface anteriad of the tooth towards the ampulla is longer; and the ampulla is rounded, without a tooth. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1155.7.2:A272G, aly1155.7.2:T495A, aly640.37.1:A171G, aly640.37.1:A186G, aly577.3.6:A219T; and COI barcode: T56C, A85T, T118C, T232C, A268G.

Barcode sequence of the holotype.

Sample NVG-8030, GenBank PV972649, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACCTCATTAAGACTTCTAATTCGAACAGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGTAACTGATTAGTACCTTTAATGCTAGGAGCCCCAGATATAGCCTTCCCTCGAATAAATAATATAAGATTTTGAATATTGCCCCCATCCCTAACATTATTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCGCCCCTTTCCTCTAATATTGCTCATCAAGGATCCTCTGTAGATTTAGCAATTTTCTCTCTTCACTTAGCTGGAATTTCTTCCATTTTAGGAGCTATCAATTTTATTACTACAATTATTAATATACGAATTAGAAATATATCTTTTGATCAAATACCTTTATTTGTTTGATCCGTTGGTATTACAGCATTATTATTACTTTTATCTTTACCAGTCTTAGCAGGAGCTATTACAATACTTCTTACAGATCGAAATTTAAATACTTCTTTTTTTGACCCTGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 632–633 (genitalia Fig. 1399–1400), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Panama:Chiriqui | Volcan Barú 4200’ | 21.III.1976 | G.B. Small ], [ DNA sample ID: | NVG-8030 | c/o Nick V. Grishin ], [ genitalia | NVG170208–15 | Nick V. Grishin ], [ USNMENT | {QR Code} | 01321870 ], and one red [ HOLOTYPE ♂ | Mnasinous (Mnasinous) | patagopsis Grishin ]. Paratype: 1♂ NVG-21047C03 Costa Rica, Alajuela Province, 2.8 km S of Cinchona on Ruta 9, 27-Sep-1987, G. T. Austin leg., genitalia SRS-3098 [MGCL].

Type locality.

Panama: Chiriquí Province, Volcán Barú, elevation 4200’.

Etymology.

The name is formed from the name of its sister species, M. patage, by using the suffix -opsis that means likeness and resemblance. The name is made longer to indicate a more southern distribution of the new species and is treated as a noun in apposition.

Distribution.

Costa Rica and Panama.

Thargella (Volus) amazella Grishin, new species

https://zoobank.org/1D70BEC7-F8E1-4454-A87E-58EC2A635ED2

(Fig. 17 part, 634–635, 1401–1406)

Definition and diagnosis.

Genomic analysis of specimens from the Amazonian region initially identified as Thargella (Volus) volasus (Godman, 1901) (type locality in Panama: Chiriquí) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore they represent a new species. This new species keys to Methionopsis dolor Evans, 1955 (type locality in Colombia: Cauca) (J.8.2) in Evans (1955), which is regarded as a junior subjective synonym of T. volasus, but differs from it and other relatives by the following combination of characters: slightly broader and rounder wings; slightly darker ventral side of hindwing towards the inner margin and tornus; evenly curved, claw-shaped harpe narrowing from the base to the pointed end directed dorsad, slightly serrated at the distal margin and more broadly separated from the ampulla; and the ampulla is strongly expanded, rounded, lobe-like and extends dorsad past the harpe. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly86.9.12:A126G, aly276378.7.3:T127C, aly2508.17.7:G342A, aly311.5.3:C435T, aly2178.9.13:G57A; and COI barcode: T59C, T187C, C271T, T364C, T424C.

Barcode sequence of the holotype.

Sample NVG-19099G03, GenBank PV972650, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACCTCATTAAGATTACTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTCGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAACAATATAAGATTTTGAATATTACCTCCTTCTTTAACATTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCACCTCTTTCATCTAATATTGCCCATCAAGGATCTTCAGTGGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCCATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATAATATTTGATCAAATACCATTATTTGTTTGATCAGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCGGGAGCTATTACTATACTTCTTACTGATCGTAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 634–635 (genitalia Fig. 1401–1403), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ PERU 300m | 30 Km S.W. | Pto. Maldonado | 2 May '84 | S. S. Nicolay ], [ Methionopsis | dolor ♂ | Det. E. | S.S. Nicolay ], [ DNA sample ID: | NVG-19099G03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121C01 | c/o Nick V. Grishin ], [ genitalia | NVG24112161 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01589987 ], and one red [ HOLOTYPE ♂ | Thargella (Volus) | amazella Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 1♀: 1♀ NVG-19017C01, USNMENT 00178628 Guyana, Eastern Kanuku Mts., Two Hat Mountain south slope summit, 850–1200’, GPS 3.1133, −59.0983, 21–28-Sep-2000, S. Fratello et al. leg. [USNM]; 1♂ NVG-21127D09 Brazil, Pará, old [ca. 1900] [MFNB]; and 1♂ NVG-19099G02, USNMENT 01589986 Ecuador, Pastaza, Puyo, 1000 m, 8-Dec-1972, S. S. Nicolay leg., genitalia H564 (Fig. 1404–1406) [USNM].

Type locality.

Peru: Madre de Dios Region, 30 km southwest of Puerto Maldonado, elevation 300 m.

Etymology.

The name indicates the Amazonian range of this species and is treated as a noun in apposition.

Distribution.

Amazonian region.

Synapte sala Grishin, new species

https://zoobank.org/719CDFA0-BD9A-4F57-8585-40C299D6D1D9

(Fig. 17 part, 636–637, 1407–1408)

Definition and diagnosis.

Genomic analysis of specimens from Mexico initially identified as Synapte salenus salenus (Mabille, 1883) (type locality in Colombia) reveals that they are not monophyletic with it, but are sister to Synapte silna Evans, 1955 (type locality in Mexico: Guerrero) in the nuclear genome tree and are genetically differentiated from others at the species level (Fig. 17); e.g., their COI barcodes differ by 2.1% (14 bp), and therefore they represent a new species. This new species keys to S. salenus salenus (I.2.4(b)) in Evans (1955) and was included by him in this taxon, but differs from it and other relatives by the following combination of characters: more diffuse ocherous overscaling in the postdiscal area of the forewing without golden-ochre diffuse spots of S. silna; the ventral hindwing discal dark-brown band is narrower; the ventral forewing postdiscal ocherous areas of S. silna (and, to a lesser extent, of S. salenus) are not expressed; striations on the ventral hindwing are finer than in S. salenus; narrower harpe more strongly curved dorsad; the concave area between the harpe and the ampulla is longer; and the ampulla has a broad triangular tooth-shaped process narrowing to a point and with serrated dorsal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly28779.7.3:A231G, aly822.47.3:A126G, aly822.47.3:C132T, aly822.47.3:A141T, aly1603.84.4:A192G; and COI barcode: A85A, T163C, A325G, T508A, A517G.

Barcode sequence of the holotype.

Sample NVG-10652, GenBank PV972651, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGATTGTTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATACTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCTTTAACATTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACGGGATGAACAGTATACCCCCCTCTTTCTTCTAATATTGCTCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATCTCCTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGTAATATATCATTTGATCAAATACCATTATTTGTATGATCAGTGGGAATTACAGCTTTATTACTACTTTTATCATTACCTGTATTAGCTGGGGCTATTACAATACTTCTTACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 636–637 (genitalia Fig. 1407–1408), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ ] no text on this label, left antenna is glued to it, [ MEXICO: | SanLuis Potosi | El Naranjo, Thomas Blagg’s | property along Rio Salto ], [ Coll. | 21 Feb 1976 | Roy O. Kendall | and C. A. Ke ], [ HESPERIIDAE, | Hesperiinae: | Synapte salenus | (Mabille, 1883) | ♂ det. R. O. Kendall | M. & B. No. 126] ], [ DNA sample ID: | NVG-10652 | c/o Nick V. Grishin ], [ genitalia | NVG180106–69 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Synapte sala | Grishin ]. Paratypes: 2♂♂ from Mexico [TMMC]: 1♂ NVG-20062E04 Puebla, Patla, 1800’, 5-Apr-1990, J. Kemner leg. and 1♂ NVG-20062E05 Veracruz, 4.5 km SW of Omealca, 6-Aug-1981, C. J. Durden leg.

Type locality.

Mexico: San Luis Potosí, El Naranjo, Thomas Blagg’s property along Río Salto.

Etymology.

The name is formed from the sister species name, S. salenus, made shorter to indicate more northern distribution of this new species. The name is treated as a noun in apposition.

Distribution.

Currently known from Mexico.

Synapte oaxala Grishin, new species

https://zoobank.org/A010DCBB-FFF7-408B-BA1E-162609303678

(Fig. 17 part, 638–639, 1409–1410)

Definition and diagnosis.

Genomic analysis of a specimen from Oaxaca, Mexico, initially identified as Synapte salenus salenus (Mabille, 1883) (type locality in Colombia) reveals that it is genetically differentiated at the species level (Fig. 17); e.g., their COI barcodes differ by 3.8% (25 bp), and therefore it represents a new species. This new species keys to S. salenus salenus (I.2.4(b)) in Evans (1955), but differs from it and other relatives by the following combination of characters: only vestigial ocherous overscaling in the postdiscal area of the forewing without golden-ochre diffuse spots of S. silna; the ventral hindwing discal dark-brown band is medium in width and its costal triangle is shorter; the ventral forewing postdiscal ocherous areas of S. silna (and, to a lesser extent, of S. salenus) are not expressed and the forewing is nearly the same brown color throughout; striations on the ventral hindwing are similar to those in S. salenus; broader harpe more strongly curved dorsad with expanded and rounded posterior margin; the concave area between the harpe and the ampulla is shorter; and the ampulla has an even broader triangular tooth-shaped process narrowing to a point slightly turning dorsad and with serrated dorsal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.93.3:T669C, aly525.93.3:C691A, aly5294.20.2:A348T, aly145.18.3:A1031G, aly145.18.3:A1204C, aly276636.2.3:A1483A (not G), aly276636.2.3:G1524G (not A), aly383.11.2:T147T (not G), aly383.11.2:A172A (not C), aly423.15.3:G48G (not A); and COI barcode: A76G, T197C, A403G, T568C, T586C.

Barcode sequence of the holotype.

Sample NVG-21014G05, GenBank PV972652, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTGGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTCGGAAATTGACTAATTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACATTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCTCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCCCTGCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATATATCATTTGATCAAATACCATTATTTGTTTGATCTGTTGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGGGCCATCACAATACTTCTTACCGATCGAAATTTAAATACTTCATTTTTTGACCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 638–639 (genitalia Fig. 1409–1410), bears the following five rectangular labels (1^st handwritten, others printed), four white: [ Mex:Oaxaca | Sierra Madre del Sur | La Soledad-Buena Vista | 2 Dec.1991-el.6000’ | John Kemner ], [ DNA sample ID: | NVG-21014G05 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23108C03 | c/o Nick V. Grishin ], [ genitalia | NVG241121–65 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Synapte oaxala | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Mexico: Oaxaca, Sierra Madre del Sur, La Soledad-Buena Vista, elevation ~6000’.

Etymology.

The name means sala (or salenus) from Oaxaca and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Oaxaca, Mexico.

Mnasalcas tenapana Grishin, new species

https://zoobank.org/41CEA562-A078-4275-8DD7-8587F0536246

(Fig. 17 part, 640–643, 1411–1412)

Definition and diagnosis.

Genomic analysis of specimens from Ecuador initially identified as Mnasalcas simplicissima (Herrich-Schäffer, 1870) (type locality in Venezuela) reveals that they are genetically differentiated from it at the species level (Fig. 17); e.g., their COI barcodes differ by 4.1% (27 bp), and therefore they represent a new species. This new species keys to “Mnasitheus simplicissima” (J.32.7) in Evans (1955) and may have been included by him in this species, but differs from it and other relatives by the following combination of characters: the thorax and head are with greenish-cupreous scales, otherwise dark brown, nearly black; males with a single minute cream spot near the base of the hindwing cell M₃-CuA₁; females with two or three postdiscal hindwing spots; the dorsal tooth of the harpe is narrower and sharper; and the ampulla is more extended towards the tooth and slightly concave along the dorsal margin. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1405.10.1:A2334G, aly1022.8.1:T579C, aly725.21.2:G53T, aly11945.4.1:C994A, aly11945.4.1:G2320A; and COI barcode: A100T, T355A, T367C, T451C, A508G.

Barcode sequence of the holotype.

Sample NVG-18013A03, GenBank PV972653, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCCCCCGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACAGGTTGAACAGTTTATCCTCCTCTTTCTTCAAATATTGCTCACCAAGGATCTTCTGTTGATTTAGCAATTTTCTCATTACATTTAGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAAAAATATATCATTTGATCAAATACCATTATTTGTGTGATCTGTTGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATCTTAATACTTCCTTTTTTGATCCTGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 640–641 (genitalia Fig. 1411–1412), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR: Napo Prov | 4 km Tena–Pano Rd. | 1O 02’S, 77 O 50’W | 600m 25 Sept 1990 | S S Nicolay leg ], [ DNA sample ID: | NVG-18013A03 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121C02 | c/o Nick V. Grishin ], [ genitalia | NVG241121–66 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450352 ], and one red [ HOLOTYPE ♂ | Mnasalcas | tenapana Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-19019E09, USNMENT 01532597 Ecuador, Napo, km 4 of Tena-Pano Rd., 600 m, GPS −1.033, −77.833, 27-Sep-1990, S. S. Nicolay leg. [USNM] (Fig. 642–643).

Type locality.

Ecuador: Napo Province, km 4 of Tena-Pano Road, elevation 600 m, GPS −1.033, −77.833.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known from north-central Ecuador.

Subtribe Apaustina Grishin, 2019

Ancyloxypha aureata Grishin, new species

https://zoobank.org/0EE8B20D-E942-4565-8965-A828E3A7C410

(Fig. 18 part, 644–647, 1413–1417)

Figure 18.

Phylogenetic trees of selected Hesperiini: Apaustina, Thymelicina, Calpodina (except Calpodes, see Fig. 19), Carystina, and Pericharini inferred from protein-coding regions in a) the Z chromosome, based on 351,648 positions and b) the mitochondrial genome. See Fig. 2 legend for other notations.

Definition and diagnosis.

Genomic analysis of specimens from northwestern Peru initially identified as Ancyloxypha aurea Hayward, 1940 (type locality in Ecuador: Tungurahua) reveals that they are genetically differentiated from it at the species level in the nuclear genome (Fig. 18) (but COI barcodes do not differ), and therefore they represent a new species. This new species keys to A. aurea (M.2.5) in Evans (1955) and was included by his in this species, but differs from it and other relatives by the following combination of characters: paler, with less extensive dark scaling along the margins of both wings, less contrasting ventral hindwing, which in males is uniformly amber without paler veins and rays, the hindwing is darker in females with a central broad paler ray from the base to the outer margin; the harpe is more curved and narrower in the middle, ending in a sharp tooth, the ampulla with a triangular process that is slightly broader and shorter. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly587.8.5:A101G, aly2582.9.6:T2556C, aly17805.1.1:G180T, aly16.3.1:G798A, aly133.4.1:T766A; and its COI barcode does not differ from that of A. aurea.

Barcode sequence of the holotype.

Sample NVG-18012G01, GenBank PV972654, 658 base pairs:

AACTTTATATTTTTTATTTGGAATTTGAGCAGGAATATTAGGTACTTCTCTTAGCTTACTAATTCGTACAGAATTAAGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTCACAGCACATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCACGAATAAATAACATAAGATTTTGAATACTGCCCCCCTCTTTAACACTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCCCTCTCCTCTAATATTGCTCATCAAGGACCTTCAGTTGATTTAGCAATTTTTTCTTTACACTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAACATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTCGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCCGTTTTAGCTGGAGCTATTACTATACTTCT TACTGATCGAAATTTAAATACCTCATTTTTTGATCCAGCAGGAGGGGGAGACCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 644–645 (genitalia Fig. 1413–1415), bears the following six printed rectangular labels, five white: [ PERU: La Libertad | Casmiche, 1950m. | 07° 59’ S, 78° 39’W | 27 September 1999 | Ahrenholz, Robbins, Lamas ], [ DNA sample ID: | NVG-18012G01 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121C04 | c/o Nick V. Grishin ], [ genitalia | NVG241121–67 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450316 ], and one red [ HOLOTYPE ♀ | Ancyloxypha | aureata Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-23121C03 the same data as the holotype (Fig. 646–647, 1416–1417).

Type locality.

Peru: La Libertad Region, Casmiche, elevation 1940 m, GPS −7.9833, −78.6500.

Etymology.

The name is formed from the sister species epithet, aurea, made longer to indicate a more southern distribution of this species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in northwestern Peru.

Subtribe Thymelicina Tutt, 1905

Oarisma (Copaeodes) jeor Grishin, new species

https://zoobank.org/AD74E9D5-3CD6-4FA8-883D-EAEAEC8EBAA9

(Fig. 18 part, 648–649, 1418–1419)

Definition and diagnosis.

Genomic analysis of a specimen from central Brazil initially identified as Oarisma (Copaeodes) jean Evans, 1955 (type locality in Guyana) reveals that it is genetically differentiated at the species level in the nuclear genome (Fig. 18); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore it represents a new species. This new species keys to Copaeodes jean jean (M.3.3(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: wings above with a narrow dark border along the outer margin, broader than in Oarisma (Copaeodes) favor (Evans, 1955) (type locality in Brazil: Paraná), but much narrower than in O. jean; weaker dark overscaling along veins; slightly broader stigma; a weaker central paler ray on ventral hindwing; a nearly straight, only slightly upturned harpe; and an expanded dorsoposteriad ampulla not reaching the end of the harpe and with a concave dorsal margin prior to a nearly straight costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly113.6.1:G902C, aly113.6.1:A1803G, aly2752.3.1:A1167T, aly3001.5.1:T124C, aly3001.5.1:A189T, aly54.4.1:A262A (not G), aly54.4.1:G283G (not A), aly54.4.1:C1631C (not T), aly54.4.1:G2275G (not A), aly798.29.4:T57T (not C); and COI barcode: T82T, C133C, A217G, T415A, T427C, T428C, A484A.

Barcode sequence of the holotype.

Sample NVG-18012G12, GenBank PV972655, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGTACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCCCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATCGGAGGTTTTGGAAATTGATTAGTACCATTAATATTAGGGGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCTCCATCATTAACACTTTTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCTCCCCTTTCATCTAATATTGCTCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATCCTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCTTTATTTGTATGATCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTCTTACAGATCGAAATTTAAACACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTC

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 648–649 (genitalia Fig. 1418–1419), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRAZIL: Mato Grosso | Diamantino, 350–400m | Alto Rio Arinos | 14O13’S 56O13’W | 13.XII.1985 | leg E. Furtado ], [ DNA sample ID: | NVG-18012G12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121C05 | c/o Nick V. Grishin ], [ genitalia | NVG241121–69 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450327 ], and one red [ HOLOTYPE ♂ | Oarisma (Copaeodes) | jeor Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Mato Grosso, Diamantino, Alto Rio Arinos, elevation 350–400 m, GPS −14.2167, −56.2167.

Etymology.

The name is a fusion of species epithets of relatives: je[an] + [fav]or, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in central Brazil.

Subtribe Calpodina A. Clark, 1948

Lectotype designation for Pamphila panoquinoides Skinner, 1891

Pamphila panoquinoides Skinner, 1891 was described from an unstated number of specimens from Key West, Fla. and Texas (Skinner 1891). To stabilize nomenclature, clarify the type locality, and define the name P. panoquinoides objectively, N.V.G. hereby designates the sequenced syntype in the CMNH collection, the male that bears the following three rectangular labels (2^nd red, others white; 1^st handwritten, others printed with handwritten text shown in italics): [ Key West | H.K.M “85 ], [ TYPE No. 7103 | Pamphila | panoquinoides | Henry Skinner ], [ DNA sample ID: | NVG-15095G06 | c/o Nick V. Grishin ], as the lectotype of Pamphila panoquinoides Skinner, 1891. The lectotype is the specimen referred to as “type” and illustrated on Pl. II, Fig. 26 by Skinner (1900). It is the only specimen in the series with the “TYPE” label (there is a female with an “ALLO TYPE” label), and was likely considered by Skinner to represent best his concept of this species. The lectotype has a deep tear from the middle of the outer margin of the left forewing to its middle, introduced after its photograph was published by Skinner (1900). Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of P. panoquinoides becomes USA: Florida, Monroe Co., Key West. The COI barcode sequence of the lectotype, sample NVG-15095G06, GenBank PV972656, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGTACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGAATACTTCCTCCTTCTTTAACTCTATTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTACCCCCCTCTTTCCTCAAATATTGCTCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATCATTAACATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTTGGTATTACAGCTTTATTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Lectotype designation for Pamphila errans Skinner, 1892

Pamphila errans Skinner, 1892 was described from an unstated number of specimens from California and Texas (Skinner 1892). To stabilize nomenclature, clarify the type locality, and define the name P. errans objectively, N.V.G. hereby designates the sequenced syntype in the CMNH collection, the female that bears the following four rectangular labels (3^rd red, others white; 2^nd handwritten, others printed with handwritten text shown in italics): [ Cal. ], [ Dyar ], [ TYPE No. 7102 | Pamphila | errans | Henry Skinner ], [ DNA sample ID: | NVG-15095G09 | c/o Nick V. Grishin ], as the lectotype of Pamphila errans Skinner, 1892. This specimen is the only one in the series with the “TYPE” label and was likely considered by Skinner to represent best his concept of this species. The lectotype is missing its left antenna and has a prominent pinhole near the middle of the discal cell on the left hindwing. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of P. errans becomes USA: California. The COI barcode sequence of the lectotype, sample NVG-15095G09, GenBank PV972657, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGTACCTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTCCCCCGTATAAATAATATAAGATTTTGAATACTTCCTCCTTCTTTAACTCTATTAATCTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTACCCCCCTCTTTCTTCAAATATTGCTCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTCGGTATTACAGCTTTATTATTACTTTTATCTTTACCAGTTTTAGCGGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Panoquina sinasona Grishin, new species

https://zoobank.org/F1E8B37F-81A0-407D-92FD-75E34E1D4B25

(Fig. 18 part, 650–651, 1420–1421)

Definition and diagnosis.

Genomic analysis of specimens from northwestern Mexico initially identified as Panoquina errans (Skinner, 1892) (type locality in California) reveals that they are genetically differentiated from it at the species level (Fig. 18); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore they represent a new species. This new species keys to Panoquina panoquinoides errans (O.2.2(a)) in Evans (1955), but differs from it and other relatives by the following combination of characters: more weakly developed, vestigial, or absent pale spots on the ventral hindwing; a more robust harpe, more strongly bulged ventrad at the base; a larger ampulla broadening towards the harpe; and a more concave costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly6841.12.5:C108T, aly11226.2.1:T314A, aly925.11.9:T312C, aly2101.22.7:G209C, aly2668.2.3:C55T; and COI barcode: T100C or A, A211G, T238C, T340T, C343T.

Barcode sequence of the holotype.

Sample NVG-17068F03, GenBank PV972658, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGTACCTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATGTTAGGAGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGAATACTTCCCCCTTCTTTAACTCTATTAATCTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTCTTTCTTCAAATATTGCTCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCTGTTGGTATTACAGCTTTATTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Colorado State University Collection, Fort Collins, CO, USA (CSUC), illustrated in Fig. 650–651, bears the following six rectangular labels (first two handwritten and others printed, 3^rd yellow, last red, and others white), five white: [ MEX:SINALOA | Mazatlan, 3mi.N. | XI-19–2003 | leg. P.A. Opler ], [ Panoquina | panoquinoides | errans ], [ Barcode of Life | DNA voucher specimen | CSU-CPG-LEP001743 | BOLD ID ABLCU743–09 ], [ CSU_ENT | 1027433 ], [ DNA sample ID: | NVG-17068F03 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Panoquina | sinasona Grishin ]. Paratypes: 2♂♂ and 2♀♀ from Mexico, Sonora: 1♂ NVG-21058D10 playa 1 km E of Bahia San Carlos, eclosed on 19-May-2003 [JPB] and 1♀ NVG-17068F04, CSU_ENT1027432 Guaymas, 2 mi W of San Carlos, beach with Distichlis, 23-Mar-2004, P. A. Opler leg. [CSUC] and Sinaloa, Mazatlán: 1♂ NVG-19013B07 (leg, DNA sequenced) NVG-23068H11 (abdomen, DNA stored) 30-Dec-1990, Andrew D. Warren leg., genitalia NVG241121–70 (Fig. 1420–1421) [TAMU] and 1♀ NVG-21058D11 30-Dec-1974, Jim P. Brock leg. [JPB].

Type locality.

Mexico: Sinaloa, 3 mi north of Mazatlán.

Etymology.

The name is derived from the Mexican states where this species is found: Sina[loa] + Son[or]a. The name is treated as a noun in apposition.

Distribution.

Northwestern Mexico.

Zenis lipas Grishin, new species

https://zoobank.org/C1C6D7CC-36B8-46BA-9490-C78EF8C73E50

(Fig. 18 part, 652–653, 1422–1424)

Definition and diagnosis.

Genomic analysis of a specimen from Mexico initially identified as Zenis minos (Latreille, [1824]) (type locality in Brazil) reveals that they are genetically differentiated at the species level (Fig. 18); e.g., their COI barcodes differ by 6.5% (43 bp), and therefore it represents a new species. This new species keys to Z. minos (O.3.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: shorter subapical (three) and submarginal (one, in cell M₂-M₃) spots on the forewing; the spot in the cell R₅-M₁ is offset distad from the other two subapical spots and does not overlap with them; the hindwing pale band is narrower and with a stronger yellow overcast on the ventral side; the ampulla is larger and protrudes farther dorsad from the dorsal tooth of the harpe; and the tooth is narrower and terminally not as sharp. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.6.2:A269T, aly2096.39.2:T114C, aly8478.6.1:T72G, aly8478.6.1:C86T, aly412.7.1:A1794G, aly927.1.6:A96A (not G), aly1281.13.4:G249G (not A), aly1249.14.7:C2004C (not T), aly26.35.10:C155C (not G), aly294.3.2:T499T (not C); and COI barcode: T25C, A67G, 220A, T322C, T595C.

Barcode sequence of the holotype.

Sample NVG-22056H02, GenBank PV972659, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGGACAGAATTAGGAAACCCTGGCTCTTTAATTGGCGATGATCAAATTTACAATACTATTGTTACAGCACATGCTTTTATCATAATTTTTTTTATGGTAATACCTATTATAATTGGAGGATTCGGAAACTGATTAGTACCTTTAATATTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCTGGCACAGGATGAACCGTATACCCCCCTCTTTCTTCTAATATTGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTATTACTTTTATCCTTACCTGTATTAGCTGGTGCTATTACCATACTATTGACTGATCGAAACTTAAATACATCTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 652–653 (genitalia Fig. 1422–1424), bears the following four printed rectangular labels, three white: [ TA.Xicotencatl.1 | Rio Sabinas | Durden 72362A63 ], [ DNA sample ID: | NVG-22056H02 | c/o Nick V. Grishin ], [ genitalia | NVG241121–71 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Zenis lipas | Grishin ]. The holotype was collected on 27-Dec-1972 (i.e., “72362”: day 362 of 1972, A63 is the collection event referring to this specimen in Durden’s master catalog), and 1 after “Xicotencatl” on the first label is the code for this locality).

Type locality.

Mexico: Tamaulipas, Xicotencatl, 3.5 km southeast of Azteca, Río Sabinas, elevation 130m.

Etymology.

The name is derived rom the Mexican state of the type locality, [Tamau]lipas, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Tamaulipas, Mexico.

Calpodes rostris Grishin, new species

https://zoobank.org/B75FCF07-1C02-42FF-A6CC-6115E0D5FC68

(Fig. 19 part, 654–657, 1425–1426)

Definition and diagnosis.

This new species is a close relative of Calpodes longirostris (Sepp, [1840]) (type locality in Suriname), but is genetically differentiated from it at the species level in the nuclear genome (Fig. 19); e.g., F_st/G_min are 0.22/0.029; however, they are not strongly different in the COI barcode, probably due to introgression, e.g., the holotype is 100% identical, but paratypes differ from the holotype and C. longirostris by 1.1% (7 bp). This new species keys to “Saliana longirostris” (O.14.15) in Evans (1955), but differs from it by the following combination of characters: two (not three) hindwing semihyaline spots (in one paratype, 3^rd small yellowish spot on the dorsal side only), the spot in the cell M₃-CuA₁ is smaller, and the spot between veins M₁ and M₃ is nearly divided into two by the vein M₂; rounder hindwing in males; yellower, more saturated semihyaline spots; a rounder forewing discal cell spot with a shorter upper segment; the basal half of the ventral forewing in males is paler by the costal margin; and the anal area yellowish basal half is brighter colored in males, yellower. Due to cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2612.6.2:G285A, aly2612.6.2:A4011T, aly499.10.6:C159A, aly499.10.6:G201A, aly2012.67.12:C45T; and some specimens can not be identified by the COI barcode due to introgression with C. longirostris.

Barcode sequence of the holotype.

Sample NVG-23053A04, GenBank PV972660, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACCATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGTGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCTGTAGGTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTCTTACTGACCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGAGGTGACCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 654–655 (genitalia Fig. 1425–1426), bears the following eight rectangular printed (handwritten text is shown in italics) labels, 4^th pink, 8^th red and others white: [ MEXICO: OAXACA | Candelaria Loxicha | +500m.; 16-X | 1969; E. C. Welling ], [ A. C. Allyn | Acc. 1973–48 ], [ MGCL/FLMNH | Specimen no. | 36334 ], [ ] no text on this label, [ DNA sample ID: | NVG-23053A04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24129D05 | c/o Nick V. Grishin ], [ genitalia | NVG250720–36 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Calpodes | rostris Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 1♂ and 1♀ from Mexico: 1♂ NVG-17112A12 Veracruz, Fortin de las Flores, Río Metlac Canyon, 16-Oct-1980, W. H. Howe leg. [LACM] and 1♀ NVG-23053A05 the same data as the holotype but 25-Oct-1969 (Fig. 656–657).

Type locality.

Mexico: Oaxaca, Candelaria Loxicha, elevation ca. 500 m.

Etymology.

The name is formed from the name of its relative, C. longirostris, made shorter for this more northern species and is treated as a noun in apposition.

Distribution.

Currently known only from Southern Mexico.

Calpodes rostridus Grishin, new species

https://zoobank.org/8EDEBA9E-3987-443B-BAC5-F2946C5F04DF

(Fig. 19 part, 658–659)

Definition and diagnosis.

This new species is sister to C. rostris, new species (type locality in Mexico: Oaxaca) and a more distant relative of Calpodes longirostris (Sepp, [1840]) (type locality in Suriname) being genetically differentiated from these at the species level in the nuclear genome (Fig. 19); but it is not different in the COI barcode from C. longirostris and some C. rostris, new species, probably due to irregularities in mitochondrial evolution in this group of species. This new species keys to “Saliana longirostris” (O.14.15) in Evans (1955), but differs from it and other relatives by the following combination of characters in males: two (not three) hindwing semihyaline spots, which are larger and more rectangular, and one pale-yellow spot in the cell CuA₁-CuA₂; the spot in the cell M₃-CuA₁ is nearly the same length as the spot between the veins M₁ and M₃, which is divided into two by the vein M₂ and the two parts of the spot are offset relative to each other; the hindwing rounder than in C. longirostris; a longer and narrower upper segment of the spot in the discal forewing cell; the basal half of ventral forewing by the costal margin is more tawny-orange than in C. rostris, new species, darker than the gold-yellow cell Sc-R₁; the pale basal half of ventral hindwing is more saturated in color, dull-yellow with a maroon tint; apical areas on the ventral side of both wings are prominently paler with some yellowish overscaling; and the yellowish basal half of the anal area is brighter colored in males, yellower. Due to cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2694.9.2:A225G, aly595.10.1:C513T, aly18312.9.70:G84A, aly208.51.2:A360C, aly1139.93.1:T378C, aly272.2.16:C24C (not T), aly2612.6.2:A4011A (not T), aly499.10.6:C159C (not A), aly636.8.6:A312A (not T), aly2508.20.1:G33G (not A); and COI barcode cannot identify this species.

Barcode sequence of the holotype.

Sample NVG-23081F06, GenBank PV972661, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACCATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGTGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCTGTAGGTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTCTTACTGACCGAAATTTAAATACATCTTTTTTTGACCCAGCAGGAGGAGGTGACCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 658–659, bears the following four rectangular printed labels, three white: [ Merida | Bricenno ], [ Coll. | Staudinger ], [ DNA sample ID: | NVG-23081F06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | rostridus Grishin ].

Type locality.

Venezuela: Mérida.

Etymology.

The name is a fusion: rost[ris] + [Me]rid[a] + us, is longer than the name of its more northern sister species C. rostris, new species, and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Mérida, Venezuela.

Calpodes culta (Evans, 1955) and Calpodes catha (Evans, 1955) are species distinct from Calpodes saladin (Evans, 1955)

Proposed as subspecies, Saliana saladin culta (Evans, 1955) (type locality in Brazil: Pará) and Saliana saladin catha Evans, 1955 (type locality in Brazil: Santa Catarina), currently in the genus Calpodes Hübner, [1819] (type species Papilio ethlius Stoll, 1782), are genetically differentiated from each other and from Calpodes saladin (Evans, 1955) (type locality Ecuador: Paramba) at the species level, e.g., their COI barcodes differ by at least 1.8% (12 bp) (between C. culta and C. saladin). Furthermore, as Evans (1955) noted, the three taxa consistently differ from each other in genitalia. Therefore, we propose that Calpodes culta (Evans, 1955), new status, and Calpodes catha (Evans, 1955), new status, are species distinct from Calpodes saladin (Evans, 1955).

Calpodes perlatus Grishin, new species

https://zoobank.org/F55F7909-CD5D-431C-B29A-6454471CC713

(Fig. 19 part, 660–661, 1427–1429)

Definition and diagnosis.

Genomic sequencing of a female from Amazonian Brazil reveals that it is not closely related to any known species of Calpodes Hübner, [1819] (type species Papilio ethlius Stoll, 1782) (Fig. 19) and therefore represents a new species. This new species keys to “Saliana saladin culta” Evans, 1955 (type locality in Brazil: Pará) (O.14.19) in Evans (1955), but differs from it and other relatives by the following combination of characters in females: semihyaline spots are paler than in many relatives, but not white, slightly yellowish; the forewing with a vestigial subapical spot in the cell R₃-R₄ as a streak along the vein R₄, but present; a pale spot in the forewing cell M₂-M₃ is dot-like, vestigial on the ventral side, smaller than in most relatives; between the discal cell and the costal margin, the ventral forewing is golden-yellow with strong whitish overscaling for about its half and diffusely towards subapical spots; the forewing apex and the anterior distal half of ventral hindwing (starting from the white area, not just closer to the outer margin) are with prominent purple gloss of a slightly greenish tint; the hindwing with three semihyaline spots arranged similarly to those in C. ethlius, but the spot between the veins M₁ and M₃ has its posterior side (along vein M₃) shifted distad; the basal half of the ventral hindwing is pearly white with olive tint all the way from the costal to the inner margin, not yellower towards the inner margin, the boundary between the white and brown parts is irregular, slightly concave outward, in the anterior half of the wing; and the tornus is warmer brown, slightly paler. Due to unexplored individual variation in this species, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1313.30.3:C81T, aly1761.4.4:G78A, aly499.25.5:T102A, aly767.19.1:C444T, aly72.18.2:C174T, aly2954.5.2:C1248C (not T), aly103.16.1:T1683T (not A), aly103.16.1:A1881A (not T), aly103.16.1:A1857A (not T), aly127.74.3:T1560T (not C); and COI barcode: T136C, T157C, T259C, A277T, A454T.

Barcode sequence of the holotype.

Sample NVG-23081F02, GenBank PV972662, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGAATACTTCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGTTGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAGTTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTCTTACTGACCGAAATTTAAATACATCTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATCTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 660–661 (genitalia Fig. 1427–1429), bears the following six rectangular labels (1^st handwritten others printed), five white: [ Itaituba | 86 Hhl ], [ Coll.| Staudinger ], [ DNA sample ID: | NVG-23081F02 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24029E06 | c/o Nick V. Grishin ], [ genitalia | NVG241114–21 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Calpodes | perlatus Grishin ]. According to its label, the holotype was collected in 1886 by Paul Hahnel (1843–1887). The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Brazil: Pará, Itaituba.

Etymology.

Although many species of Calpodes have a whitish or cream-colored basal half of ventral hindwing, this base appears particularly pearly in this new species suggesting the name, which is an adjective.

Distribution.

Currently known only from the holotype collected in the mid-Amazonian region of Brazil.

Calpodes contrastus Grishin, new species

https://zoobank.org/52848B84-427F-4E68-B008-7AF7AC109411

(Fig. 19 part, 662–665)

Definition and diagnosis.

This new species is a strongly supported sister to Calpodes saladin (Evans, 1955) (type locality Ecuador: Paramba) in the Z chromosome tree but is sister to Calpodes culta (Evans, 1955) (type locality in Brazil: Pará) in the autosome (nuclear genome) and the mitochondrial genome trees, while being more similar in facies to its more distant and sympatric relative Calpodes catha (Evans, 1955) (type locality in Brazil: Santa Catarina) (Fig. 19). It keys to “Saliana saladin catha” (O.14.18(c)) in Evans (1955) and was likely included by him in this taxon, but differs from it by more extensive purplish overscaling in the apical area on the ventral side of both wings, including the entire area between the veins M₁ and M₂ starting from the discocellular vein, with the basal half of the area being paler than the distal half (basal part is darker in C. catha); more deeply notched—and better separated from the cream-colored, yellower than in C. catha, subcostal area, not nearly fused into it—semihyaline spot in the discal cell on the forewing; two (not three) subapical semihyaline spots on the forewing in females; in males, the two spots are not equal in length and the upper spot is smaller (about the same length in C. catha, in which the upper spot may be thinner); and a wider cream-colored area at the base of the ventral hindwing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1489.16.3:T144A, aly1489.16.3:G162A, aly2011.4.2:C33T, aly2011.4.2:C60T, aly537.24.3:G81A; and COI barcode: T118C, T187C, A325C, A376C, T407T, T542C, 578T.

Barcode sequence of the holotype.

Sample NVG-23084G11, GenBank PV972663, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACCGGTTGAACAGTTTATCCCCCCCTTTCAGCTAATATTGCCCACCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTACTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATCTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 662–663, bears the following three printed (text in italics handwritten) rectangular labels, two white: [ Rio Grande | H v. Wernicke | Thr. Salius | coll.v.Rosen ], [ DNA sample ID: | NVG-23084G11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | contrastus Grishin ]. Paratype: 1♀ NVG-23084F12 Brazil, Santa Catarina, no other data [ZSMC] (Fig. 664–665).

Type locality.

Brazil: Rio Grande do Sul.

Etymology.

The name is given for more contrasting patterns in this species compared to its relatives and is an adjective.

Distribution.

South Brazil.

Comment.

Curiously, the name of Hermann Wernicke (1851–1925), a German insect dealer, appearing on one of the labels of the holotype of this new species, is also listed on the label of the holotype of its sympatric and cryptic relative C. catha, although collected in a different Brazilian State.

Neotype designation for Papilio salius Cramer, 1775

Papilio salius Cramer, 1775, currently a valid species in the genus Calpodes Hübner, [1819] (type species Papilio ethlius Stoll, 1782) (Mielke 2004; Mielke 2005; Zhang et al. 2019c), was described from an unstated number of specimens from Suriname, with a dorsal side of one specimen illustrated (Cramer 1775) (Fig. 666–667). The description is short, and we translate it as follows: “The yellowish spots on the wings of this skipper butterfly (Pap[ilio]. Pleb[ejus]. Urbicola) are hyaline. Beneath, there is no difference, except that the hindwings are dark ash-gray in color near the bases. It is from Suriname.” Genomic sequencing reveals that a number of Calpodes species generally agree with this description. To learn more about the taxonomic identity of Calpodes salius, we searched for its syntypes among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. We found two specimens of Calpodes in the Joan Calkoen collection (in RMNH) that is suggested to include some Cramer type specimens (de Jong 1983), but these Calpodes have a cream-colored hindwing bases beneath (not dark ash-gray) and we identified them as Calpodes antoninus (Latreille, [1824]) (type locality in Brazil and Suriname). Thus, we failed to find syntypes of Papilio salius and believe that they were lost.

There is an exceptional need for a neotype of P. salius to define this taxon objectively due to the existence of several similar-looking species of Calpodes. Therefore, we proceeded with the neotype designation. Genomic sequencing reveals four distinct Calpodes species in Suriname that have darker bases (not cream-colored) of ventral hindwings. The original drawing of P. salius shows a nearly rectangular semihyaline spot in the forewing discal cell (different shape is drawn on different wings, suggesting inaccuracies in the drawing) without a prominent upper segment and two (not three) spots on hindwing: the lower spot being much smaller than the upper one, dot-like. Out of the four Surinamese species, one has larger hindwing (and forewing) spots, typically three in number. The other one has a deeply clefted forewing discal cell spot. The third species has two hindwing spots nearly equal in size. Only the fourth species agrees better with the original illustration. A Surinamese specimen of this species that is in the best agreement with the illustration and the original description was found and sequenced. Hereby, N.V.G. designates this specimen in ZSMC illustrated in Fig. 668–669 (DNA sample NVG-23012C07) as the neotype of Papilio salius Cramer, 1775.

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. salius, which is necessary because cryptic species are present among its relatives; 75.3.2. The characters to differentiate this taxon from others are revealed from the illustrations of its type specimen in Cramer (1775) and are stated above. Briefly, the dark ash-gray hindwing bases beneath, the semihyaline spot in forewing discal cell is not deeply clefted, hindwing with 2 semihyaline spots, the lower spot is dot-like; 75.3.3. The neotype specimen is a male bearing two rectangular printed labels: [ Surinam | V. – IX. | Fruhstorfer ], [ DNA sample ID: | NVG-23012C07 | c/o Nick V. Grishin ] and illustrated in Fig. 668–669. The neotype’s right antenna is missing the apiculus, and forewing apices have fingerprints of the collector; 75.3.4. We failed to find syntypes of P. salius among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and believe that they were lost; 75.3.5. The neotype closely agrees with the original description and the dorsal side illustration of P. salius syntype in all (but one, see below) characters, as evidenced by comparing the neotype illustrated in Fig. 668–669 with the original illustration and the characters of this taxon listed above (75.3.2.). The only exception is the shape of the forewing discal cell spot that has a more developed upper segment than shown in the illustration. We are not sure if this is because of variation or because the illustration may not be fully accurate about such details. To show variation in this spot, we also illustrate a specimen of this species from French Guiana: Gourdonville, 15-Sep-1905, E. Le Moult leg. (Fig. 670–671, NVG-23026G05) that has an upper segment reduced to a short spike more similar to the original drawing; 75.3.6. The neotype is from Suriname and the original type locality given as Suriname is the same; 75.3.7. The neotype is in the Zoologische Staatssammlung München, Germany (ZSMC). As a result of the neotype designation, the type locality of P. salius remains Suriname. Genomic sequencing reveals that this species is also present in Guyana and French Guiana (Fig. 19). The COI barcode sequence of the neotype, sample NVG-23012C07, GenBank PV972664, 658 base pairs, is:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCACCAAGGATCATCAGTTGATTTAGCAATTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACTATACTACT TACTGACCGAAATTTAAATACATCTTTTTTTGACCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Calpodes trimacula (Mabille, 1878) is a valid species distinct from Calpodes salius (Cramer, 1775)

Thracides salius var. trimacula Mabille, 1878, is regarded as a junior subjective synonym of Calpodes salius Cramer, 1775 (type locality in Suriname) (Mielke 2004; Mielke 2005; Zhang et al. 2019c). Genomic sequencing of specimens of Calpodes Hübner, [1819] (type species Papilio ethlius Stoll, 1782) that included the neotype of C. salius and specimens we identified as T. salius var. trimacula due to well-developed triple of semihyaline spots on the hindwing that is sullied beneath similarly to C. salius, reveals that they belong to different non-sister clades that are genetically differentiated at the species level (Fig. 19); e.g., their COI barcodes differ by 3.3% (22 bp). Moreover, the two taxa are sympatric in Suriname. Therefore, we propose that Calpodes trimacula (Mabille, 1878), new status, is a valid species distinct from Calpodes salius (Cramer, 1775).

Calpodes fissalius Grishin, new species

https://zoobank.org/0D784A0C-F11D-40F8-8A89-A09FAB584FBF

(Fig. 19 part, 672–675)

Definition and diagnosis.

This new species is phenotypically close to and sympatric with Calpodes salius (Cramer, 1775) (type locality in Suriname), but is in a different clade and is genetically differentiated from it at the species level (Fig. 19); e.g., their COI barcodes differ by 3.2% (21 bp). This new species keys to “Saliana salius” (O.14.17) in Evans (1955) and was included by him in this taxon, but differs from it and other relatives by the following combination of characters in males: the semihyaline spot in the forewing discal cell is deeply clefted on its distal side and notched on the basal side, thus nearly split into two, with its upper section thinner, streak-like; the hindwing with two or three semihyaline spots that are larger than in C. salius but smaller than in Calpodes trimacula (Mabille, 1878) (type locality in Brazil), the lower spot is smaller than the upper spot and does not overlap with it; and the basal half of the ventral hindwing is as dark as in some C. trimacula, but darker than in C. salius, and the dark-gray area is narrower. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly3446.8.24:T234C, aly3446.8.24:C267G, aly1281.7.7:G363C, aly7003.4.4:T2004C, aly7003.4.4:T2070G; and COI barcode: T117C, T127C, T292C, A421T, T439C.

Barcode sequence of the holotype.

Sample NVG-23095B10, GenBank PV972665, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGATCATTAATCGGAGATGATCAAATTTATAACACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATCAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCGTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATGCTACTTACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGTGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zentrum für Biodokumentation des Saarlandes Collection, Schiffweiler, Germany (ZfBS), illustrated in Fig. 672–673, bears the following four rectangular labels printed (2^nd handwritten, others printed), three white: [ Muzo, Colombia | 400 b. 800 m | Coll. Fassl ], [ chiomara | | U ], [ DNA sample ID: | NVG-23095B10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | fissalius Grishin ]. The second label is in Draudt’s handwriting and indicates that the ventral side (U) of this specimen was illustrated as “chiomara” (misidentification) in Draudt (1921–1924). Paratypes: 2♂♂ and 2♀♀: 1♂ NVG-18021C07 Venezuela, Caripito, 10-Mar-1942 [AMNH]; 1♀ NVG-23096D12 Suriname, 1945 [SMNS] (Fig. 674–675); and Brazil: 1♂ NVG-23081F07 Para, Capim,1886, Donckier leg., coll. Weymer [MFNB] and 1♀ NVG-23084F11 Amazonas, Rio Negro, Vaupés, 18-Jan-3-Feb-1964, Chr. Lindemann leg. [ZSMC].

Type locality.

Colombia: Boyacá Department, Muzo.

Etymology.

In Latin, fissura mean fissure, split, or cleft and is fused with the name of its relative C. salius to indicate a deeper cleft in the forewing discal cell spot characteristic of this species: fiss[ura] + [s]alius. The name is treated as a masculine noun in apposition.

Distribution.

Northern South America: recorded from Colombia, Venezuela, Suriname, and Amazonian Brazil.

Comment.

Ventral side of the holotype is illustrated in Draudt (1921–1924) on plate 191 row f as “Thracides chiomara,” a misidentification.

Calpodes parasalius Grishin, new species

https://zoobank.org/1CC46FBF-F531-47F3-A3E1-F5C49A7F5647

(Fig. 19 part, 676–679, 1430–1431)

Definition and diagnosis.

This is probably the most common species that has been lumped with Calpodes salius (Cramer, 1775) (type locality in Suriname), is sympatric with it in the Guianas, placed in a different clade, and is genetically differentiated from it (Fig. 19); e.g., their COI barcodes differ by 3.2% (21 bp). It differs from similar Calpodes fissalius, new species (type locality in Colombia: Boyacá) by 3.5% (23 bp) in the COI barcode. This new species keys to “Saliana salius” (O.14.17) in Evans (1955) and was included by him in this taxon, but differs from it and other relatives by the following combination of characters in males: the semihyaline spot in the forewing discal cell is strongly clefted on its distal side, but not as deeply as in C. fissalius, new species, and may be notched on the basal side, its upper section is broader and while not as short as in C. salius, is shorter than in C. fissalius; the hindwing with two semihyaline spots (the third one may be present as a dot) that are larger than in C. salius but smaller than in Calpodes trimacula (Mabille, 1878) (type locality in Brazil), the lower spot is about the same size as the upper spot and does not overlap with it; the basal half of the ventral hindwing is not as dark as in a typical C. trimacula, and about the same as in C. salius but with more ocherous tint; and the tawny patch in the anal area of the ventral hindwing is typically better developed and separated from the dark-brown tornal area. Females are with more pronounced purple overscaling by the apices of both wings on ventral side than in C. fissalius, new species. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly82.27.3:C204T, aly1838.39.2:T1533C, aly1838.39.2:A1558C, aly1720.4.1:A1085G, aly1019.14.45:G258A; and COI barcode: T106C, A229G, T355C, A517A, T574C.

Barcode sequence of the holotype.

Sample NVG-23053A08, GenBank PV972666, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGTGCTCCTGACATGGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCAGCCAATATCGCCCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACCATATTACT TACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTC

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 676–677, bears the following six rectangular labels (1^st handprinted others printed with handwritten text shown in italics), five white: [ SURINAME | SAV. FST | ADJ AIRPORT | III02 MJS ], [ Allyn Museum | Acc. 2002–11 ], [ Saliana | salius ♂ | Det. S.R.Steinhauser ], [ Allyn Museum/FLMNH | Specimen no. 2714 ], [ DNA sample ID: | NVG-23053A08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | parasalius Grishin ]. According to its label, the holotype was collected in March 2002 by Mark J. Simon. Paratypes: 7♂♂ and 1♀: 1♂ NVG-18021C08 Colombia, Meta, Cano Quenane, 27-Jul-1946, L. Richter leg. [AMNH]; 1♂ NVG-18021C06 Trinidad, La Brea, Pitch Lake, 19-Apr-1933, Albert S. Pinkus leg. [AMNH]; Suriname, ex. coll. Fruhstorfer: 1♂ NVG-24021H03 [SMF] and 3♂♂: NVG-23012C05, NVG-23012C06, and NVG-23012C08 [ZSMC]; 1♂ NVG-20013B05 (leg, DNA sequenced), NVG-24015G12 (abdomen, DNA stored), WRD 15421 Peru, Madre de Dios, Alto Madre de Dios at Pantiacolla Lodge, 400 m, approx. GPS −12.65, −71.22, 20-Jun-2019, W. R. Dempwolf, leg., genitalia NVG241114–56 (Fig. 1430–1431) [WRD]; and 1♀ NVG-23084F10 Brazil, Amazonas, A. H. Fassl leg., ex coll. Arp [ZSMC] (Fig. 678–679).

Type locality.

Suriname: vic. Zanderij and the airport.

Etymology.

The meanings of the Latin prefix para- include resembling, similar to, beside, alongside, and the prefix is added to the name of its close relative, C. salius, for which this species has been misidentified. Moreover, in Latin, the word par means equal and being added to the name indicates that the semihyaline spots on the hindwing of this species are more equal to each other is size than in other species. The name is treated as a masculine noun in apposition.

Distribution.

Northern South America, including Colombia, Trinidad, Suriname, and Amazonian Peru and Brazil.

Calpodes chimalapus Grishin, new species

https://zoobank.org/A89CE8E6-3885-4649-9391-CA52FA7AD744

(Fig. 19 part, 680–681, 1432–1433)

Definition and diagnosis.

A species related to Calpodes saladin (Evans, 1955) (type locality in Ecuador), but genetically differentiated from it at the species level (Fig. 19); e.g., the COI barcodes of two specimens from Oaxaca differ by 1.7% (11 bp). This new species keys (incompletely) to “Saliana longirostris” (Sepp, [1840]) (type locality in Suriname) (O.14.15) in Evans (1955), but differs from it by males with a darker basal half of the ventral hindwing, two (not three) semihyaline spots on the hindwing, where the spot between veins M₁ and M₃ is about twice as wide and long as the spot in the cell M₃-CuA₁ and does not overlap it. The new species differs from other relatives by the combination of the following characters (in addition to those mentioned above) in males: the ventral forewing with a purple gloss area between the veins M₁ and M₃ from the discocellular vein to a small semihyaline spot in the cell M₂-M₃ (near the vein M₃), a mostly dark-yellow cell Sc-R₁ from the base to near the origin of the vein R₁, and darker, tawny color of the cell C-Sc; yellowish (not white) semihyaline spots; the forewing discal cell spot with a shorter upper segment (less than twice as long as the lower segment); and a tawny patch in the middle of the anal area of the ventral hindwing from its base to the middle. Due to partly cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2012.51.1:C594G, aly822.26.3:G54A, aly822.26.3:T96A, aly276451.1.1:A57G, aly276451.1.1:C61A, aly82.27.3:C204C (not T), aly1838.39.2:T1533T (not C), aly1838.39.2:A1558A (not C), aly127.44.3:C879C (not T), aly275206.10.2:T174T (not A); and COI barcode: T25C, A229G, 268T, T439C, A517G.

Barcode sequence of the holotype.

Sample NVG-23053A11, GenBank PV972667, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATGGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCAGCTAATATTGCCCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATCAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCTGTGGGAATTACAGCATTATTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATCTATTC

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 680–681 (genitalia Fig. 1432–1433), bears the following eight rectangular printed (handwritten text is shown in italics) labels, 4^th pink, 8^th red and others white: [ T. Escalante | Chimalapa | Oax | VII · 52 ], [ A. C. Allyn | Acc. 1973–48 ], [ MGCL/FLMNH | Specimen no. | 36343 ], [ ] no text on this label, [ DNA sample ID: | NVG-23053A11 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24129D03 | c/o Nick V. Grishin ], [ genitalia | NVG250720–34 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Calpodes | chimalapus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Mexico: Oaxaca, Santa María Chimalapa.

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Chimalapas mountains, Mexico.

Calpodes vividus Grishin, new species

https://zoobank.org/30F38F8C-CA17-4D03-84BA-D3B995C83946

(Fig. 19 part, 682–683, 1434–1436)

Definition and diagnosis.

Genomic sequencing of a brightly colored male from the eastern Andes in Colombia reveals that it is not closely related to any known species of Calpodes Hübner, [1819] (type species Papilio ethlius Stoll, 1782) (Fig. 19) and therefore it represents a new species. This new species keys (incompletely) to “Saliana severus” (Mabille, 1895) (type locality in French Guiana) (O.14.19) in Evans (1955), but differs from it by a longer upper arm of the discal cell spot on the forewing and a paler basal area on the ventral hindwing in males. This new species differs from other relatives by the following combination of characters (in addition to those mentioned above) in males: generally, colors are more saturated and vivid, borders between the colors are more sharply defined and semihyaline spots are yellower; the area from the discal cell to the costal margin on the ventral forewing from the base to about half of the wing is golden-yellow, brighter and warmer than in most other relatives; distal areas on the ventral side of both wings towards the apex have purple sheen; the hindwing has two pale-yellow spots, the one between the veins M₁ and M₃ is twice as wide as long, about the same length as a smaller spot in the cell M₃-CuA₁; basal 2/5^ths of the ventral hindwing is light-tan in color, with olive tint at places, overscaled with maroon towards the base and brighter, gold-yellow in the anal area; and the rest of the wing is chestnut in color, the border between the two colors (tan and chestnut) is strongly concave outward. Due to unexplored individual variation in this species, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly727.31.2:G9A, aly727.31.2:T18C, aly1341.12.28:T2238C, aly1341.12.28:T8103A, aly84.43.2:T214C; and COI barcode: 88A, T292C, T367C, A412A, T514A, T586C, .

Barcode sequence of the holotype.

Sample NVG-23081F04, GenBank PV972668, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCATTATTTGTTTGATCAGTAGGAATTACAGCATTATTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACCGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 682–683 (genitalia Fig. 1434–1436), bears the following six rectangular labels (1^st handwritten others printed), five white: [ Muzo. | Stichel. ], [ Hesperiidae | Coll.Thieme ], [ DNA sample ID: | NVG-23081F04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24029E07 | c/o Nick V. Grishin ], [ genitalia | NVG241114–22 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | vividus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Colombia: Boyacá Department, Muzo.

Etymology.

In Latin, vividus means vivid, bright, or lively, and the name refers to the brighter aspect of this species, having more vivid and contrasting colors compared to most other Calpodes. The name is an adjective.

Distribution.

Currently known only from the holotype collected in the eastern Andes of central Colombia.

Calpodes obscurus Grishin, new species

https://zoobank.org/E83B608C-2C64-43DE-95D9-A26B73987C53

(Fig. 19 part, 684–685)

Definition and diagnosis.

Close sister to Calpodes vividus, new species (type locality Colombia: Muzo), this new species is genetically differentiated from it (Fig. 19) and differs by 2.1% (14 bp) in the COI barcode. It keys (incompletely) to “Saliana longirostris” (Sepp, [1840]) (type locality in Suriname) (O.14.15) in Evans (1955) but differs from it by males with a darker basal half of the ventral hindwing, paler-yellow semihyaline spots, longer upper extension of the discal cell spot on the forewing, two (not three) spots on the hindwing, the spot between the veins M₁ and M₃ is about twice as wide as long, shorter than the spot in the cell M₃-CuA₁, and does not overlap it. This new species differs from other relatives by the following combination of characters (in addition to those mentioned above) in males: the ventral forewing with a purple gloss area between the veins M₁ and M₃ from the discocellular vein to 3/5^ths the distance to the outer margin, a mostly dark-yellow cell Sc-R₁ from the base to near the origin of the vein R₁ and darker, tawny color of the cell C-Sc; and no yellower patches in the anal area of the ventral hindwing, which is mostly purplish-brown. Due to partly cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly6654.1.1:A1743G, aly727.31.2:G9A, aly727.31.2:T18C, aly84.43.2:T214C, aly2284.26.24:A51T, aly862.10.9:C168C (not T); and COI barcode: T127A, T292C, T367C, A412T, T500C, A517G, T523C.

Barcode sequence of the holotype.

Sample NVG-23012C09, GenBank PV972669, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTAATATTTGATCAAATACCGCTATTTGTTTGATCTGTGGGAATCACAGCATTATTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACATCTTTTTTCGATCCTGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 684–685, bears the following four rectangular labels (2^nd handwritten others printed), three white: [ S.-America | Caucathal. ], [ ♂ Thrac. longirostris | Sepp ], [ DNA sample ID: | NVG-23012C09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | obscurus Grishin ].

Type locality.

Colombia: Valle del Cauca.

Etymology.

In Latin, obscurus means dark, obscure, hidden, or unclear, and the name refers to the darker aspect of this species compared to its close sister C. vividus, new species. The name is an adjective.

Distribution.

Currently known only from the holotype collected in western Colombia.

Calpodes antonus Grishin, new species

https://zoobank.org/6F0BE413-A29D-43B6-84BD-2036BCB44004

(Fig. 19 part, 686–689, 1437–1438)

Definition and diagnosis.

A species related to Calpodes antoninus (Latreille, [1824]) (type locality in Brazil and Suriname), but genetically differentiated from it at the species level (Fig. 19); e.g., the COI barcodes of two specimens from Oaxaca differ by 4.7% (31 bp). This new species keys to “Saliana antoninus” (O.14.13) in Evans (1955), but differs from it by males with a darker basal half of the ventral hindwing and two (not three) semihyaline spots on the hindwing. This new species is sympatric with and rather similar to Calpodes chimalapus, new species, while not being its closest relative and differing from it by 5% (33 bp) in the COI barcode, and in male facies by a more uniformly colored apical area of the ventral forewing lacking purple gloss between the veins M₁ and M₃ distad of the discocellular vein; the hindwing with overlapping semihyaline spots, typically a rounder spot between the veins M₁ and M₃, frequently separated into two spots by the vein M₂; the basal 2/5^ths of the ventral hindwing is paler and more olive with maroon tint basad; a brighter gold-yellow with orange tint distad patch in the basal half of the anal area on the ventral hindwing; and a narrower spot in the forewing discal cell with a more gracile upper segment. Due to partly cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly5294.5.4:G99A, aly5294.5.4:A105G, aly315.14.3:T274C, aly2781.5.1:A570G, aly671.22.3:G174A; and COI barcode: T106C, T154C, T220C, T346C, T451C, A484G, T646T.

Barcode sequence of the holotype.

Sample NVG-23052H12, GenBank PV972670, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGATTATTAATTCGTACTGAATTAGGTAATCCTGGATCATTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCCCTTTCAGCTAATATTGCTCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAGTTAAAAACTTAATGTTTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACCATATTACTTACTGATCGAAATTTAAATACATCTTTTTTTGACCCCGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 686–687 (genitalia Fig. 1437–1438), bears the following eight rectangular printed (handwritten text is shown in italics) labels, 4^th pink, 8^th red and others white: [ T. Escalante | Chimalapa | Oax | IX-56 ], [ A. C. Allyn | Acc. 1973–48 ], [ MGCL/FLMNH | Specimen no. | 36320 ], [ ] no text on this label, [ DNA sample ID: | NVG-23052H12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24129D04 | c/o Nick V. Grishin ], [ genitalia | NVG250720–35 | c/o Nick V. Grishin ], [ HOLOTYPE ♂ | Calpodes | antonus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 2♀♀ from Mexico, Oaxaca, T. Escalante leg.: 1♂ NVG-23053A07 Río Sarabia, Aug-1958 [MGCL] and from the type locality: 1♂ NVG-23053A06 Oct-1965 [MGCL], 1♀ NVG-23053A01 Sep-1956 [MGCL] (Fig. 688–689), and 1♀ NVG-18021C09 Aug-1965 [AMNH].

Type locality.

Mexico: Oaxaca, Santa María Chimalapa.

Etymology.

The name is formed from the name of its relative, C. antoninus, and is treated as a noun in apposition.

Distribution.

Currently known only from Oaxaca, Mexico.

Calpodes venamus Grishin, new species

https://zoobank.org/4544C9CC-FD82-4C76-BC0C-D43075AD92D2

(Fig. 19 part, 690–691)

Definition and diagnosis.

This new species is sister to Calpodes antonus, new species (Mexico: Oaxaca) and is genetically differentiated from it (Fig. 19); e.g., their COI barcodes differ by 1.2% (8 bp), and therefore represents a new species. This new species keys to “Saliana antoninus” (O.14.13) in Evans (1955) but is more similar to C. antonus, new species, e.g., in having two (not three) semihyaline spots on the hindwing, but differs from both of these species by its intermediate appearance of males, e.g., the basal area of the ventral hindwing is less dark than in C. antonus, new species, and redder in the basal half (overall yellower in C. antoninus); the two hindwing spots are not overlapping; the forewing discal cell spot being more elongated with its upper segment more strongly shifted distad; the ventral hindwing with a paler-yellow patch in the anal area; slightly more developed purple overscaling at the wing apices beneath, especially just distad of the discal cell and between the veins M₁ and M₃, resembling Calpodes longirostris (Sepp, [1840]) (type locality in Suriname) in this regard. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.44.3:T96C, aly5547.1.1:G348A, aly2379.27.7:C90T, aly1139.36.3:T633A, aly860.8.8:T39C; and COI barcode: T154C, T220T, T439C, A484G, T553C, T646C.

Barcode sequence of the holotype.

Sample NVG-23081E12, GenBank PV972671, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGATTATTAATTCGTACTGAATTAGGTAATCCTGGGTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAGCTAATATTGCTCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATCAATTTTATTACCACAATTATTAATATACGAGTTAAAAACTTAATGTTTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCCGTCTTAGCAGGAGCTATTACCATATTACTTACTGATCGAAATTTAAATACATCTTTTTTTGACCCCGCAGGAGGAGGTGATCCTATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 690–691, bears the following five printed rectangular labels (3^rd handwritten, other printed), four white: [ P^to Cabello | Hahnel ], [ Coll. | Staudinger ], [ wie Antoninus | God. ], [ DNA sample ID: | NVG-23081E12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calpodes | venamus Grishin ]. Paratype: 1♂ NVG-23012C11 Suriname, May–Sep, old, Fruhstorfer leg. [ZSMC].

Type locality.

Venezuela: Carabobo, Puerto Cabello.

Etymology.

The name is a fusion Ven[ezuela] + [Surin]am[e] + us for the known distribution of this species and is treated as a noun in apposition.

Distribution.

Currently known from Venezuela and Suriname.

Calpodes calimus Grishin, new species

https://zoobank.org/86AAE3D7-1902-4FE0-9E57-C19A1F401902

(Fig. 19 part, 692–693)

Definition and diagnosis.

A species related to Calpodes antoninus (Latreille, [1824]) (type locality in Brazil and Suriname), but genetically differentiated from it at the species level (Fig. 19); e.g., the COI barcodes of two specimens from Oaxaca differ by 3.2% (21 bp). This new species keys (incompletely) to “Saliana antoninus” (O.14.13) in Evans (1955) and it similar in general appearance to Calpodes catha (Evans, 1955) (type locality in Brazil: Santa Catharina), while not beingly closely related to it; but differs from them and other relatives by the following combination of characters in females: one (not two or three) pale spot (more precisely, two spots fused into one, as is most relatives) on the hindwing; generally slightly smaller pale and semihyaline spots, smaller and whiter pale basal area on the ventral hindwing not reaching half of the wing; a somewhat paler (less yellow) cream-white area by the ventral forewing costal margin; a more strongly developed purple sheen around the ventral side of apical areas on both wings; and more extensive pale overscaling around the pale rectangular spot in the cell CuA₂-1A+2A on the ventral forewing. Due to cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.172.4:T72C, aly536.172.4:G75A, aly11426.3.1:C57T, aly11426.3.1:G96T, aly420.7.2:G36A, aly294.13.2:T1005T (not C), aly294.13.2:G1182G (not A), aly221.10.4:T87T (not C), aly221.10.4:G130G (not T), aly2954.5.2:A186A (not G); and COI barcode: , T154T, T346A, T403C, T407C, C619A, A643G, T646C.

Barcode sequence of the holotype.

Sample NVG-17112B02, GenBank PV972672, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACAGGTTGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCACCAAGGATCTTCAGTTGATTTAGCAATTTTTTCTCTCCATCTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAACTTAATATTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTACTGATCGAAATTTAAATACATCTTTCTTTGACCCAGCAGGAGGAGGTGATCCTATCTTGTACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM), illustrated in Fig. 692–693, bears the following three rectangular printed labels, two white: [ COLOMBIA: Valle Dept. | Calima River.4.13°N | 77.07°W. Nov.1989 ], [ DNA sample ID: | NVG-17112B02 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Calpodes | calimus Grishin ].

Type locality.

Colombia: Valle del Cauca Department, Calima River, approx. GPS 4.13, −77.07 (GPS maps to Chocó Department).

Etymology.

The name is derived from the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Chocó region, Colombia.

Subtribe Carystina Mabille 1878

Calvetta calva Grishin, new species

https://zoobank.org/EF8D528F-CF6F-4D63-B355-0A246751A1FF

(Fig. 18 part, 694–695, 1439–1440)

Definition and diagnosis.

Genomic analysis of specimens from Panama and Colombia initially identified as Calvetta calvina (Hewitson, 1866) (type locality in Brazil: Pará) reveals that they are genetically differentiated from it at the species level (Fig. 18); e.g., their COI barcodes differ by 2% (13 bp), and therefore represent a new species. This new species keys to “Cobalus calvina” (K.22.2) in Evans (1955), but differs from it by the following combination of characters: a yellower ventral hindwing discal spot in males, a less prominent pale area near the forewing tornus not joining the hyaline spot in the cell CuA₁-CuA₂, and a straighter outer edge of the pale discal band on the ventral hindwing in females (i.e., the outer edge of the spot near the apex is not offset distad from other spots in the band). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly315.19.1:G949T, aly536.168.1:G645A, aly216.50.2:A191G, aly26.42.7:A801G, aly1139.96.1:T807C; and COI barcode: T59C, A81G, A181G, 541G, T583T.

Barcode sequence of the holotype.

Sample NVG-23122E09, GenBank PV972673, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATACTAGGATCATCTTTAAGATTACTAATTCGAACTGAATTAGGTAGCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTTCCCCTAATACTCGGAGCCCCTGATATAGCTTTCCCTCGAATAAACAATATAAGTTTTTGACTTTTACCCCCTTCTTTAACTCTATTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTTTATCTTCAAATATTGCTCATCAAGGATCCTCAGTTGACTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCATTATTTGTTTGATCTGTTGGAATTACAGCTTTATTATTATTGTTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAACACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 694–695 (genitalia Fig. 1439–1440), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Colon(Sta. Rita) | Panama 1500’ | 31 Dec.’68 | S.S.Nicolay ], [ Cobalus ♂ | calvina | Hew. | DET.BY S.S.NICOLAY ], [ DNA sample ID: | NVG-23122E09 | c/o Nick V. Grishin ], [ genitalia | NVG250720–52 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Calvetta calva | Grishin ]. Paratypes: 2♂♂ and 1♀ in USNM, G. B. Small leg.: Panama, Canal Zone: 1♂ NVG-23122E10 Ft. Sherman, 31-Oct-1965 and 1♀ NVG-23122E11 Gatún, 27-Jan-1973 and 1♂ NVG-23122E12 Colombia, Chocó, Quibdó, 13-Mar-1976.

Type locality.

Panama: Colón Province, Santa Rita Arriba, elevation 1500’.

Etymology.

The name is formed from the name of its sister species, C. calvina, made shorter to indicate a more northern distribution of this species, and is treated as a noun in apposition.

Distribution.

Currently known from Panama and western Colombia.

Carystus (Argon) gus Grishin, new species

https://zoobank.org/DBD1947B-EFA9-4EC1-8562-191D6143B804

(Fig. 18 part, 696–697, 1441–1442)

Definition and diagnosis.

Genomic analysis of a specimen from Oaxaca, Mexico initially identified as Carystus (Argon) argus Möschler, 1878 (type locality in Colombia, holotype sequenced as NVG-15035D03) reveals that it is genetically differentiated at the species level (Fig. 18); e.g., their COI barcodes differ by 5.2% (34 bp), and therefore represents a new species. This new species keys to Argon argus (K.8) in Evans (1955), but differs from it and other relatives by the following combination of characters: in addition to the forewing discal cell semihyaline spot next to the spot in the cell CuA₁-CuA₂, there is a smaller spot closer to the spot in the cell M₃-CuA₁, no pale spot in the dorsal forewing cell CuA₂-1A+2A, dark brown spots on the ventral hindwing are typically smaller; smoothly curved ventral margin of the harpe, which is slightly smaller and terminally expanded, with more irregular dorsal margin, concave and serrated with irregular teeth (some teeth broader than others); the harpe is separated from the ampulla by a small notch; and the ampulla is broadly rounded and not protruding dorsad of the costa, which is nearly straight, not concave. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2774.21.1:A123G, aly2774.21.1:C160A, aly1139.50.2:A114G, aly1838.17.2:A54G, aly1811.1.6:C54T, aly84.30.11:C165C (not T), aly527.6.8:T99T (not A), aly671.35.2:A144A (not G), aly322.29.6:C258C (not T), aly11127.1.1:G87G (not A); and COI barcode: T59C, A166G, C169T, A265G, A550C.

Barcode sequence of the holotype.

Sample NVG-22109E04, GenBank PV972674, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGTACTTCTTTAAGATTACTAATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCTTTTATTATAATCTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGAATGTTACCCCCTTCTTTAACATTATTAATCTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCTCTTTCATCAAATATTGCTCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTAGCATTTGATCAAATACCATTATTTGTTTGATCAGTAGGAATTACAGCTTTACTTTTACTTTTATCTCTCCCAGTATTGGCAGGAGCTATTACAATACTTCTCACTGATCGAAATTTAAATACTTCTTTTTTTGACCCCGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 696–697 (genitalia Fig. 1441–1442), bears the following nine rectangular labels (1^st handwritten, others printed with handwritten text shown in italics), eight white: [ MEX: OAXACA | CANDELARIA | VIII-16–72 ], [ E.C.Welling | Collector ], [ Collection of | C.D.MacNeill ], [ Argon argus | (Möschl) | Det. C.D. MacNeill ], [ DNA sample ID: | NVG-22109E04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-24015E03 | c/o Nick V. Grishin ], [ genitalia | NVG241114–10 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8568779 ], and one red [ HOLOTYPE ♂ | Carystus (Argon) | gus Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Mexico: Oaxaca, Candelaria Loxicha.

Etymology.

The name formed from its sister species epithet, argus, truncated to indicate a more northern distribution of this new species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Oaxaca, Mexico.

Aroma oma Grishin, new species

https://zoobank.org/6F92C61E-E183-48C7-828C-4371D6983312

(Fig. 18 part, 698–699, 1443–1445)

Definition and diagnosis.

Genomic analysis of a specimen from Panama initially identified as Aroma aroma (Hewitson, 1867) (type locality in Brazil: Pará) reveals that it is genetically differentiated at the species level (Fig. 18); e.g., their COI barcodes differ by 4.3% (28 bp), and therefore represents a new species. This new species keys to A. aroma (O.17.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: a typically more sullied and less extensive tornal pale area on the ventral forewing; the serrated dorsoposterior margin of the harpe is longer and not strongly concave before the ampulla; the ampulla does not stand out as a hump; and the costa is only slightly concave from the last serration of the harpe through the ampulla and to the base. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3561.6.1:G156A, aly3561.6.1:T168C, aly770.8.14:C66T, aly798.26.1:G66A, aly798.26.1:C78T, aly9687.3.1:A59A (not T), aly686.20.6:C165C (not T), aly164.2.2:T72T (not A), aly1651.33.8:A90A (not C), aly2124.3.36:G78G (not C); and COI barcode: T226C, C271T, T487C, T604C, T616C.

Barcode sequence of the holotype.

Sample NVG-5058, GenBank PV972675, 658 base pairs:

AACTCTATATTTTATTTTTGGAATTTGAGCAGGATTACTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGACATAGCTTTCCCCCGTATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTGACCCTGCTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGTTGAACAGTCTACCCCCCTCTGTCATCTAATATTGCCCATCAAGGATCTTCTGTTGATTTAGCAATTTTCTCTCTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCCTTCGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATACTTCTTACAGATCGAAATTTAAATACCTCCTTCTTTGACCCTGCAGGAGGTGGAGACCCAATCTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 698–699 (genitalia Fig. 1443–1445), bears the following four rectangular labels (1^st handwritten, others printed), three white: [ Gamboa, CZ. | 17 Aug 69 ], [ DNA sample ID: | NVG-5058 | c/o Nick V. Grishin ], [ genitalia | NVG151102–13 | Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Aroma oma | Grishin ]. Judging from the handwriting on the locality label, the holotype was likely collected by Gordon B. Small.

Type locality.

Panama: Colón Province, Gamboa.

Etymology.

The name is formed from its sister species epithet, aroma, truncated to indicate more northern distribution of this new species. The name is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in Panama.

Molo reticulatus Grishin, new species

https://zoobank.org/A1805189-A9A1-422A-98B3-C9A1E079BF27

(Fig. 18 part, 700–701, 1446–1448)

Definition and diagnosis.

Genomic analysis of specimens from Esmeraldas Province in Ecuador reveals that they form a clade sister to other species in the genus Molo Godman, 1900 (type species Hesperia heraea Hewitson, 1868, treated as a junior subjective synonym of Hesperia mango Guenée, 1865) and are genetically differentiated from others at the species level (Fig. 18); e.g., their COI barcodes differ by 6.7% (44 bp) from Molo mango, and therefore they represent a new species. This new species keys to Molo (I.13) in Evans (1955), but not to any species in particular and differs from its relatives by the following combination of characters in males: distinctly larger in size; the hindwing reddish brown with much smaller postdiscal spots, missing in some cells, but with a heavy orange overscaling along all veins; the female is dark-brown with an orange postdiscal forewing band similar to the male, just broader, and a large orange spot in the discal cell; beneath, the female is patterned similarly to its dorsal side but paler and with larger spots. This species is not cryptic, but due to unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly16576.6.12:C75T, aly16576.6.12:C118T, aly1603.27.4:A45G, aly6841.11.7:A131T, aly6841.11.7:A132G; and COI barcode: T56C, T154C, T259C, T397C, T547C.

Barcode sequence of the holotype.

Sample NVG-18117B06, GenBank PV972676, 658 base pairs:

TACATTATATTTTATTTTTGGAATTTGAGCAGGATTATTAGGAACTTCTTTAAGTCTATTAATTCGAACAGAATTAGGTCATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTCATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTCTGATTACTTCCCCCCTCTTTAATACTCCTAATCTCAAGAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATCAAGGATCCTCTGTAGATTTAGCAATTTTCTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAATAATCTTTCTTTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACTGCTTTACTATTACTATTATCCTTACCTGTTTTAGCAGGAGCAATTACTATACTTCTTACAGACCGAAATTTAAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 700–701 (genitalia Fig. 1446–1448), bears the following seven rectangular labels (2^nd handwritten on glassine paper, others printed), six white: [ ECUADOR: Esmeraldas | Rio Cachavi, 1 Km W | Alto Tambo | 0° 54.74’ N, 78° 32.83’ W | 2 March 2001, 725 m | D. H. Ahrenholz leg. ], [ 3/2/01 | 1 K W | Alto Tambo ], [ DNA sample ID: | NVG-18117B06 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121C06 | c/o Nick V. Grishin ], [ genitalia | NVG241121–73 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531677 ], and one red [ HOLOTYPE ♂ | Molo reticulatus | Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 2♂♂ and 1♀ from Ecuador, Esmeraldas, I. Aldas leg. [USNM]: 1♀ NVG-18117C04, USNMENT 01531687 37 km N Pero Vicente Maldonado, Ruminahui, 500 m, GPS 0.278833, −78.998333, Apr-2001 and Chuchuví, km. 12.5 of Lita–San Lorenzo Rd., 850 m, GPS 0.8835, −78.5150: 1♂ NVG-23119B03 Jan-2001 and 1♂ NVG-23119B04 Oct-2002.

Type locality.

Ecuador: Esmeraldas Province, Río Cachaví, 1 km west of Alto Tambo, elevation 725 m, GPS 0.9123, −78.5472.

Etymology.

The name refers to the reticulate ventral hindwing pattern and is an adjective.

Distribution.

Currently known only from the Esmeraldas Province in Ecuador.

Mielkeus tertius Grishin, new species

https://zoobank.org/B1964F50-2810-4C07-9050-DDEB847B8CE8

(Fig. 18 part, 702–705, 1449–1451)

Definition and diagnosis.

Genomic analysis of specimens from Mexico and Costa Rica initially identified as Mielkeus tertianus (Herrich-Schäffer, 1869) (type locality not specified, likely in the Amazonian region) reveals that they are genetically differentiated from it at the species level in the nuclear genome (Fig. 18), however may not differ strongly in COI barcodes (up to 1.2%, 8 bp); and therefore they represent a new species. This new species keys to Vettius tertianus (J.45.21) in Evans (1955) and was included by him in this species, but differs from it and other relatives by the following combination of characters: females with a darker ventral hindwing especially noticeable in the postdiscal area closer to the costal margin; the harpe appears truncated distally, with a longer distal margin and nearly straight ventrodistal and dorsodistal margins, the latter is finely serrated; the dorsal tooth of the harpe by the ampulla is more rounded; the ampulla is not protruding, mostly straight dorsally from it though the costa. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.39.2:G415A, aly1229.9.12:C1314T, aly838.17.1:A1260G, aly838.17.1:T1275G, aly727.20.3:G51A; and COI barcode: T106C, A265A, but some specimens may be unidentifiable by the barcodes due to their similarity and variation.

Barcode sequence of the holotype.

Sample NVG-19016H10, GenBank PV972677, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTGAGTTTATTAATTCGAACAGAATTAGGGAATCCTGGATCTTTAATTGGTAATGACCAAATTTACAATACAATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGTGCCCCCGACATAGCTTTCCCTCGATTAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATACTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCTCTTTCTTCAAATATTGCTCACCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTCATTACTACAATTATTAATATACGAATTATAAACTTATCATTTGATCAAATACCCCTATTTGTATGATCTGTTGCCATTACAGCTTTACTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 702–703 (genitalia Fig. 1449–1451), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ COSTA RICA:Cartago | Turrialba 2100’ | 9°54’N 83°41’W | 10 July 1965 | leg. G.B.Small ], [ DNA sample ID: | NVG-19016H10 | c/o Nick V. Grishin ], [ genitalia | NVG241121–78 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01532364 ], and one red [ HOLOTYPE ♂ | Mielkeus | tertius Grishin ]. Paratype: 1♀ NVG-22108G10, CASENT 8568713 Mexico, Quintana Roo, X-Can, 28-Aug-1959, E. C. Welling leg. [CAS] (Fig. 704–705).

Type locality.

Costa Rica: Cartago Province, Turrialba.

Etymology.

The name is similar to the name of its sister species, M. tertianus, made shorter for this new more northern relative. The name is treated as a noun in apposition.

Distribution.

Mexico to Costa Rica.

Damas surivenas Grishin, new species

https://zoobank.org/1A8FE01F-63F0-45C9-B037-36F1E2C2F137

(Fig. 18 part, 706–707, 1452–1454)

Definition and diagnosis.

Genomic analysis of specimens from Venezuela and Suriname initially identified as Damas clavus (Herrich-Schäffer, 1869) (type locality in Southeast and South Brazil) reveals that they originated during the rapid radiation of Damas Godman, 1901 (type species Goniloba clavus Herrich-Schäffer, 1869) and are more distant from all other species, being genetically differentiated from them at the species level (Fig. 18); e.g., their COI barcodes differ by 4.4% (29 bp) from more closely related Damas corope (Herrich-Schäffer, 1869) (type locality in Amazonian region) (Zhang et al. 2025a) and by 5% (33 bp) from their sister in the Z chromosome tree, Damas lavandas Grishin, 2025, and therefore they represent a new species. This new species keys to Damas clavus (K.26) in Evans (1955), but differs from it and other relatives by the following combination of characters in females: one apical forewing spot (not three and not missing) and a discal cell spot being expressed, but weaker than in Damas cervus (Möschler, 1876) (type locality in Suriname); moderately well developed the ventral forewing pale area by the tornus; and a doublet of small (but well-defined) discal spots on the ventral hindwing. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly307.2.1:T99C, aly536.210.1:A295C, aly1849.12.8:G69A, aly1849.12.8:C81T, aly310.8.9:C78T; and COI barcode: A34T, T226C, T406C, A494T, T640C.

Barcode sequence of the holotype.

Sample NVG-21118A07, GenBank PV972678, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGTTTGCTAGGAACTTCCTTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCCCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCTGACATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTCTACCCCCCCCTTTCTTCCAATATTGCCCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTTTACACTTAGCAGGAATTTCTTCCATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGTGTAAGAAATTTATCCTTTGATCAATTACCCTTATTTGTATGATCTGTAGGAATTACAGCCCTTTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTTCTTTTTTTGACCCCGCTGGTGGAGGAGATCCTATCTTATATCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 706–707 (genitalia Fig. 1452–1454), bears the following ten rectangular labels (1^st, 2^nd, 4^th, and 5^th handwritten, others printed, 1^st green, last red, and others white): [ Surinam | Wd. 79 ], [ Corope | H. Sch. ], [ Coll. Möschl. ], [ Corope HS. | false ], [ sp. 51:11. ], [ Coll. | Staudinger ], [ DNA sample ID: | NVG-21118A07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23076A04 | c/o Nick V. Grishin ], [ genitalia | NVG240817–72 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Damas surivenas | Grishin ], collected by Wiedemann (“Wd.”) in 1879 (“79”). The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♀ NVG-23075H05 Venezuela, Mérida, no date (old), Bricenno leg. [MFNB].

Type locality.

Suriname.

Etymology.

The name is a modified fusion of the names of the countries constituting the known distribution of this species: Suri[name] + ven[ezuel]a + s, and is treated as a noun in apposition.

Distribution.

Venezuela and Suriname.

Pyrrhopygopsis orasus (H. Druce, 1876) is a species distinct from Pyrrhopygopsis socrates (Ménétriés, 1855)

Genomic analysis of specimens we identified as Pyrrhopygopsis socrates (Ménétriés, 1855) (type locality in Brazil: Minas Gerais) reveals that Pyrrhopygopsis socrates orasus (H. Druce, 1876) (type locality in Peru: Cuzco) is genetically differentiated from the nominate subspecies at the species level in the nuclear genome (but not in the mitochondrial genome) (Fig. 18); e.g., F_st/G_min for the pair are 0.44/0.009. Therefore, we propose that Pyrrhopygopsis orasus (H. Druce, 1876), reinstated status, is a species distinct from Pyrrhopygopsis socrates (Ménétriés, 1855).

Lectotype designation for Pyrrhopygopsis crates Mabille and Boullet, 1912

Pyrrhopygopsis crates Mabille and Boullet, 1912 (type locality in Ecuador and Bolivia), currently regarded as a valid subspecies of Pyrrhopygopsis socrates (Ménétriés, 1855) (type locality in Brazil: Minas Gerais), was described from two males in MNHP (from the upper Amazonian region) and two males in the Mabille collection (from Bolivia). To stabilize nomenclature and define the name P. crates objectively, N.V.G. hereby designates the sequenced syntype in the MNHP collection, the male that bears the following five labels (1^st red, 4^th green, others white; 1^st and the last printed, others handwritten with the last line on the 2^nd label printed): [ TYPE ], [ Rio Napo | Ht. Amazone | 1878 | R.P. Pozzi | MUSEUM DE PARIS ], [ Pyrrhopygopsis | crates Mab.-Boull. | Am. Sci. mat., Zool., | (9)16, p. 3, 1912 ], [ P. Crates, | Mab et Boull ], [ DNA sample ID: | NVG-18079H05 | c/o Nick V. Grishin ], as the lectotype of Pyrrhopygopsis crates Mabille and Boullet, 1912. The lectotype is missing both antennae and has fingerprints around the apices and scales rubbed at the bases of both forewings. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of P. crates becomes Ecuador: Río Napo. The COI barcode sequence of the lectotype, sample NVG-18079H05, GenBank PV972679, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTGGGAACCTCTTTAAGATTGTTAATTCGAACAGAATTAGGTAACCCAGGATCACTCATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTCCCTCCTTCTTTAACATTGTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTACCCTCCTTTATCTTCCAATATTGCTCACCAAGGATCTTCAGTTGATTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATGCGAATTATAAATTTATCATTTGATCAAATACCCCTATTTGTTTGATCAGTGGGAATTACAGCATTATTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAACTTAAATACTTCCTTTTTTGATCCAGCAGGAGGTGGAGATCCTATTTTATACCAACATTTATTT

Pyrrhopygopsis socrates crates Mabille and Boullet, 1912 is a junior subjective synonym of Pyrrhopygopsis orasus (H. Druce, 1876)

Genomic analysis of the lectotype of Pyrrhopygopsis crates Mabille and Boullet, 1912 (type locality in Ecuador: Napo River) places it among specimens of Pyrrhopygopsis orasus (H. Druce, 1876), reinstated status, (type locality in Peru: Cuzco) without notable genetic differentiation (Fig. 15). Phenotypically, the lectotype falls within variation seen in P. orasus with both taxa characterized by a white patch at the bases of the ventral hindwing crossed by dark veins that continue through the dark, greenish overcast ground color of the rest of the wing. Darker veins are also apparent over the dark greenish apical section of the forewing. Therefore, we propose that Pyrrhopygopsis socrates crates Mabille and Boullet, 1912 is a new junior subjective synonym of Pyrrhopygopsis orasus (H. Druce, 1876).

Pyrrhopygopsis bixis Grishin, new species

https://zoobank.org/BDD07A9A-8F74-48C0-969B-8A29F641210C

(Fig. 18 part, 708–709, 1455–1459)

Definition and diagnosis.

Genomic analysis of specimens from Ecuador and Peru initially identified as Pyrrhopygopsis socrates crates Mabille and Boullet, 1912 (type locality in Ecuador: Napo River, lectotype sequenced as NVG-18079H05) reveals that they are genetically differentiated from it at the species level (Fig. 18); e.g., their COI barcodes differ by 6.5% (43 bp), and therefore represent a new species. This new species keys to “P. socrates crates” (O.19.2(b)) in Evans (1955) and represents, at least in part, the taxon that Evans misidentified. This new species differs from it and other relatives by the white bases present on the ventral hindwings and a darker ventral side with less prominent darker veins and mostly uniformly black with greenish, bluish, or purplish (depending on the wing area, lighting, and angle) tint. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly691.6.8:G696A, aly2487.17.2:A54T, aly890.16.1:T36C, aly203.17.7:G51A, aly203.17.7:G54T; and COI barcode: A37G, T49C, A391G, A565G, T586C.

Barcode sequence of the holotype.

Sample NVG-18111B07, GenBank PV972680, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCCTTAAGATTATTGATTCGAACAGAATTAGGTAACCCAGGATCATTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTAATGTTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTGCCCCCTTCTTTAACATTGTTGATCTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCTCCTTTGTCCTCTAATATCACCCACCAAGGATCCTCAGTTGATTTAGCGATTTTTTCCTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTATAAATTTATCATTTGATCAAATACCTCTATTTATTTGATCTGTGGGAATTACAGCATTATTACTACTTTTATCTTTACCAGTATTAGCCGGGGCTATTACTATACTTCTTACCGATCGAAATTTAAATACTTCATTCTTTGATCCAGCAGGAGGTGGAGACCCCATTTTATACCAACATTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 708–709 (genitalia Fig. 1455–1456), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ ECUADOR,Napo Prov. | Yasuni RschSta/ NPk | 0.675°S; 76.398°W | 5–17 SEPT. ’99;275m | R.Leuschner,900 ft ], [ DNA sample ID: | NVG-18111B07 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23121C07 | c/o Nick V. Grishin ], [ genitalia | NVG241121–74 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01531301 ], and one red [ HOLOTYPE ♂ | Pyrrhopygopsis | bixis Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratype: 1♂ NVG-22047F10 (leg, DNA sequenced), NVG-23117B12 (abdomen, DNA stored) Peru, Pasco, Puerto Bermudez, Río Pichis, 16-Jul-1920, genitalia NVG241121–75 (Fig. 1457–1459) [CUIC].

Type locality.

Ecuador: Orellana Province, Yasuní National Park Research Station, elevation 275 m, GPS −0.675, −76.398.

Etymology.

The color pattern of this species is the ultimate expression of the bixae form described for Pyrrhopyge, without strong dark veins inside black areas. The name is treated as a noun in apposition.

Distribution.

Ecuador and Peru.

Tribe Pericharini Grishin, 2019; Subtribe Pericharina Grishin, 2019

Oenides ecuadorina Grishin, new species

https://zoobank.org/0B98EA14-F007-479A-A24A-7ABDA4A75373

(Fig. 18 part, 710–711, 1460–1461)

Definition and diagnosis.

Genomic analysis of specimens from Ecuador initially identified as Oenides vulpina (C. Felder and R. Felder, 1867) (type locality in Colombia: Bogotá) reveals that they are genetically differentiated from it at the species level (Fig. 18); e.g., their COI barcodes differ by 5% (33 bp), and therefore they represent a new species. This new species keys to “Alera vulpina” (K.32.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: more pronounced dark overscaling along the tornus on the dorsal hindwing; a medium length tornal white streak on the ventral hindwing; a shorter and less curved upper segment of the stigma at a distance from the semihyaline white spot in cell CuA₁-CuA₂; a sullied white band near the ventral hindwing costa; a distally narrower harpe, rounded and with a longer posterodorsal margin that is nearly straight, turning anteriad towards the ampulla, sclerotized and serrated; and the tooth by the ampulla is small and rounded. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly4003.5.1:G297A, aly4003.5.1:C366T, aly671.47.1:G1653T, aly671.15.6:C166A, aly86.8.16:A722C; and COI barcode: A31G, A76G, T97C, T313T, A565G, A631G.

Barcode sequence of the holotype.

Sample NVG-22019E12, GenBank PV972681, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCGGGAATATTAGGAACATCCCTAAGTTTATTAATTCGTACAGAATTGGGGAATCCTGGATCATTAATCGGAGATGATCAAATTTATAATACTATTGTCACAGCTCACGCTTTTATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTGCCCCTTATATTGGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGAATACTGCCCCCTTCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTACCCCCCCCTTTCCTCTAATATTGCACATCAAGGATCGTCGGTAGATTTAGCAATCTTTTCCCTTCATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTATAAACTTATCATTCGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCATTATTATTACTATTATCTTTACCAGTTTTAGCTGGGGCTATCACAATACTTTT AACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGGGACCCAATCTTATACCAACACTTATTT

Type material.

Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 710–711 (genitalia Fig. 1460–1461), bears the following six printed rectangular labels, five white: [ Canclos | Ecuador or. ], [ Collection | v.Rosen ], [ DNA sample ID: | NVG-22019E12 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23084H07 | c/o Nick V. Grishin ], [ genitalia | NVG241121–76 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Oenides | ecuadorina Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection. Paratypes: 3♂♂ from Ecuador: 1♂ NVG-23078E05 Bolívar, Balzapamba, old, R. Haensch S. [MFNB]; 1♂ NVG-23078E03 Tungurahua, Baños, old, R. Haensch S. leg. [MFNB]; and 1♂ NVG-23096D10 Zamora-Chinchipe, Río San Francisco, Estación Científica San Francisco, 1750–1900 m, 3-Dec-1999, D. Bartsch and C. Häuser leg. [SMNS].

Type locality.

Ecuador: Pastaza Province, Canelos.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from Ecuador.

Comment.

Male genitalia of O. vulpina NVG-22019E11 (leg, DNA sequenced), NVG-23084H06 (abdomen, DNA stored) from Colombia, genitalia NVG241121–77 [ZSMC], are shown for comparison in Fig. 1462–1463.

Oenides erytorna Grishin, new species

https://zoobank.org/9917DA3C-A552-4AE5-B877-12E3D3A8DB41

(Fig. 18 part, 712–713)

Definition and diagnosis.

A specimen from the Andes in central Peru is sister to the previous new species and is genetically differentiated from it at the species level (Fig. 18); e.g., their COI barcodes differ by 2.4% (16 bp), and therefore represents a new species. This new species keys to “Alera vulpina” (K.32.1) in Evans (1955), but differs from it and other relatives by the following combination of characters in males: a weaker dark overscaling along the tornus on the dorsal hindwing; a longer tornal white streak on the ventral hindwing; a longer and more curved upper segment of the stigma nearly reaching the semihyaline white spot in cell CuA₁-CuA₂; prominent paler overscaling by the ventral forewing apex; and more strongly developed white band near the ventral hindwing costa (frequently obscured and missing in some other relatives). Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly363.19.1:T33C, aly363.19.1:A48G, aly489.8.1:T217G, aly383.17.7:C106A, aly2582.15.3:G714A, aly671.15.6:C166C (not A), aly374.12.1:T1383T (not C), aly374.12.1:T1402T (not C), aly5582.8.1:C1195C (not T), aly4091.5.1:G438G (not A); and COI barcode: T25C, T313C, T499C, A565T, A631A.

Barcode sequence of the holotype.

Sample NVG-23122G01, GenBank PV972682, 658 base pairs:

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATATTAGGAACATCCCTAAGTTTATTAATTCGTACAGAATTGGGGAATCCTGGATCATTGATCGGAGATGATCAAATTTATAATACTATTGTCACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTGCCCCTTATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGAATGCTGCCCCCTTCCTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAACGGTGCAGGGACAGGTTGAACAGTTTACCCCCCCCTTTCCTCTAATATTGCACATCAAGGATCGTCGGTAGATTTAGCAATCTTTTCCCTTCATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTATAAACTTATCATTCGATCAAATACCCTTATTTGTATGATCTGTAGGTATTACAGCATTATTATTACTATTATCTTTACCAGTTTTAGCTGGTGCTATCACAATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTCGATCCTGCTGGAGGAGGAGACCCAATCTTGTATCAACACTTATTT

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 712–713, bears the following four printed (handwritten text shown in italics) rectangular labels, three white: [ PERU: Huanuco Dept | Carpish, 3000m | 9° 42’ S, 76° 04’ W | May 1990], [ Alera ♂ | vulpina | Det. | S.S. Nicolay ] [ DNA sample ID: | NVG-23122G01 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Oenides | erytorna Grishin ].

Type locality.

Peru: Huánuco Region, Carpish, elevation 3000 m, approx. GPS −9.700, −76.067.

Etymology.

The name refers to the orange-red (ἐρυθρός (erythrós) is Greek for red) dorsal hindwing tornus: eryt[hrós] + [t]orn[us] + a and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of central Peru.

Oenides andina Grishin, new species

https://zoobank.org/DD3DEDF6-62DE-4D44-A54B-B0BCE56E69D7

(Fig. 18 part, 714–717, 1464–1468)

Definition and diagnosis.

Genomic analysis of specimens from Peru and Bolivia initially identified as Oenides vulpina (C. Felder and R. Felder, 1867) (type locality in Colombia: Bogotá) reveals that they are genetically differentiated from it at the species level (Fig. 18); e.g., their COI barcodes differ by 4.4% (29 bp), and therefore represent a new species. This new species keys to “Alera vulpina” (K.32.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: strong dark overscaling along the mostly dark tornus on the dorsal hindwing; a medium length tornal white streak on the ventral hindwing; a shorter and less curved upper segment of the stigma at a distance from the semihyaline white spot in cell CuA₁-CuA₂; a sullied white band near the ventral hindwing costa; a greener than yellower tint of the ground color on the ventral side; more weakly developed beige (instead of yellow) area between the band of three subapical spots and the spot in the cell M₃-CuA₁; a distally truncate harpe, which is broader, with a straighter distal margin, and with a medium length posterodorsal margin that is evenly convex towards the ampulla, strongly sclerotized, broader, and serrated; and the tooth by the ampulla is larger and rounded, knob-like. Due to the cryptic nature of this species and unexplored individual variation, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly862.11.2:A84G, aly862.11.2:T97C, aly318.42.2:G549A, aly1315.17.2:G45A, aly967.4.1:A195G; and COI barcode: T106C, A334G, T542C, A592T, A631T.

Barcode sequence of the holotype.

Sample NVG-18014F09, GenBank PV972683, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATGTTAGGAACATCCTTAAGTTTATTAATTCGTACAGAATTAGGAAATCCTGGATCATTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGAATACTACCCCCTTCTTTAACTCTTTTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGAACAGGTTGAACGGTTTACCCCCCCCTTTCTTCTAATATTGCACATCAAGGATCATCAGTAGACTTAGCAATCTTTTCCCTTCATTTAGCGGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTATAAACCTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCATTATTATTATTACTATCTTTACCAGTTTTAGCTGGAGCTATTACAATACTTTTAACAGATCGTAATTTAAATACTTCATTTTTCGACCCTGCTGGAGGGGGTGATCCAATCTTATACCAACACTTATTC

Type material.

Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 714–715, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PERU:Cuzco 1450m. | San Pedro Lodge | Cosnipata Valley 4589 | 01-IV-2016 Kinyon ], [ DNA sample ID: | NVG-18014F09 | c/o Nick V. Grishin ], [ USNMENT | {QR Code} | 01450685 ], and one red [ HOLOTYPE ♂ | Oenides | andina Grishin ]. Paratypes: 4♂♂ and 1♀: 1♂ NVG-21119A05 Ecuador (probably mislabeled), “Santa Jnez”, old [ca. 1900], R. Haensch S. leg. [MFNB]; Peru, Cuzco, Cosñipata Valley, San Pedro, 1375 m, GPS −13.05, −71.55, 17-Jun-2019, W. R. Dempwolf leg. [WRD]: 1♂ NVG-20014F09 (leg, DNA sequenced), NVG-24015F07 (abdomen, DNA stored), WRD 17099, genitalia NVG241114–39 (Fig. 1464–1465) and 1♀ NVG-20014F07 (leg, DNA sequenced), NVG-24015H02 (abdomen, DNA stored), WRD 17100, genitalia ssNVG241114–58 (Fig. 716–717, 1466–1468); and Bolivia: 1♂ NVG-23084H08 La Paz, Fariñas, old [ZSMC] and 1♂ NVG-24021G12 no locality details, H. Rolle, coll. A. Seitz [SMF].

Type locality.

Peru: Cuzco Department, Cosñipata Road, San Pedro Lodge, elevation 1450 m.

Etymology.

The name is derived from the Andean region, which this species inhabits, and is treated as a noun in apposition.

Distribution.

The Andes of Ecuador (?), Peru, and Bolivia.

Oenides peruvina Grishin, new species

https://zoobank.org/EE9DDFBA-041C-40D2-AE29-A29A75224DAE

(Fig. 18 part, 718–719, 1469–1471)

Definition and diagnosis.

Genomic analysis of a specimen from central Peru initially identified as Oenides vulpina (C. Felder and R. Felder, 1867) (type locality in Colombia: Bogotá) reveals that it is genetically differentiated at the species level (Fig. 18); e.g., their COI barcodes differ by 9.4% (62 bp), and therefore represents a new species. This new species keys to “Alera vulpina” (K.32.1) in Evans (1955), but differs from it and other relatives by the following combination of characters: weakly developed dark overscaling along the mostly rustorange tornus on the dorsal hindwing; a shorter tornal pale yellow streak on the ventral hindwing; a pale yellow band reaching the ventral hindwing costa and extending along it towards the wing base; reddish tint of the ground color on the ventral side; the lack of paler overscaling by the ventral forewing apex; and a more strongly developed golden area between the band of three subapical spots and the spot in the cell M₃-CuA₁. Due to the cryptic nature of this species, unexplored individual variation, and unknown males, the most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly798.26.1:A45T, aly798.26.1:T54C, aly10226.17.4:A135G, aly890.2.4:T42A, aly890.2.4:T54A, aly956.4.1:C102C (not T), aly956.4.1:G123G (not T), aly3277.16.1:A757A (not G), aly318.42.2:A1260A (not G), aly318.42.2:A879A (not G); and COI barcode: T74C, A217G, A409G, A484C, T556A.

Barcode sequence of the holotype.

Sample NVG-21119A04, GenBank PV972684, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACATCCCTAAGTTTATTAATTCGTACAGAACTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCCCATGCTTTTATTATAATTTTTTTCATGGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAATCCCCCTTATACTGGGGGCCCCTGATATAGCATTCCCCCGAATAAACAATATAAGATTTTGAATATTACCTCCCTCATTAACTCTTTTAATTTCAAGAAGAATCGTTGAAAATGGTGCAGGTACTGGTTGAACGGTATACCCCCCGCTGTCCTCTAACATTGCCCACCAAGGATCTTCTGTGGATTTAGCAATCTTTTCCCTTCATTTGGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTATAAATTTATCCTTTGATCAAATACCTTTATTTGTTTGATCCGTTGGTATTACAGCATTATTATTATTATTATCTTTACCAGTATTGGCTGGAGCTATTACCATACTTCTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGGGGAGATCCAATTTTATACCAACATTTATTT

Type material.

Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 718–719 (genitalia Fig. 1469–1471), bears the following seven rectangular labels (first three handwritten, others printed, 1^st green, last red, and others white), six white: [ O - Peru | Zw. Yanacha- | ga u. Pozuzo | ca 2000 m | G. Tessmann ], [ Oenides ], [ vulpina Feld. ], [ DNA sample ID: | NVG-21119A04 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-23078E08 | c/o Nick V. Grishin ], [ genitalia | NVG240912–12 | c/o Nick V. Grishin ], [ HOLOTYPE ♀ | Oenides | peruvina Grishin ]. The first DNA sample ID refers to the extraction from a leg (sequenced), and the second from the abdomen (stored) prior to genitalia dissection.

Type locality.

Peru: Pasco Region, between Yanachaga and Pozuzo, elevation ca. 2000 m.

Etymology.

The name is derived from the country of the type locality and is treated as a noun in apposition.

Distribution.

Currently known only from the holotype collected in the Andes of central Peru.