ABSTRACT
Maternal cell contamination (MCC) in fetal specimens poses a major risk for misdiagnosis in prenatal genetic testing. Standard variable number tandem repeat (VNTR) analysis of the thyroid peroxidase (TPO) gene intron 10 is informative for MCC detection but traditionally requires DNA extraction, limiting its use in resource‐limited laboratories. This study aimed to develop and validate a direct PCR‐based VNTR assay for MCC detection without DNA extraction. Leftover whole blood and amniotic fluid specimens from 90 families undergoing prenatal diagnosis for severe thalassemia were analyzed, with white blood cell and amniotic fluid pellets directly subjected to PCR amplification of the TPO intron 10 VNTR locus using a high‐pH buffer to overcome PCR inhibitors. The direct PCR results were compared with standard DNA‐based VNTR analysis in a blinded study, and VNTR heterozygosity at the TPO locus was also assessed in 148 unrelated Thai individuals to evaluate marker informativeness. Among 253 specimens, informative VNTR patterns were observed in 65 families (72.2%), with MCC ruled out in 64 families (71.1%) and detected in 1 family (1.1%). Uninformative VNTR patterns occurred in 25 families (27.8%) due to maternal homozygosity or similarity between maternal and fetal VNTRs. Direct PCR showed 100% concordance with standard DNA‐based VNTR analysis. The heterozygosity rate of the TPO intron 10 VNTR was 87.8% among unrelated Thai individuals, supporting its suitability for routine MCC screening. The developed direct PCR protocol is a practical, rapid, and reliable tool for MCC detection, streamlining laboratory workflows and ensuring accurate prenatal diagnosis in low‐resource settings.
Keywords: direct PCR, maternal cell contamination, prenatal diagnosis, TPO gene, VNTR
Study Highlights
- What is the current knowledge on the topic?
-
○Maternal cell contamination (MCC) in fetal specimens is a significant source of diagnostic error in prenatal genetic testing. Although variable number tandem repeat (VNTR) analysis of the thyroid peroxidase (TPO) gene intron 10 is highly informative for MCC detection, the traditional approach requires DNA extraction, which is time‐consuming and limits its use in resource‐constrained laboratories.
-
○
- What question did this study address?
-
○This study examined whether a direct PCR‐based VNTR assay, eliminating DNA extraction, could provide a rapid, reliable, and practical method for MCC detection in prenatal samples from families at risk of severe thalassemia.
-
○
- What does this study add to our knowledge?
-
○We developed and validated a direct PCR protocol for VNTR analysis of the TPO gene intron 10 using whole blood and amniotic fluid pellets. The assay demonstrated 100% concordance with standard DNA‐based VNTR analysis in a blinded study, achieved a high informativeness rate (72.2%), and confirmed a high VNTR heterozygosity rate (87.8%) among unrelated Thai individuals. These findings support the suitability of this marker for routine MCC screening and show that direct PCR can streamline workflows without compromising accuracy.
-
○
- How might this change clinical pharmacology or translational science?
-
○This direct PCR approach simplifies MCC detection by eliminating DNA extraction, reduces turnaround time and resource requirements, and enhances the reliability of prenatal diagnosis in low‐resource settings. Its simplicity and accuracy could lead to broader adoption of MCC screening and serve as a model for applying direct PCR in other translational and clinical laboratory applications.
-
○
1. Introduction
Prenatal diagnosis is a vital method for detecting and preventing genetic disorders. When the couples are identified as having a risk of passing on a genetic condition, fetal tissue samples are collected by obstetricians for diagnostic purposes. These samples may include chorionic villus sampling (CVS), amniotic fluid, and cord blood. Amniotic fluid is the most commonly used among these samples due to its relatively simple collection process and low failure rates. Accurate Prenatal diagnosis is crucial for effective pregnancy management and informed decision‐making.
Maternal cell contamination (MCC) in fetal specimens shows a significant risk of misdiagnosis in prenatal testing [1]. Misidentification of maternal cells as fetal cells can lead to serious diagnostic errors. For example, a mutant allele from maternal cells may result in a non‐diseased fetus being misdiagnosed as affected, or a normal allele from maternal cells could cause an affected fetus to be mistakenly identified as a carrier. A potential misdiagnosis can lead to incorrect genetic counseling and management decisions by the physician. Despite the critical implications, routine screening for MCC in amniotic fluid samples is not commonly performed in standard laboratories, leaving a crucial gap in diagnostic accuracy. While some laboratories perform MCC screening using DNA analysis, these methods are often time‐consuming, labor‐intensive, and require additional resources, highlighting the need for more efficient and simplified approaches.
Microsatellites, known as tandem repeats (TRs), are highly polymorphic DNA markers on every chromosome [2]. These markers, categorized as short tandem repeats (STRs, 2–4 base pairs) or variable number tandem repeats (VNTRs, 10–100 base pairs) [2, 3, 4, 5], are invaluable for human identification, forensic science, and paternity testing due to their inheritance patterns [2, 6, 7, 8, 9]. VNTR analysis has also proven useful in detecting MCC in fetal tissue during prenatal diagnosis (PND) [10]. Specific chromosomal loci, such as the APOB gene, CIAS1 gene, D17S5 locus, D1S80 locus, D4S95 locus, IL1A intron 6 polymorphism, TH01 locus, TPO gene intron 10, and VNTRI of the VWF gene, are commonly utilized for maternal cell contamination in fetal specimens [10, 11, 12, 13, 14, 15].
The VNTR analysis on the TPO gene intron 10 was conducted to detect MCC at our laboratory, the Centre for Research and Development of Medical Diagnostic Laboratories (CMDL), due to the high heterogeneity [10]. However, VNTR analysis is traditionally performed using PCR‐based techniques that require DNA extraction. This requirement limits its applicability to other laboratories, particularly those lacking the necessary resources or infrastructure for DNA extraction procedures. To address this limitation, direct PCR assays can be utilized as an alternative, offering a simpler and more accessible approach by eliminating the need for DNA extraction.
The direct PCR technique, which enables samples to be directly added to the DNA amplification reaction without requiring DNA extraction, substantially reduces both the time and complexity of sample processing. This approach is gaining broader adoption in molecular diagnostics, including its use in prenatal genetic diagnosis of severe thalassemia and inherited diseases [16, 17]. Moreover, we have developed a direct PCR assay specifically for the prenatal diagnosis of Hb E/β‐thalassemia disease [16]. Despite its advantages, the application of direct PCR for detecting MCC in amniotic fluid samples remains relatively unexamined, particularly with direct PCR techniques. Further investigation is needed to validate its potential in MCC analysis as well as to enhance the prenatal diagnosis for Hb E/β‐thalassemia disease using direct PCR techniques. The development of a direct PCR technique for VNTR analysis enables a practical method for detecting MCC in the prenatal diagnosis of severe thalassemia. This approach allows for more rapid diagnosis, as it eliminates the need for time‐consuming DNA extraction—particularly from amniotic fluid samples, which often require extended processing time. Therefore, this study aims to develop and validate a direct PCR method for VNTR analysis of the TPO gene intron 10 to improve MCC detection in prenatal diagnosis. The proposed method not only simplifies the diagnostic process in the prenatal diagnosis of thalassemia but also has the potential to be applied to the prenatal diagnosis of other genetic disorders.
2. Methods
2.1. Specimens and Study Design
Leftover whole blood and amniotic fluid specimens collected between January and April 2024 from at‐risk couples undergoing prenatal diagnosis for severe thalassemia were obtained from the Thalassemia Service Unit (TSU) at the Centre for Research and Development of Medical Diagnostic Laboratories (CMDL), Faculty of Associated Medical Sciences, Khon Kaen University, Khon Kaen, Thailand. During this period, all available samples were included in the analysis. The study comprised 90 families, consisting of 73 paternal whole blood samples, 90 maternal whole blood samples, and 90 amniotic fluid samples from the fetuses. All specimens were stored at 2°C–8°C and were used within a maximum of 5 months from the date of collection. To ensure confidentiality, all samples were anonymized prior to use, and patient consent was not required. This study was approved by the Institutional Review Board (Khon Kaen University, HE671234).
Direct PCR condition for the TPO gene intron 10 was developed using whole blood and amniotic fluid specimens from families with known VNTR results. Prior to validation, intra‐ and inter‐assay reproducibility were evaluated during the development phase to ensure that the direct PCR conditions were reliable and suitable for further validation (data not shown). The developed PCR conditions were prospectively validated through a blinded experiment, in which different personnel conducted the direct PCR and reference DNA‐based VNTR assays using independent workflows to maintain blinding. The direct PCR results were subsequently compared with the standard DNA‐based method from routine practice [18]. Data analysis was performed using a descriptive study design.
2.2. Specimen Preparation
The preparation of amniotic fluid pellets was modified from our previously published methods [16]. The procedure includes the following steps: thoroughly mixing the amniotic fluid for at least 5 s, transferring 1.5 mL of the fluid into a microtube, and centrifuging it at 9214g for 15 min. After centrifugation, 1400 μL of the supernatant is discarded, and the remaining pellet is thoroughly mixed using a vortex mixer. The prepared pellets can be processed immediately for PCR or stored at −20°C for later use.
The preparation of white blood cell pellets from whole blood specimens, a process developed in this study, involves the following steps: mixing EDTA‐anti‐coagulated blood by gently inverting the tube approximately eight times, combining 500 μL of whole blood with 500 μL of 3% Dextran in a microtube, mixing thoroughly, and allowing the mixture to settle for at least 30 min or until red blood cells separate and settle at the bottom. The supernatant is then transferred to a new microtube and centrifuged at 5904g for 5 min. After discarding the supernatant fluid, the precipitate is resuspended in 1 mL of lysis buffer (150 mM ammonium chloride, 10 mM potassium bicarbonate, 0.1 mM ethylenediaminetetraacetic acid, pH 7.4), incubated at 37°C for 5 min, centrifuged again at 5904g for 5 min, and the supernatant discarded. The resulting WBC pellets are ready for immediate PCR processing or storage at −20°C.
2.3. Direct PCR for VNTR Analysis on TPO Gene Intron 10
The PCR reaction mixture was prepared with a total volume of 50 μL, containing 1.5 μL of WBC pellets or AF pellets, 5 μL of PCR buffer with high pH [17], 0.2 mM dNTPs, 3 mM MgCl2, 1.005 M betaine, 2% dimethyl sulfoxide, 0.15 pmole each of the G186 forward primer (5′‐GTCAACCTCCGTTTGAGCG‐3′) and G187 reverse primer (5′‐ATGCAGTGGGCTTCGAACTG‐3′) [18], and 1.5 units of Taq DNA Polymerase (PCR Biosystems Ltd., Oxford, United Kingdom). The thermal cycling protocol included an initial denaturation step at 95°C for 15 min, followed by 36 cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min 30 s, and extension at 72°C for 2 min. The PCR amplification was performed on a SimpliAmp Thermal Cycler (Thermo Fisher Scientific Inc., Massachusetts, United States). The resulting PCR amplicons were analyzed using 2% agarose gel electrophoresis and visualized under UV light following staining with ViSafe Green Gel Stain (Vivantis Technologies Sdn. Bhd., Malaysia). The orientations of the primers and representative gel electrophoresis results for the developed direct PCR for VNTR analysis of the TPO gene intron 10 are presented in Figure 1A,B, respectively.
FIGURE 1.

The developed direct PCR for VNTR analysis of the TPO gene intron 10. (A) Illustrates the location of the TPO gene intron 10 on chromosome 2p25.3 and the primer mapping used for direct PCR in VNTR analysis. Each repeat sequence in intron 10 is 50 base pairs long, oriented in the 5′ to 3′ direction, with six repeats as an example. These repeats contribute to the length of the PCR fragment since the fragment length corresponds to the number of repeats present in the gene. (B) Presents gel electrophoresis results of VNTR analysis for MCC determination from four representative families: Family 1 and 4 demonstrate the informative VNTR patterns. Family 1: The AF specimen from the fetus showed VNTR fragments inherited from the father (Fa) and the mother (M), with no additional maternal VNTR fragments detected in the AF specimen. This indicates that no maternal cell contamination (MCC) was observed. On the other hand, Family 4: The AF specimens contained VNTR fragments inherited from both the father (Fa) and mother (M) and additional fragments originating from the maternal VNTR. This demonstrates the presence of maternal cell contamination (MCC). Family 2: VNTR fragments from both the father (Fa) and mother (M) were identified in the AF specimen. However, the homozygosity of the maternal VNTR pattern made it unfeasible to rule out maternal contamination. Family 3: Similar VNTR patterns between the mother and fetus were observed. As a result, maternal contamination could not be ruled out. The DNA marker used in this study was the VC 100 bp Plus DNA Ladder (Vivantis Technologies Sdn. Bhd., Selangor Darul Ehsan, Malaysia). (Generated by Microsoft PowerPoint for Mac, Version 16.89.1 (24091630), Microsoft Corporation).
The results of the four VNTR patterns analyzed in this study are categorized as follows: (1) no maternal contamination was detected, (2) maternal contamination could not be ruled out due to homozygosity of the maternal VNTR, (3) maternal contamination could not be ruled out due to similarity between the maternal and fetal VNTR patterns, and (4) maternal contamination was observed (Figure 1B).
2.4. Statistical Analysis
Descriptive statistics were used to summarize the frequency and distribution of VNTR patterns and maternal cell contamination (MCC) detection in fetal samples. In‐group consistency analysis was performed by evaluating the concordance of VNTR patterns among maternal, paternal, and fetal specimens within each family. Agreement between direct PCR and standard DNA‐based PCR was assessed by calculating the concordance rate and one‐sided 95% confidence bounds. The heterozygosity rate was reported with a 95% confidence interval. All analyses were performed using Stata software version 18 (Stata Corp, Texas, USA).
3. Results
This study successfully developed and validated a direct PCR method for analyzing the VNTR in intron 10 of the TPO gene using 253 samples from 90 families. The samples included 73 whole blood samples from the fathers, 90 from the mothers, and 90 amniotic fluid samples from the fetuses. Table 1 presents the four distinct VNTR patterns identified. Informative VNTR patterns were observed in 65 families (72.2%), with maternal contamination ruled out in 64 families (71.1%) and detected in 1 family (1.1%). Uninformative VNTR patterns were observed in 25 families (27.8%), including 12 families (13.3%) where the maternal VNTR pattern was homozygous and 13 families (14.4%) where similar VNTR patterns in the mother and fetus made it unfeasible to rule out maternal contamination. Comparison with DNA‐PCR techniques used in routine VNTR analysis showed 100% concordance among all 90 families, with a one‐sided 95% lower confidence bound of 98.6%, confirming the reliability of the developed direct PCR method.
TABLE 1.
VNTR analysis results of the TPO gene intron 10 using direct PCR and DNA‐PCR techniques in 90 families.
| VNTR interpretation pattern | Number of families (%) | |
|---|---|---|
| Direct PCR | DNA PCR | |
| No maternal cell contamination (MCC) was observed | 64 (71.1) | 64 (71.1) |
| MCC could not be ruled out due to the homozygosity of the maternal VNTR | 12 (13.3) | 12 (13.3) |
| MCC could not be ruled out due to a similar pattern in the maternal VNTRs | 13 (14.4) | 13 (14.4) |
| Maternal contamination was observed | 1 (1.1) | 1 (1.1) |
| Total | 90 (100) | 90 (100) |
The heterogeneity of the VNTR in intron 10 of the TPO gene was also analyzed in 148 unrelated Thai samples. The findings revealed that heterozygosity, defined by the presence of two distinct VNTR fragment sizes, was observed in 87.8% of the samples (130/148), with a 95% confidence interval (CI) of 81.6%–92.2%. Conversely, homozygosity, indicated by a single VNTR fragment size, was identified in 12.2% of the samples (18/148), with a 95% CI of 7.8%–18.4%.
The direct PCR method for VNTR analysis of the TPO gene intron 10 was applied in routine practice for prenatal diagnosis of Hb E/β0‐thalassemia in a representative family from our center (Figure 2). The father was homozygous for Hb E (Hb EE), while the mother was a carrier of the βCD41/42 mutation. Based on their genotypes, the fetus had a 50% risk of inheriting Hb E/β0‐thalassemia, a severe condition (Figure 2A). The fetal amniotic fluid (AF) sample was analyzed using both the direct PCR method for β‐thalassemia mutation detection and VNTR analysis. The results showed that the fetus was affected and diagnosed with Hb E/β0‐thalassemia, with genotypes βCD41/42/βE. VNTR analysis confirmed the absence of maternal cell contamination (MCC), ensuring the accuracy of the prenatal diagnosis (Figure 2B). Using direct PCR to determine MCC through VNTR analysis provided a simple, rapid, and reliable diagnostic approach. The results demonstrated 100% concordance with routine DNA analysis. This method not only benefits the diagnosis of severe thalassemia but also holds potential for broader application in the prenatal diagnosis of other genetic diseases.
FIGURE 2.

Comprehensive identification of Hb E/β‐thalassemia disease in a representative family. (A) Illustrates the pedigree, hematological profiles, Hb type, and parental DNA analysis of the representative family. The father was homozygous for Hb E, while the mother was a carrier of βCD41/42. The arrow indicates the fetus, whose amniotic fluid specimen was collected at an unknown gestational age. Based on the parental thalassemia genotypes, the fetus was at risk of Hb E/β0‐thalassemia disease. (B) Presents the direct PCR results. The multiplex direct PCR for βCD41/42/βE revealed that the amniotic fluid specimen was positive for βCD41/42/βE. The direct VNTR analysis confirmed the absence of maternal cell contamination. As a result, the fetus was diagnosed with Hb E/β0‐thalassemia disease. The DNA marker used in this study was the VC 100 bp Plus DNA Ladder (Vivantis Technologies Sdn. Bhd., Selangor Darul Ehsan, Malaysia). (Generated by Microsoft PowerPoint for Mac, Version 16.89.1 (24091630), Microsoft Corporation).
4. Discussion
Variable number tandem repeats (VNTRs) are highly polymorphic DNA markers composed of repeats ranging from 10 to 100 base pairs. Due to their inheritance patterns, these markers are widely used in human identification, forensic science, and paternity testing [2, 6, 7, 8, 9]. The specific fragment size of the amplicon corresponds to the number of repeat copies, making VNTRs valuable genetic markers for analysis. VNTR polymorphisms vary across populations and are particularly useful for MCC testing in prenatal diagnosis (PND). Although short tandem repeats (STRs, 2–4 base pairs) analysis is highly sensitive and can detect MCC, VNTR was chosen due to practical limitations. STRs requires costly equipment and multiple‐loci kits, while VNTR uses simple agarose gel electrophoresis and a single locus, making it more affordable [19, 20]. The heterozygosity of VNTR at the TPO intron 10 region effectively distinguishes maternal from fetal DNA [10]. These advantages make it suitable for routine use in low‐resource laboratory settings.
A key component of PND is detecting maternal blood contamination in fetal samples to ensure accurate diagnosis. The most common approach for this purpose involves analyzing VNTR patterns inherited from both parents [10, 11, 12, 13, 14, 15]. However, current approaches for MCC detection rely exclusively on DNA‐based techniques, and no direct PCR method has been developed for this purpose.
The direct PCR technique has been developed for prenatal diagnosis and efficiently applies to whole blood and amniotic fluid samples from fetuses. This method is particularly useful for thalassemia gene testing, which plays a crucial role in controlling and preventing severe forms of the disease. Therefore, the development of a direct PCR method for VNTR analysis represents a significant advancement in PND. It offers a faster, simpler, and more cost‐effective approach to MCC detection compared to conventional DNA‐based techniques. This technique has the potential to enhance diagnostic accuracy, reduce laboratory turnaround time, and expand the applicability of VNTR analysis in genetic testing and prenatal care.
This study successfully developed and validated a direct PCR method for analyzing the VNTR in intron 10 of the TPO gene, tailored for MCC in prenatal diagnosis. The method was efficient for whole blood and amniotic fluid specimens without requiring DNA extraction. The whole blood specimens involved a simplified preparation process, and AF specimens required only centrifugation step. The white blood cell and AF pellets could be directly used in the PCR master mix with a high‐pH buffer developed at our center [17]. Whole blood and amniotic fluid specimens are known to contain various PCR inhibitors [21]. In this study, the use of a high‐pH PCR buffer significantly reduced the effects of these inhibitors. At high pH, the net charge of DNA‐binding proteins becomes negative, causing them to dissociate from the DNA, which facilitates efficient amplification during direct PCR [22]. Studies by Wang DY et al. and Park SJ et al. demonstrated the utility of Whatman FTA cards for direct PCR analysis of short tandem repeats (STR), enabling whole blood specimen collection and preparation for PCR without requiring DNA extraction [23, 24]. Similarly, Park et al. showed that whole blood specimens processed with distilled water could be directly incorporated into PCR master mixes for STR analysis [25]. These approaches, combined with the direct PCR method developed in this study, have potential for further research and expansion to other applications in genetic and prenatal diagnostics. Moreover, this study develops a direct PCR method for VNTR analysis using amniotic fluid specimens, representing a significant advancement in MCC detection for prenatal diagnosis. Therefore, the developed Direct PCR method can reduce laboratory costs and processing time by eliminating the need for DNA extraction kits for whole blood and amniotic fluid specimens, compared with the conventional DNA PCR method.
We propose this developed method as an additional tool to double‐check prenatal genetic diagnoses. It improves accuracy, reduces errors, and provides faster recommendations for further steps. Studies suggest that prenatal diagnosis should use at least two methods for better reliability [26]. Detecting maternal cell contamination is highly recommended for PND. Therefore, VNTR analysis is a valuable method for identifying maternal cell contamination and confirming paternity [27]. This approach can assist in deciding whether to re‐sample amniotic fluid, use alternative techniques, or try other diagnostic methods. Incorporating VNTR analysis ensures more accurate results, helping obstetricians make informed decisions for fetal care and treatment planning [1, 20, 25]. Its implementation could influence clinical practice by promoting more rapid, cost‐effective, and accessible genetic screening, especially in resource‐limited settings, and may contribute to the development of national guidelines or policies for prenatal genetic testing.
Additional information on the heterogeneity of VNTRs in the TPO gene intron 10 was observed in this study. Among unrelated parents, the heterogeneity of VNTRs was found to be 87.7%, with homozygosity at 12.3%. These findings differ from previous reports, which documented the heterozygosity rates of 66% in the Thai population [10] and 63.5% in the Italian population [18]. The higher heterozygosity observed in this study may be attributed to the larger sample size compared to earlier research. This highlights the significant potential of VNTR analysis of the TPO gene intron 10 for prenatal diagnosis and genetic testing in the Thai population. Although our method for analyzing MCC in PND specimens did not reach 100% informativeness, it demonstrated a high informative rate of 72.2%. To further improve the reliability of MCC analysis, additional studies investigating other VNTR polymorphisms using the direct method developed here are recommended.
However, several limitations should be acknowledged. Although a 100% amplification success rate was observed, this finding should be interpreted with caution. The sample size was limited to 90 families, and all assays were performed in a single research laboratory under standardized conditions with adequate specimen volume. These factors may not fully represent broader clinical or field settings. Larger‐scale studies, multi‐laboratory evaluations, or testing with more variable fetal specimens, including cord blood or limited‐volume samples, may reveal occasional amplification failures. Furthermore, while successful amplification from whole blood and amniotic fluid suggests reduced susceptibility to common PCR inhibitors, this work did not include quantitative inhibitor‐spiking or signal‐intensity experiments to formally assess inhibitory tolerance. In addition, the heterozygosity rate observed for the TPO intron 10 VNTR may differ across populations due to allele distribution variability. The current study did not determine a quantitative MCC detection threshold, and the minimum detectable proportion of maternal DNA remains unknown. Finally, automation and high‐throughput scalability of the direct PCR method were not assessed and should be explored in future research.
Beyond these limitations, it is important to consider how the direct PCR–VNTR approach compares with other established MCC detection methods. STR‐based and SNP‐based assays generally offer higher sensitivity for identifying low‐level maternal DNA admixture, often detecting contamination at levels as low as 1%–5% [28, 29]. In contrast, the direct PCR method provides a qualitative, pattern‐based assessment and is less suited for detecting very low‐level MCC. However, the direct PCR assay offers notable advantages in simplicity, turnaround time, and cost, making it particularly suitable for settings that prioritize rapid screening and where high technical complexity may represent a limitation for implementation.
In conclusion, the direct PCR technique developed for VNTR analysis of the TPO gene intron 10 locus is simple, reliable, and compatible with DNA PCR. Additionally, the method requires only basic preparation steps for whole blood and amniotic fluid specimens, eliminating the need for DNA extraction. As a result, this technique has the potential to serve as an alternative method for detecting MCC in routine prenatal diagnosis practices by promoting more rapid, cost‐effective, and accessible genetic screening, especially in resource‐limited settings.
Author Contributions
Phongsathorn Wichian and Supawadee Yamsri wrote the manuscript; Supawadee Yamsri designed the research; Phongsathorn Wichian, Apisit Pattrakorn, and Simaporn Prommetta performed the research; Phongsathorn Wichian and Hataichanok Srivorakun analyzed the data; Supan Fucharoen and Supawadee Yamsri contributed new reagents/analytical tools.
Funding
This research was funded by the Young Researcher Development Project of Khon Kaen University, Thailand (2024), awarded to Phongsathorn Wichian (PW).
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
The authors gratefully acknowledge the Centre for Research and Development of Medical Diagnostic Laboratories, Faculty of Associated Medical Sciences, Khon Kaen University, for providing laboratory facilities and technical assistance. We also thank all researchers and laboratory personnel for their contributions to specimen collection, processing, and data analysis. Generative AI tools were used only for language refinement. All scientific content was created and verified by the authors.
Wichian P., Pattrakorn A., Fucharoen S., Srivorakun H., Prommetta S., and Yamsri S., “Direct PCR‐Based VNTR Analysis of TPO Intron 10 for Rapid Detection of Maternal Cell Contamination in Prenatal Diagnosis,” Clinical and Translational Science 19, no. 1 (2026): e70474, 10.1111/cts.70474.
References
- 1. Li D. Z. and Yang Y. D., “Invasive Prenatal Diagnosis of Fetal Thalassemia,” Best Practice & Research. Clinical Obstetrics & Gynaecology 39 (2017): 41–52. [DOI] [PubMed] [Google Scholar]
- 2. Smith G. W., Graham C. A., Nevin J., and Nevin N. C., “Detection of Maternal Cell Contamination in Amniotic Fluid Cell Cultures Using Fluorescent Labelled Microsatellites,” Journal of Medical Genetics 32, no. 1 (1995): 61–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Litt M. and Luty J. A., “A Hypervariable Microsatellite Revealed by In Vitro Amplification of a Dinucleotide Repeat Within the Cardiac Muscle Actin Gene,” American Journal of Human Genetics 44, no. 3 (1989): 397–401. [PMC free article] [PubMed] [Google Scholar]
- 4. Hamada H., Petrino M. G., and Kakunaga T., “A Novel Repeated Element With Z‐DNA‐Forming Potential Is Widely Found in Evolutionarily Diverse Eukaryotic Genomes,” Proceedings of the National Academy of Sciences of the United States of America 79, no. 21 (1982): 6465–6469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Vergnaud G. and Pourcel C., “Multiple Locus Variable Number of Tandem Repeats Analysis,” Methods in Molecular Biology 551 (2009): 141–158. [DOI] [PubMed] [Google Scholar]
- 6. Trabetti E., Galavotti R., and Pignatti P. F., “Genetic Variation in the Italian Population at Five Tandem Repeat Loci Amplified In Vitro: Use in Paternity Testing,” Molecular and Cellular Probes 7, no. 1 (1993): 81–87. [DOI] [PubMed] [Google Scholar]
- 7. Wall W. J., Williamson R., Petrou M., Papaioannou D., and Parkin B. H., “Variation of Short Tandem Repeats Within and Between Populations,” Human Molecular Genetics 2, no. 7 (1993): 1023–1029. [DOI] [PubMed] [Google Scholar]
- 8. Gill P., Ivanov P. L., Kimpton C., et al., “Identification of the Remains of the Romanov Family by DNA Analysis,” Nature Genetics 6, no. 2 (1994): 130–135. [DOI] [PubMed] [Google Scholar]
- 9. Edwards A., Hammond H. A., Jin L., Caskey C. T., and Chakraborty R., “Genetic Variation at Five Trimeric and Tetrameric Tandem Repeat Loci in Four Human Population Groups,” Genomics 12, no. 2 (1992): 241–253. [DOI] [PubMed] [Google Scholar]
- 10. Singsanan S., Yamsri S., Pangjit K., Saenwang P., Karnpean R., and Fucharoen S., “Five Variable Number of Tandem Repeats Loci (D17S5, APOB, TPO Intron 10, IL‐1α Intron 6, and CIAS1) in Thais and Application in the Prenatal Diagnostic Laboratory,” Genetic Testing and Molecular Biomarkers 26, no. 6 (2022): 324–330. [DOI] [PubMed] [Google Scholar]
- 11. Thakur C., Vaz F., Banerjee M., et al., “Prenatal Diagnosis of Beta‐Thalassaemia and Other Haemoglobinopathies in India,” Prenatal Diagnosis 20 (2000): 194–201. [PubMed] [Google Scholar]
- 12. Sachdeva M. P., Mastana S. S., Saraswathy K. N., Elizabeth A. M., Chaudhary R., and Kalla A. K., “Genetic Variation at Three VNTR Loci (D1S80, APOB, and D17S5) in Two Tribal Populations of Andhra Pradesh, India,” Annals of Human Biology 31, no. 1 (2004): 95–102. [DOI] [PubMed] [Google Scholar]
- 13. Budowle B., Chakraborty R., Giusti A. M., Eisenberg A. J., and Allen R. C., “Analysis of the VNTR Locus D1S80 by the PCR Followed by High‐Resolution PAGE,” American Journal of Human Genetics 48, no. 1 (1991): 137–144. [PMC free article] [PubMed] [Google Scholar]
- 14. Antoniadi T., Yapijakis C., Kaminopetros P., et al., “A Simple and Effective Approach for Detecting Maternal Cell Contamination in Molecular Prenatal Diagnosis,” Prenatal Diagnosis 22, no. 5 (2002): 425–429. [DOI] [PubMed] [Google Scholar]
- 15. Attila G., Yalin S., Tuli A., Yalin E., and Aksoy K., “Prenatal Diagnosis of Sickle Cell Anemia in Twin Pregnancies and Identification by VNTRs,” Clinica Chimica Acta 350, no. 1–2 (2004): 137–142. [DOI] [PubMed] [Google Scholar]
- 16. Wichian P., Yamsri S., Sanchaisuriya K., and Fucharoen S., “Direct Amplification of Whole Blood and Amniotic Fluid Specimens for Prenatal and Postnatal Diagnosis of Hb E‐β0‐Thalassemia Diseases,” Laboratory Medicine 52, no. 4 (2021): e92–e99. [DOI] [PubMed] [Google Scholar]
- 17. Wichian P., Yamsri S., Sanchaisuriya K., Fucharoen G., and Fucharoen S., “Whole Blood PCR for Rapid Screening of Alpha(0)‐Thalassemia,” Annals of Clinical and Laboratory Science 48, no. 2 (2018): 231–235. [PubMed] [Google Scholar]
- 18. Rose G., De Luca M., Falcone E., Giacchetto C., and De Benedictis G., “Rapid Identification of VNTR Alleles of the Human Thyroid Peroxidase Gene by PCR: A Study in a Population Sample From South Italy,” Genomics 17, no. 3 (1993): 796–798. [DOI] [PubMed] [Google Scholar]
- 19. Sharifi Z., Rahiminejad F., Joudaki A., et al., “Development and Validation of a Novel Panel of 16 STR Markers for Simultaneous Diagnosis of Beta‐Thalassemia, Aneuploidy Screening, Maternal Cell Contamination Detection and Fetal Sample Authenticity in PND and PGD/PGS Cases,” Scientific Reports 9, no. 1 (2019): 7452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Nagan N., Faulkner N. E., Curtis C., Schrijver I., and Committee MGWGotAfMPCP , “Laboratory Guidelines for Detection, Interpretation, and Reporting of Maternal Cell Contamination in Prenatal Analyses a Report of the Association for Molecular Pathology,” Journal of Molecular Diagnostics 13, no. 1 (2011): 7–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Opel K. L., Chung D., and McCord B. R., “A Study of PCR Inhibition Mechanisms Using Real Time PCR,” Journal of Forensic Sciences 55, no. 1 (2010): 25–33. [DOI] [PubMed] [Google Scholar]
- 22. Bu Y., Huang H., and Zhou G., “Direct Polymerase Chain Reaction (PCR) From Human Whole Blood and Filter‐Paper‐Dried Blood by Using a PCR Buffer With a Higher pH,” Analytical Biochemistry 375, no. 2 (2008): 370–372. [DOI] [PubMed] [Google Scholar]
- 23. Wang D. Y., Chang C. W., Lagacé R. E., Oldroyd N. J., and Hennessy L. K., “Development and Validation of the AmpFℓSTR Identifiler Direct PCR Amplification Kit: A Multiplex Assay for the Direct Amplification of Single‐Source Samples,” Journal of Forensic Sciences 56, no. 4 (2011): 835–845. [DOI] [PubMed] [Google Scholar]
- 24. Park S. J., Kim J. Y., Yang Y. G., and Lee S. H., “Direct STR Amplification From Whole Blood and Blood‐ or Saliva‐Spotted FTA Without DNA Purification,” Journal of Forensic Sciences 53, no. 2 (2008): 335–341. [DOI] [PubMed] [Google Scholar]
- 25. Lamb A. N., Rosenfeld J. A., Coppinger J., et al., “Defining the Impact of Maternal Cell Contamination on the Interpretation of Prenatal Microarray Analysis,” Genetics in Medicine 14, no. 11 (2012): 914–921. [DOI] [PubMed] [Google Scholar]
- 26. Karnpean R., Fucharoen G., Fucharoen S., Sae‐ung N., Sanchaisuriya K., and Ratanasiri T., “Accurate Prenatal Diagnosis of Hb Bart's Hydrops Fetalis in Daily Practice With a Double‐Check PCR System,” Acta Haematologica 121, no. 4 (2009): 227–233. [DOI] [PubMed] [Google Scholar]
- 27. Schrijver I., Cherny S. C., and Zehnder J. L., “Testing for Maternal Cell Contamination in Prenatal Samples: A Comprehensive Survey of Current Diagnostic Practices in 35 Molecular Diagnostic Laboratories,” Journal of Molecular Diagnostics 9, no. 3 (2007): 394–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Stojilkovic‐Mikic T., Mann K., Docherty Z., and Mackie Ogilvie C., “Maternal Cell Contamination of Prenatal Samples Assessed by QF‐PCR Genotyping,” Prenatal Diagnosis 25, no. 1 (2005): 79–83. [DOI] [PubMed] [Google Scholar]
- 29. Sharifi Z., Rahiminejad F., Joudaki A., et al., “Development and Validation of a Novel Panel of 16 STR Markers for Simultaneous Diagnosis of β‐Thalassemia, Aneuploidy Screening, Maternal Cell Contamination Detection and Fetal Sample Authenticity in PND and PGD/PGS Cases,” Scientific Reports 9 (2019): 7452. [DOI] [PMC free article] [PubMed] [Google Scholar]
