TABLE 2.
Features of etd pathogenicity island ORFs
ORF no. | Gene | Location (bp) | G+C content (%) | Size (aa) | Translation signala | Homologue as determined by BLAST and/or FASTA
|
||||
---|---|---|---|---|---|---|---|---|---|---|
Source | Description | Identity (%) | Overlap (aa) | Accession no. | ||||||
4 | IS256 | 1089-2261 | 36.57 | 390 | AGGAGGACTTTTACATG | S. aureus | IS256 | 100 | 390/390 | P19775 |
5 | hsdS | 2393-3613 | 28.75 | 406 | GGGGTGTTGAAAGATG | S. aureus N315 | Probable restriction-modification system specificity subunit | 37 | 30/403 | BAB41621.1 |
6 | hsdM | 3606-5162 | 38.66 | 518 | GGAGGAATCACATG | S. aureus N315 | Probable type 1 site-specific DNase Lldl chain HsdM | 98 | 518/518 | BAB41620.1 |
1 | etd | 5409-6254 | 31.21 | 281 | AAGGAGTTTTATTATG | S. aureus | ETB | 66 | 267/268 | AB036767 |
2 | orf5 | 6410-7108 | 30.76 | 233 | GAGGTGTAAATTGTG | B. intermedius | Glutamyl endopeptidase | 25 | 186/303 | CAC17594.1 |
3 | edin-B | 7154-7897 | 31.32 | 247 | GGAGATGAATTTAAATATG | S. aureus | EDIN-B | 99 | 212/212 | AJ277173 |
7 | orf7 | 8082-9914 | 24.28 | 610 | TAAGGGATGATTAGAAAATATG | L. lactis | AbiK | 46 | 519/599 | AAB53491.2 |
8 | orf8 | 9979-10800 | 30.29 | 273 | GGAGGAATGAGTATG | S. aureus N315; SA2005 | Conserved hypothetical protein | 98 | 271/271 | BAB43296.1 |
9 | orf9 | 11088-11513 | 30.75 | 141 | AAGGAGATTGAGATATG | S. aureus N315; SA2006 | Hypothetical protein, similar to major histocompatibility complex class II analogue | 99 | 141/141 | BAB43297.1 |
10 | orf10 | 11887-12591 | 33.76 | 234 | GGAAATTTTATG | S. aureus N315; SA2007 | Hypothetical protein, similar to alpha-acetolactate decarboxylase | 97 | 234/234 | BAB43298.1 |
11 | orf11 | 12628-14292 | 35.2 | 554 | GGAAATGAATATAAATG | S. aureus N315; SA2008 | Alpha-acetolactate synthase | 98 | 554/554 | BAB43299.1 |
Underlining indicates the putative ribosomal binding site; boldface indicates the start codon.