Summary
Convolvulus pluricaulis (shankhpushpi) is a traditional herb used to treat depression and anxiety. Using Drosophila melanogaster as a model, we identified conserved metabolic and molecular pathways mediating its neuroprotective effects. Metabolomic profiling of flies fed C. pluricaulis revealed altered levels of ascorbic acid, glucose, and adenine monophosphate in the head tissue. Gene expression analysis showed significant modulation of Glut1 (glucose transporter 1), CG6293 (ascorbate transporter), Rdl (resistant to dieldrin), GABA-B-R1 (GABA-B receptor 1), and Sod1 (superoxide dismutase 1). Dietary C. pluricaulis reduced depression-like behavior in a stress-induced model and elevated head ascorbate levels. Knockdown of CG6293, Sod1, Glut1, or GABA-B-R1 abolished the antioxidant effects, and knockdown of CG6293 eliminated the antidepressant effects, implicating these genes as key downstream effectors. Supplementation with L-ascorbic acid mimicked the behavioral and oxidative resilience conferred by C. pluricaulis. Together, these findings reveal conserved antioxidant and anxiolytic mechanisms underlying the pharmacological effects of C. pluricaulis in Drosophila.
Subject areas: Neuroscience
Graphical abstract

Highlights
-
•
C. pluricaulis alleviates stress-induced depression-like behavior in Drosophila
-
•
C. pluricaulis intake modulates the expression of antioxidant and GABAergic genes
-
•
C. pluricaulis diet enhanced oxidative stress resistance in Drosophila
-
•
Intake of L-ascorbic acid mimics the beneficial effects of the C. pluricaulis diet
Neuroscience
Introduction
Depression and anxiety are widespread neuropsychiatric disorders that severely affect patients’ quality of life due to frequent relapses and remissions.1,2,3 The symptoms of depression include behavioral despair, anhedonia, helplessness, fatigue, and sleep disturbances. Several hypotheses have been proposed for the pathogenesis of depression. These include abnormal expression of neurotransmitters and their receptors, as well as dysregulation of the immune system and inflammation.4,5 Oxidative stress and dysfunction of the hypothalamic-pituitary-adrenal axis are also implicated.6,7 Additional mechanisms involve reduced levels of neurotrophic factors, alterations in gut microbiota, mitochondrial dysfunction, and impaired neuroplasticity that disrupt neuronal connectivity.8,9,10,11,12,13,14,15,16,17
Current pharmacological interventions for depression and anxiety primarily target the monoaminergic neurotransmitter systems. The most commonly prescribed drugs include selective serotonin reuptake inhibitors (SSRIs) such as fluoxetine, sertraline, and citalopram; serotonin-norepinephrine reuptake inhibitors (SNRIs) such as venlafaxine and duloxetine; tricyclic antidepressants such as amitriptyline and imipramine; and monoamine oxidase inhibitors such as phenelzine and tranylcypromine.18,19 For anxiety disorders, benzodiazepines (diazepam and lorazepam), buspirone, and certain SSRIs/SNRIs are commonly used.20,21,22 Although these agents are effective for some patients, they display several limitations, including delayed onset of action (typically 4–6 weeks), incomplete symptom remission, and a high rate of relapse.23,24 Moreover, adverse effects such as sedation, weight gain, sexual dysfunction, gastrointestinal disturbances, and dependence significantly reduce patient adherence.21,25 Importantly, nearly 30%–50% of patients with major depressive disorder (MDD) fail to respond adequately to first-line antidepressants, highlighting the urgent need for novel therapeutic strategies that target the molecular, cellular, and epigenetic mechanisms underlying these disorders.26,27
Given the limited efficacy and adverse side effects associated with existing pharmacological treatments, there has been growing interest in exploring natural plant-based alternatives with fewer side effects and multifactorial mechanisms of action.28,29 These are complex phytochemical mixtures that contain one or more bioactive compounds that could potentially modulate neurotransmitter systems, oxidative stress pathways, and neuroinflammatory responses, thus providing a single plant extract with multiple beneficial properties.30,31 Among these, Convolvulus pluricaulis Choisy, commonly known as shankhpushpi in Ayurvedic medicine, is traditionally used as a cognitive and nervine tonic that ameliorates symptoms of anxiety, insomnia, and depression in folk medicine.32,33,34,35,36,37,38,39 Preclinical studies in rodents have demonstrated that C. pluricaulis extracts exert antidepressant-like effects in the forced swim and tail suspension tests, probably involving interactions with monoaminergic (serotonin, dopamine, and adrenergic) systems.38 In another study, the aerial parts of C. pluricaulis mitigated depressive behavior induced by chronic unpredictable mild stress in rats, along with suppression of pro-inflammatory cytokines and restoration of monoamine levels in the hippocampus and prefrontal cortex.40 Additionally, its antioxidant potential (e.g., scavenging free radicals and enhancing superoxide dismutase [Sod] and catalase activity) and neuroprotective effects (e.g., reducing lipid peroxidation and oxidative stress) have been reported in ischemia-reperfusion injury models of rats and in tauopathy models of Drosophila.41 Dietary administration of C. pluricaulis to scopolamine-treated Wistar rats reduced Aβ levels and exerted a neuroprotective effect at the tissue level.42 Chronic administration counteracts aluminium-induced neurotoxicity, normalizes the activity of acetylcholinesterase and antioxidant enzymes, and prevents the accumulation of lipid and protein damage.43 C. pluricaulis also shows systemic metabolic benefits, such as reduction of lipid abnormalities in high-fat diet and streptozotocin-treated rat models, and modulates adipocyte differentiation in cellular models.44,45 Some of the broad classes of phytoconstituents that have been identified in C. pluricaulis include vitamin E, ascorbic acid, phthalic acid, squalene, silane, decanoic acid, linoleic acid, tropane alkaloids, kaempferol, beta-sitosterol, pentanoic acid, and cinnamic acid.46,47
Despite the availability of phytochemical information regarding the constituents of this medicinal extract, the precise molecular targets and pathways modulated by these phytochemicals remain to be elucidated. Many plant-derived actives function as prodrugs, but they require conversion to active metabolites that are pharmacologically available. Tissue-level absorption, metabolism, transport across blood-brain barrier, conjugation, and excretion determine the systemic and CNS-specific exposure of the relevant components of the plant extract upon dietary administration. Despite its rich pharmacological footprint and well-characterized phytochemistry, the biotransformation pathways, bioavailability, metabolite profiles, and molecular targets of its constituents in vivo remain undefined. This gap poses a significant obstacle to the translation of traditional wisdom into mechanistically grounded therapeutics.
To address this gap, we deployed the genetically tractable model Drosophila melanogaster to dissect metabolic and molecular targets underlying C. pluricaulis’s beneficial effects. Using metabolomic profiling, gene expression analysis, and genetic knockdowns, we reveal key players, including ascorbic acid, glucose metabolism, antioxidant enzymes, transporters, and GABAergic signaling, in mediating antidepressant and antioxidant effects. This approach bridges traditional usage with mechanistic insights, potentially guiding the development of more precise interventions.
Results
Short variable stress induces anhedonia in D. melanogaster
To establish a model for assessing the psychopharmacological properties of C. pluricaulis, we optimized a protocol for inducing stress in both male and female adult flies. This protocol combined psychosocial and physical stressors to induce anhedonia-like behavior, resembling a depression-like state. Three- to five-day-old flies were sorted according to sex and subjected to a stress regime consisting of heat shock at 37°C, fasting, social isolation, and cold shock at −5°C (Figure 1A). Following exposure to the stress regime, unstressed control flies and stressed flies were offered a choice between 5% sucrose and water, and their anhedonia was tested through the sucrose preference test (SPT) for 3 h. Anhedonia is the lack of interest in enjoyment or pleasure, which is a typical symptom of a depression-like state.48 Wild-type male and female flies respond to the stress regime by showing reduced preference for sucrose (preference index [PI] dropped from 0.4754 ± 0.3343 to −0.2812 ± 0.4080 in males and from 0.5427 ± 0.2739 to −0.4668 ± 0.3593 in females), indicating disinterest in reward-seeking activities (Figures 1B and 1C; panels 1, 3). SSRIs are known to reverse depression-like behaviors by binding to pre-synaptic neurons and enhancing serotonin signaling in the brain. Fluoxetine is one such SSRI known to relieve depression-like behavior in mice and humans, and we wanted to assess its effects on behavior in response to our stress regime in flies. To ensure that this behavior was reversible and a response to the stress regime alone, we administered 10 mM fluoxetine to stressed flies and tested their behavior in the SPT. Fluoxetine administration led to the reversal of anhedonia in stressed male and female Canton S flies (PI in the treated flies increased from −0.1492 ± 0.2055 to 0.4406 ± 0.1097 in males and from −0.05587 ± 0.3674 to 0.8679 ± 0.09840 in females upon exposure to fluoxetine). Their preference levels recapitulated the values obtained for unstressed flies (Figures 1B and 1C, panels 2, 3).
Figure 1.
Administration of Convolvulus pluricaulis ameliorates stress-induced anhedonia in wild-type flies
(A) A schematic diagram representing the stress regime for inducing a depression-like state in Drosophila melanogaster. Three- to five-day-old flies were exposed to a stress regime comprising heat shock at 37°C (20 min for males and 30 min for females), fasting (6 h for males and 8 h for females), 18 h of social isolation, and cold shock at −5°C (10 min for males and 20 min for females), following which the sucrose preference test (SPT) was performed for 3 h.
(B and C) The preference index of male Canton S flies (B) and female Canton S flies (C). Each circle represents the preference index using 10 flies. The boxplots show the mean, and the box spans from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points. Panel 1 represents control (Ctrl) flies that were not exposed to stress, panel 2 represents flies that were exposed to a stress regime and treated (Trd), and Panel 3 represents flies that were treated with 10 mM fluoxetine followed by exposure to a stress regime (Trd + Flx).
(D and E) The latency to first immobility/swimming time (seconds) of male Canton S flies (D) and female Canton S flies (E). Each circle represents the latency to first immobility using a single fly. Statistical significance was determined using a one-way ANOVA. Adjusted p values after applying Bonferroni’s correction are represented, and we used an α level of 0.05 to assess statistical significance.
(F) The experimental scheme utilized to determine the impact of C. pluricaulis in the stress-induced depression model. Canton S flies were fed C. pluricaulis throughout their development and adulthood (E, embryonic stage; L, larval stage; A, adult stage). Three- to five-day-old flies were subjected to a stress regime, and their anhedonia-like behavior was measured using the SPT.
(G and H) Male (G) and female (H) Canton S flies consume comparable amounts of normal fly food and 50× C. pluricaulis-supplemented food. Food intake was measured by Ex-Q assay. Each data point represents a group of 10 flies. Data are represented as the mean ± SD, n = 6. p value was calculated using the unpaired t test with Welch’s correction.
(I and J) 50× C. pluricaulis-fed male (I) and female (J) Canton S flies exposed to the stress regime, showing a positive preference index, indicating more sucrose consumption and decreased anhedonia in comparison to the stress-exposed control flies raised on regular fly food, showing lower preference index indicating anhedonia. Each data point for the SPT represents a group of 10 flies.
(K and L) 50× C. pluricaulis-fed male (K) and female (L) Canton S flies exposed to the stress regime, showing increased latency time to first immobility bout, indicating decreased despair-like phenotype in comparison to the stress-exposed control flies raised on regular fly food, showing a lower latency time to first immobility, indicating a despair-like state. The boxplots show the median, and the box spans from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points, and we used an α level of 0.05 to assess statistical significance. ∗p < 0.05, ∗∗∗p < 0.005, and ∗∗∗∗p < 0.0005 by Student’s t test.
See also Figure S1.
To complement the SPT and further validate depression-like phenotypes in Drosophila, we employed a forced swimming test (FST) adapted for flies.49,50 This assay quantifies behavioral despair by measuring the latency to immobility in an aqueous column, providing an independent index of the motivational state and stress-coping behavior. Both male and female flies that were exposed to the stress regime exhibited a significant reduction in latency to immobility (immobility time decreased from 617.33 ± 111.73 to 354.33 ± 52.44 s in males and from 736.33 ± 101.09 to 543.83 ± 119.62 s in females) (Figures 1D and 1E, panels 1, 2). Fluoxetine administration led to a reversal of the despair-like phenotype and an increase in latency to immobility (swimming time increased from 354.33 ± 52.44 to 793.33 ± 145.94 s in males and from 543.83 ± 119.62 to 897.33 ± 80.33 s in females) (Figures 1D and 1E, panels 2, 3). Thus, we found that administering 10 mM fluoxetine for 18 h during the social isolation period resulted in relief from depression-like behavior in wild-type flies. This amelioration of the variable stress-induced phenotype suggests that evolutionarily conserved biochemical pathways are involved in the depressive state of flies and MDD in humans and that this model could be utilized for studying the effects of other pharmacological interventions and the underlying conserved genetic players.
Dietary administration of C. pluricaulis alleviates stress-induced anhedonia and despair-like phenotype in Drosophila
To understand the effect of dietary intake of C. pluricaulis on stress-responsive behavior, we administered two different dosages of C. pluricaulis-supplemented regular fly food to wild-type Canton S flies throughout the developmental period and adulthood. Three- to five-day-old flies were sorted according to sex and subjected to a short variable stress regime (Figure 1F). To ensure this effect was due to administration of C. pluricaulis alone and not due to altered food consumption upon C. pluricaulis supplementation, we measured the food intake of flies by performing the excreta-quantification (Ex-Q) assay to measure food intake per fly. We found that supplementation of 25× or 50× C. pluricaulis in fly food did not affect food consumption of Canton S male and female flies (Figures 1G, 1H, S1A, and S1B). Following exposure to the stress regime, control flies raised on a standard fly diet and C. pluricaulis-fed flies were offered a choice between 5% sucrose and water. Their anhedonia-like behavior was tested through the SPT (Figures 1G, 1H, S1C, and S1D). Dosage was calculated according to the recommended intake prescribed to human beings, standardized to approximate the body weight of flies. We found that dietary supplementation of 25× C. pluricaulis extract in regular fly food resulted in alleviation of anhedonia in male Canton S flies. At the same time, no significant effect was observed in female flies (Figures S1C and S1D). We further increased the dosage of C. pluricaulis to 50× and found that both male and female Canton S flies raised on 50× C. pluricaulis-supplemented food showed relief from anhedonia, as they preferred sucrose over water, compared to their control counterparts raised on regular fly food and exposed to stress. These control flies lost their preference for sucrose upon exposure to a psychosocial and physical stress regime, indicating an anhedonia-like state. At the same time, C. pluricaulis extract administration alleviated this stress-induced anhedonia-like behavior (PI increased from −0.3257 ± 0.1341 to 0.3663 ± 0.2936 in males and from −0.1801 ± to 0.1199 ± 0.03973 in females that were administered the Shankhpushpi-supplemneted [Sh] diet) (Figures 1I and 1J).
The observed sexually dimorphic behavioral response to C. pluricaulis supplementation, where male flies exhibited behavioral resilience at lower concentrations (25×) while females required higher doses (50×) for comparable rescue, suggests that underlying physiological and molecular sex differences modulate the extract’s efficacy. Studies have demonstrated that Drosophila demonstrates sexually dimorphic behavioral responses to stress, which may relate to female versus male reproductive demands and drive.51 Some of the mechanisms that may be responsible for the physiological differences include sex differences in gut physiology and higher lipid storage in females that could alter the availability of lipophilic phytochemicals.52 Key neurotransmitter systems implicated in stress and reward, such as dopaminergic and GABAergic pathways, are sexually dimorphic, and differential sensitivity of dopaminergic receptors or differences in receptor expression may account for differences in behavioral responses.53 The interactions between these pathways could produce the observed sex-specific dose-response relationships. It is likely that male flies reach the effective neural concentration of active C. pluricaulis-derived metabolites at a lower dietary dose due to lower metabolic clearance and heightened neural sensitivity, while female flies require higher doses to overcome physiological and metabolic buffering.
Administration of 50× C. pluricaulis extract also reversed the despair-like phenotypes observed in both male and female flies exposed to the stress regime. Intake of C. pluricaulis led to an increase in latency to immobility (swimming time increased from 367.37 ± 226.39 to 687.62 ± 218.12 s in males and from 410.11 ± 245.23 to 842.33 ± 260.78 s in females) (Figures 1K and 1L). These results indicate that C. pluricaulis has antidepressant properties when administered at 50× concentration in wild-type flies.
Changes in the metabolome upon intake of C. pluricaulis
To determine how C. pluricaulis intake impacts metabolism in the brain and the rest of the body, we performed small-molecule gas chromatography-mass spectrometry (GC-MS) analysis with head and decapitated body tissue of wild-type Canton S flies that were fed a control diet or a diet supplemented with C. pluricaulis for 20 days (Figures 2 and S2). This metabolomic approach revealed that the intake of C. pluricaulis led to a significant increase in L-ascorbic acid, adenosine monophosphate, myristic acid, and D-glucose in the head tissue (Figures 2A–2H). Principal-component analysis (PCA) revealed that the metabolomes of the head tissue show no overlap between their confidence intervals (Figure 2B). To determine the factors driving the metabolomic differences between the control and C. pluricaulis-fed flies, we used correlation analysis to identify metabolites altered in response to elevated L-ascorbate levels (Figure 2D). This approach revealed that L-ascorbate levels positively correlate with the abundance of D-glucose, L-sorbose, ethanolamine, adenosine monophosphate, and myristic acid. In contrast, concentrations of fumaric acid, succinic acid, and D-malic acid as well as amino acids such as L-proline and L-aspartic acid displayed inversely proportional relationships with L-ascorbic acid (Figure 2D).
Figure 2.
Metabolomic analysis of the head tissue extract of C. pluricaulis-fed wild-type flies
Canton S flies (females) were fed on a control diet or a diet supplemented with C. pluricaulis for 20 days. The head tissue was dissected and analyzed using GC-MS.
(A) Heatmap showing the top 30 significantly altered metabolites in the head tissue of C. pluricaulis-fed (Sh) wild-type flies in comparison to flies raised on control diet (Ctrl). Metabolomics analysis was performed using four biological replicates for both the control and C. pluricaulis diet-fed groups.
(B) Projection of C. pluricaulis and control metabolite samples onto principal components 1 and 2 (PC1 vs. PC2), explaining 46% and 14.29% of variance, respectively. Red points indicate regular fly food-fed controls, and green points indicate metabolites in C. pluricaulis-fed flies.
(C) Volcano plot showing significantly upregulated and downregulated metabolites in C. pluricaulis-fed flies compared to control flies.
(D) Correlation analysis of the metabolites associated with L-ascorbate. Top 25 metabolites correlated with L-ascorbate levels across samples.
(E–H) L-ascorbic acid, adenosine monophosphate, myristic acid, and D-glucose levels are significantly increased in the head tissue of C. pluricaulis-fed flies in comparison to controls. Error bars indicate the mean ± S.D. ∗p < 0.05 by Student’s t test.
See also Figure S2.
In contrast, no significant changes were observed in the metabolome of the decapitated body tissue of flies that were fed a C. pluricaulis-supplemented diet for 20 days (Figures S2A–S2F). The PCA revealed that the metabolome of the decapitated body tissue of flies that were administered C. pluricaulis-diet was like the metabolome of flies that were fed a control diet lacking C. pluricaulis (Figure S2E). D-fructose, glyceraldehyde-3-phosphate, and a plant-derived metabolite, eicosane, were found to be upregulated in the C. pluricaulis group and were not investigated further. These data are consistent with those of previous studies that have confirmed the neuropharmacological properties of this extract. The effect of L-ascorbate supplementation has been tested in several studies, which have shown that it can function as both an antioxidant and a neuromodulator in the treatment of depression.54 We predicted that at least some of the beneficial effects were mediated by the increase in L-ascorbate levels. Hence, we examined whether the expression of genes that facilitate L-ascorbate accumulation in the brain was modulated by C. pluricaulis intake.
Effect of C. pluricaulis diet on gene expression
C. pluricaulis intake leads to a significant increase in L-ascorbic acid and D-glucose levels in the brain tissue. Hence, we examined the expression of genes associated with increased expression and transport of the physiological form of L-ascorbic acid, L-ascorbate (CG6293, GABA-B receptor 1 [GABA-B-R1], and resistant to dieldrin [Rdl]), D-glucose (glucose transporter 1 [Glut1]), and genes involved in the antioxidant effects (superoxide dismutase 1 [Sod1]) in the brain (Figure 3).55 We predicted that if some of the beneficial effects of C. pluricaulis were mediated by conserved metabolic pathways, then changes in the expression of genes regulating these pathways would be observed upon intake of C. pluricaulis compared to the control diet. Total RNA was extracted from the head and body (without head) tissues of wild-type (Canton S) flies that were fed a control or C. pluricaulis-supplemented diet for 10 days, and reverse-transcription PCR (RT-PCR) was performed to quantify expressions of CG6293, Glut1, Sod1, Rdl, and GABA-B-R1 in the head tissue. Gene expression analysis in the head tissue was performed after feeding three different concentrations of C. pluricaulis (10×, 25×, and 100×), while only the highest concentration was tested for the body tissue (100×). Wild-type flies that were fed a C. pluricaulis-formulated diet for 10 days expressed significantly higher levels of CG6293 in the head tissue at all three concentrations tested (Sh vs. Ctrl [10×]: 2.34 ± 1-fold increase; Sh vs. Ctrl [25×]: 1.62 ± 0.35-fold increase; Sh vs. Ctrl [100×]: 1.74 ± 0.49-fold increase) (Figures 3A–3F and 3K). The Drosophila gene CG6293 has been predicted to be involved in the transmembrane transport of L-ascorbate. It is orthologous to SLC23A1 (solute carrier family 23 member 1) and SLC23A2 (solute carrier family 23 member) in humans and codes for two isoforms of the sodium-dependent vitamin C transporters, SVCT1 and SVCT2, respectively. SVCT1 is the predominant carrier of ascorbic acid in the intestine, and SVCT2 is primarily responsible for transporting ascorbic acid in the brain.56 We also examined the expression of two other genes, GABA-B-R1 (Sh vs. Ctrl [10×]: 1.43 ± 0.56-fold increase; Sh vs. Ctrl [25×]: 1.65 ± 0.35-fold increase; Sh vs. Ctrl [100×]: 1.25 ± 0.12-fold increase) and Rdl (Sh vs. Ctrl [10×]: 1.49 ± 0.43-fold increase; Sh vs. Ctrl [25×]: 1.38 ± 0.29-fold increase; Sh vs. Ctrl [100×]: 1.67 ± 0.38-fold increase), which have been linked to ascorbate homeostasis, and both were found to be upregulated upon administration of C. pluricaulis (Figures 3C, 3D, 3H, 3I, 3M, and 3N). While the levels of Rdl increased at all three concentrations of the C. pluricaulis extract, GABA-B-R1 levels were significantly increased only at higher concentrations (25× and 100×). Previous metabolomic studies conducted in humans have linked L-ascorbate to GABAergic signaling in depression-like states.57 L-ascorbate has been shown to enhance the function of GABA receptors in the retina.58 Drosophila Rdl codes for a subunit of the GABAA receptor and has been implicated in modulating olfactory learning and regulating sleep.59 GABA-B-R1 is a receptor known to play an essential role in olfactory perception in Drosophila. Consistent with previous studies in Drosophila that have linked ascorbate intake to increased GABA-B-R1 expression, we found that the intake of C. pluricaulis for 10 days led to a significant but moderate increase in the expression of both GABA-B-R1 and Rdl in the head tissue. Next, we examined the expression of Glut1 in the head tissue of C. pluricaulis-fed flies. Drosophila Glut 1 is a glucose transporter that plays a role in glucose uptake and the storage of triglycerides.60,61 A significant increase in the expression of Glut1 was observed at all three concentrations of C. pluricaulis (Sh vs. Ctrl [10×]: 1.55 ± 0.5-fold increase; Sh vs. Ctrl [25×]: 1.28 ± 0.17-fold increase; Sh vs. Ctrl [100×]: 1.28 ± 0.15-fold increase) (Figures 3B–3L). Finally, we examined the expression of Sod1, a gene that plays a conserved critical role in antioxidant defense.62,63,64,65,66 Reactive oxygen species (ROS) and reactive nitrogen species (RNS) are overproduced upon oxidative stress, and these reactive species cause oxidation of proteins, nucleic acids, and fatty acids.67 Sod1 is a cytoplasmic copper/zinc-containing enzyme that catalyzes the conversion of superoxide radicals into hydrogen peroxide.68 The Catalase enzyme converts hydrogen peroxide into water and oxygen and effectively removes ROS.69,70 The level of Sod1 in the head tissue was found to be increased at all three concentrations of C. pluricaulis (Sh vs. Ctrl [10×]: 1.2 ± 0.05-fold increase; Sh vs. Ctrl [25×]: 1.2 ± 0.11-fold increase; Sh vs. Ctrl [100×]: 1.16 ± 0.12-fold increase) (Figures 3E, 3J, and 3O).
Figure 3.
Effect of C. pluricaulis-formulated diet on the expression of genes in the head tissue of wild-type Drosophila
Reverse-transcription polymerase chain reaction (RT-PCR) quantitation of CG6293, Glut1, Rdl, GABA-B-R1, and Sod1 mRNAs in the head tissue of female Canton S flies that were fed a control diet (Ctrl) or a C. pluricaulis (Sh) diet for 10 days. Three different concentrations of C. pluricaulis were administered: 10× (A–E), 25× (F–J), and 100× (K–O). Expression levels were normalized to those of actin. Values are mean ± SD, n = 3. For each biological replicate (n = 3), two technical replicates were analyzed. (A–E) At the lowest concentrations (10×), C. pluricaulis significantly increased the expression of CG6293, Glut1, Rdl, GABA-B-R1, and Sod1 but no significant modulation was observed for GABA-B-R1. (F–O) At moderate (25×) and high (100×) concentrations, a considerable upregulation of CG6293, Glut1, Rdl, GABA-B-R1, and Sod1 mRNA expression was observed in the head tissue of wild-type flies. Error bars represent the mean ± SD; p value was calculated using an unpaired t test with Welch’s correction and is noted in the bar graph. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗∗p < 0.0005 by Student’s t test.
To infer whether the antioxidant property of C. pluricaulis was due to changes in gene expression of antioxidant enzymes in tissues other than the head, we examined the expression of ubiquitously expressed genes, including Sod1, Sod2, Caspase, and Hsp70, in the body tissue (w/o head). Our analysis showed that Sod1 levels were increased (Sh vs. Ctrl [100×]: 1.4 ± 0.26-fold increase) and Sod2 levels were significantly decreased upon administration of C. pluricaulis (Sh vs. Ctrl [100×]: 0.86 ± 0.07-fold decrease) (Figures 4A and 4B). However, no significant change was detected for catalase and Hsp70, indicating that the beneficial effects of C. pluricaulis were likely not mediated by the increased expression levels of Catalase and Hsp70 (Figures 4C and 4D). In summary, our candidate gene expression analysis indicates that C. pluricaulis intake modulates the expression of conserved genes involved in ascorbate homeostasis, glucose transport, and defense against oxygen radicals.
Figure 4.
Sod1 and Sod2 levels are significantly altered in the body tissue of C. pluricaulis-fed flies
Real-time reverse-transcription polymerase chain reaction (RT-PCR) quantitation of Sod1, Sod2, Caspase, and Hsp70 mRNAs in the body tissue of female Canton S flies that were fed a control diet (Ctrl) or a 100× C. pluricaulis (Sh) diet for 10 days
(A) Sod1 is upregulated in the body tissue of C. pluricaulis-fed flies in comparison to solvent-fed controls.
(B) Sod2 is significantly downregulated in the body tissue of C. pluricaulis-fed flies in comparison to the controls.
(C and D) Caspase and Hsp70 levels remain unchanged in the body tissue of C. pluricaulis-fed flies in comparison to the controls. Error bars represent the mean ± SD. p value was calculated using an unpaired t test with Welch’s correction and is noted in the bar graph. ∗p < 0.05, ∗∗p < 0.01, and nsp > 0.05 by Student’s t test.
CG6293 is required for the antidepressant effect of C. pluricaulis
Metabolomic analysis of head tissue extracts from C. pluricaulis-fed flies revealed an upregulation of several metabolites, including L-ascorbic acid (Figure 2E). Consistently, gene expression analysis showed elevated levels of CG6293, the Drosophila L-ascorbate transporter gene, in both head and body tissues of flies raised on the C. pluricaulis diet (Figures 3A–3F and 3K). Other genes implicated in antioxidant defense and neurotransmission, such as Sod1, Rdl, and GABA-B-R1, were also upregulated under similar conditions.
To identify which of these genes mediate the antidepressant-like effects of C. pluricaulis, we selectively reduced the expression (knocked down) of CG6293 and Sod1 specifically by RNA interference (UAS-RNAi) in adult flies. In Drosophila, gene expression or silencing can be spatially and temporally controlled using the GAL4-UAS system, where a GAL4 “driver” line activates a target gene or RNAi transgene placed downstream of UAS sequences. To restrict knockdown in adults and avoid potential developmental effects, we employed the Actin GeneSwitch-GAL4 driver, a modified GAL4 system in which the transcriptional activator remains inactive until flies are exposed to RU-486 (mifepristone).71 Feeding RU-486 to adult flies activates the GeneSwitch protein, thereby inducing GAL4-dependent expression of the UASRNAi construct and triggering RNA interference against the target gene.
To delineate the molecular effectors through which the antidepressant effect of C. pluricaulis is mediated, we knocked down CG6293 and Sod1 ubiquitously in adult flies by crossing the Actin GeneSwitch-GAL4 driver with UASRNAi lines. F1 progenies were then sorted according to sex and administered RU-486-containing food to ensure knockdown of the relevant genes, along with dietary supplementation of C. pluricaulis (Figure 5A). Experimental controls were administered food containing ethanol and C. pluricaulis extract. Knockdown of the functionally relevant mediator of the antidepressant effect of C. pluricaulis would abolish the beneficial effect of C. pluricaulis even in its presence. Knockdown of CG6293 and Sod1 was confirmed by quantitative real-time PCR for the respective genes (Figures 5B, 5C, and 5H–5I). To test for anhedonia-like and despair-like behaviors, we exposed knockdown and control flies to a stress regimen and subjected them to the SPT and FST. Subsequently, we found that knockdown of L-ascorbate transporter, CG6293, throughout the body led to exacerbation of the antidepressant effect of dietary administration of 50× C. pluricaulis (PI decreased from 0.2900 ± 0.1252 to −0.01400 ± 0.1649 in male flies and from 0.1749 ± 0.1776 to −0.3351 ± 0.1878 in female flies) (Figures 5D and 5E) in both male and female flies. The latency to the first bout of immobility was decreased upon the induction of CG6293 knockdown (swimming time decreased from 825.40 ± 219.39 to 293.3 ± 142.25 s in males and from 653.80 ± 152.27 to 213 ± 130.54 s in females) (Figures 5F and 5G). However, knockdown of Sod1 had no such adverse effect on the PI in the presence of C. pluricaulis in both male and female flies, and no statistical significant difference was observed in the PI of the control or RNAi line (control [male] PI: 0.03449 ± 0.1713; Sod1RNAi [male]: 0.1475 ± 0.1181; control [female] PI: 0.2525 ± 0.3218; Sod1RNAi [female]: 0.006931 ± 0.1134) (Figures 5H and 5I), indicating that it may not be involved in the regulation of behavioral effects of C. pluricaulis. Our data indicate that C. pluricaulis imparts stress resilience upon its dietary intake through CG6293 in both male and female Drosophila.
Figure 5.
Antidepressant effect of C. pluricaulis supplementation is mediated by the ascorbate transporter
(A) Dietary scheme for the analysis of ActinGS>UASCG6293RNAi and ActinGS>UASSod1RNAi flies. ActinGS>UASRNAi flies were raised on 50× C. pluricaulis-supplemented diet (E, embryonic stage; L, larval stage; A, adult stage). Two- to three-day-old adult flies were then fed a 50× C. pluricaulis diet containing RU-486 or solvent (control) for 5 days to knock down the expression of the gene of interest throughout their body. Flies were then subjected to a stress regime, and their anhedonia-like behavior was assayed by the sucrose preference test (SPT).
(B and C) CG6293 knockdown in whole body extract of male (B) and female (C) flies fed RU-486, normalized to solvent-fed controls. RNA was extracted from the whole body of 4–5 flies per biological replicate.
(D and E) ActinGS>CG6293RNAi male (D) and female (E) stressed flies fed RU-486 in the presence of 50× C. pluricaulis, showing decreased preference index indicating anhedonia in comparison to control flies fed 50× C. pluricaulis and solvent showing positive sucrose preference and resilience to stress.
(F and G) Sod1 knockdown in the whole body extract of male (F) and female (G) flies fed RU-486, normalized to ethanol-fed controls. RNA was extracted from the whole body of 4–5 flies per biological replicate.
(H and I) ActinGS>Sod1RNAi male (H) and female (I) stressed flies fed RU-486 in the presence of 50× C. pluricaulis showed no significant difference in sucrose preference in comparison to the control stressed flies that were fed 50× C. pluricaulis and solvent, showing resilience to stress-induced anhedonia. Each data point for the SPT represents a group of 10 flies. The boxplot displays the median, with the box spanning from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points, and we used an α level of 0.05 to assess statistical significance.
(B–I) Error bars represent the mean ± SD; p value was calculated using the unpaired t test with Welch’s correction and is noted in the bar graph. ∗p < 0.05, ∗∗p < 0.01, and nsp > 0.05 by Student’s t test.
The antioxidant activity of C. pluricaulis is conferred by the activity of Sod1, Glut1, Rdl, GABA-B-R1, and CG6293
C. pluricaulis exhibits antioxidant properties in both in vitro and in vivo assays. It has been proposed to function by scavenging free radicals in the 2,2-diphenyl-1 picrylhydrazyl assay.35,45 In animal models and neuronal cell lines, C. pluricaulis has been shown to provide neuroprotective effects.41,72 Though several phytochemical constituents of C. pluricaulis have been linked to its neuropharmacological effects, the precise mechanisms underlying these activities remain unknown. Here, we utilized Drosophila as a model to unravel the genes responsible for the antioxidant property of C. pluricaulis. Paraquat (PQ) is a compound used to induce oxidative stress in various animal models, including D. melanogaster.73 Its administration leads to the production of highly reactive superoxide anions, hydrogen peroxide, and hydroxyl radicals, which damage cellular macromolecules and oxidize reducing agents like NADPH and reduced glutathione, essential for normal cell function.74 Our previous study, along with others, has demonstrated that PQ-induced oxidative stress can be used to evaluate the effectiveness of antioxidants in D. melanogaster.75,76 To identify downstream effectors mediating the antioxidant effect of C. pluricaulis, the survivability of stressed flies was measured with or without C. pluricaulis (Figure 6A). These experiments were performed using strains in which the expression of genes modulated by C. pluricaulis intake was reduced genetically or via RNA interference (Figures 6B–6O). We hypothesized that knocking down functionally relevant downstream effectors would increase sensitivity to the toxic effects of PQ, even in the presence of C. pluricaulis. Therefore, we anticipated that reducing the levels of these key genes would eliminate the lifespan extension effect of C. pluricaulis under PQ treatment. Since C. pluricaulis influences the expression of Rdl, Sod1, Sod2, GABA-B-R1, Glut1, and CG6293, we examined strains with decreased expression of each of these genes. Two-day-old flies with loss of one copy of Rdl, Sod1, GABA-B-R1, Glut1, and CG6293 were transferred to food containing either solvent or C. pluricaulis in 5 mM PQ. To compare the effects of a C. pluricaulis-supplemented diet in Sod1- and Sod2-deficient flies, Sod1 and Sod2 knockdowns were induced ubiquitously in adult flies using a steroid (RU- 486) inducible system with the Daughterless GeneSwitch GAL4 (daGS) driver (Figures 6D–6G). RT-PCR analysis of total RNA extracted from whole animals of daGS/UAS Sod2RNAi and daGS/UAS Sod1RNAi female flies confirmed the knockdown of sod1 and sod2 (Figures S4C and S4D). Induction of UAS Sod1RNAi and UAS Sod2RNAi resulted in approximately 32% ± 10.7% reduction in sod1 levels and approximately 56.6% ± 9.9% reduction in Sod2 levels upon treatment with RU-486 for 5 days in female flies (Figures S4C and S4D). daGS/UAS Sod1RNAi female flies fed a C. pluricaulis diet had a 10.5% decrease in median lifespan in both experimental trial 1 and experimental trial 2 (Figures 6F and 6G; Table S3). However, knockdown of Sod2 did not lead to a reduction in median or maximum lifespan. The C. pluricaulis-fed flies continued to have a 22% increase in median lifespan and a 14.2% and 28% increase in maximum lifespan in experiments 1 and 2, respectively (Figures 6D and 6E, Table S3). Genetically reducing one copy of Sod1, GABA-B-R1, Glut1, and CG6293 did not lead to any increase in survivability in C. pluricaulis-fed flies under PQ-induced oxidative stress, and reduced dosage of Rdl led to an 18% and 8% decrease in median lifespan and in experiments 1 and 2, respectively (Figures 6F–6O; Table S3). Sod1 codes for the antioxidant enzyme superoxide dismutase 1, which is an evolutionarily conserved ROS-neutralizing enzyme that converts superoxide anions to hydrogen peroxide.77 In Drosophila, Rdl (a GABA-A receptor subunit) and GABA-B-R1 play crucial roles in gamma-aminobutyric acid (GABA) signaling, and the GABA shunt helps maintain redox balance in blood progenitor cell.78 The orthologs of the glucose transporter glut1 and the ascorbate transporter CG6293 have been linked to oxidative stress defense in other models. Glut1 is a transporter for both glucose and dehydroascorbic acid, and mutations in this gene or inhibitors that prevent glucose transport have been shown to increase ROS levels in myoblasts.79 Though CG6293 is not well characterized in Drosophila, it is an ortholog of the ascorbate transporters SVCT1 and SVCT2, and L-ascorbate or vitamin C has been shown to function as an antioxidant in several biological systems.80 Taken together, these analyses have uncovered previously unknown, conserved molecular effectors responsible for the antioxidant property of C. pluricaulis.
Figure 6.
Sod1, rdl, GABA-B-R1, and Glut1 are required for the protective effects of C. pluricaulis-supplemented diet under paraquat-induced oxidative stress conditions
(A) Dietary scheme for the analysis of different lines that were fed 5 mM paraquat (PQ) in either a control diet or a C. pluricaulis (Sh)-supplemented diet during adulthood. Survivability of flies that were fed a control or C. pluricaulis-supplemented diet was measured in the presence of 5 mM PQ.
(B and C) Two experiments denoting the survivability of female daGS>UAS Sod1RNAi flies that were fed a control or Sh diet with 5 mM PQ in adult stages. Ubiquitous knockdown of Sod1 resulted in the loss of the increased survivability in the presence of Sh in the PQ diet. A moderate but significant decrease in lifespan was observed upon knockdown of sod1 in the Sh diet in both experimental trials.
(D and E) The ubiquitous knockdown of Sod2 does not influence the ability of Sh to enhance survivability in PQ-induced oxidative stress conditions. The daGS>UAS Sod2RNAi flies that were fed Sh survive significantly longer as compared to daGS>UAS Sod2RNAi flies that were fed a control diet.
(F and G) Reducing one functional copy of sod1 also worsens the increase in survivability seen upon intake of Sh. No significant difference was observed for flies that were fed a control or Sh diet.
(H and I) Reducing the dosage of rdl abolishes the antioxidant effect of Sh. Flies expressing one copy of rdl have a significant reduction in survivability on the Sh diet as compared to the control diet in the presence of PQ.
(J–O) Reducing one copy of GABA-B-R1 (J and K), Glut1 (L and M), or CG6293 (N and O) also abolished the ability of Sh to enhance lifespan in the presence of PQ. For statistical comparison of survival curves, p values and χ2 were calculated with the log rank test and are noted in the figures and Table S3. The maximum and medium lifespan and the number of flies are noted in Table S3.
Genotypes used in the study: (B and C) DaGS>UAS Sod1RNAi: w[∗];P { w[+mW.hs] =Switch1}DaGS;P{w[+mC] = UAS-Sod1.RNAi.H}4; P{w[+mC] = UAS-Sod1.RNAi.H}4; (D and E) DaGS>UASSod2RNAi: +/+; P {y[+t7.7] v [+t1.8] =TRiP.GL01015} attP40/P { w[+mW.hs] =Switch1}DaGS; (F and G) y[1] w[∗]; Mi{y[+mDint2]=MIC}Sod1[MI08143]/+; (H and I) Rdl[1]/+; (J and K) y[1] w[∗]; Mi{y[+mDint2]=MIC}GABA-B-R1[MI03255]/+; (L and M) y[1] w[∗]; Mi{y [+mDint2] = MIC}Glut1[MI05056]/+; (N and O) y[1]w[∗];Mi{y[+mDint2] = MIC}CG6293 [MI14396]/+.
Dietary L-ascorbic acid recapitulates the antidepressant and antioxidant effects of C. pluricaulis in Drosophila
Reducing the levels of CG6293 resulted in loss of the antidepressant and antioxidant effects of C. pluricaulis supplementation, thus indicating that the antidepressant and antioxidant properties of C. pluricaulis are largely due to the increased transport of L-ascorbate. To examine whether L-ascorbic acid is the primary mediator of C. pluricaulis, we examined the impact of dietary supplementation with L-ascorbic acid during development or in adulthood only. We first examined the impact of administering L-ascorbic acid throughout the development. Three- to five-day-old flies that were fed either a control diet or an L-ascorbic acid-supplemented diet were sorted according to sex and subjected to the short variable stress regime (Figure 7A). To ensure this effect was due to administration of L-ascorbic acid alone and not due to altered food consumption upon L-ascorbic acid supplementation, we measured the food intake per fly by performing the Ex-Q assay. We found that the supplementation of 100 mM L-ascorbic acid in fly food did not affect food consumption of Canton S male and female flies (Figures 7B and 7C). Following exposure to the stress regime, the anhedonia-like behavior of flies was tested through the SPT. We found that both male and female Canton S flies raised on 100 mM L-ascorbic acid-supplemented food showed relief from anhedonia, as they preferred sucrose over water, compared to their control counterparts raised on regular fly food and exposed to stress (Figures 7D and 7E). These control flies lost their preference for sucrose upon exposure to the stress regime, indicating an anhedonia-like state. At the same time, L-ascorbic acid administration alleviated this stress-induced anhedonia-like behavior (PI increased from −0.3067 ± 0.2255 to 0.4059 ± 0.1570 in males and from −0.2144 ± 0.2659 to 0.2477 ± 0.2808 in females that were administered an L-ascorbic acid diet). Administration of 100 mM L-ascorbic acid also reversed the despair-like phenotypes observed in both male and female flies exposed to the stress regime. Intake of L-ascorbic acid led to an increase in latency to immobility (swimming time increased from 367.37 ± 226.39 to 909.50 ± 342.70 s in males and from 668.10 ± 227.79 to 1,009.70 ± 246.96 s in females) (Figures 7F and 7G). To examine the impact of L-ascorbic acid supplementation specifically in adulthood, 3- to 5-day-old Canton S flies were developed on a normal diet and shifted to either a normal diet or an L-ascorbic acid-supplemented diet for 20 days, following which the flies were exposed to the stress regime and subjected to behavioral assessments using the SPT or FST (Figure 7H). Supplementation of L-ascorbic acid in fly food did not affect food consumption of Canton S male and female flies (Figures 7I and 7J). Both male and female Canton S flies that were fed L-ascorbic acid-supplemented food for 20 days showed relief from anhedonia, compared to their control counterparts that were fed regular fly food and exposed to stress (Figures 7K and 7L). These control flies lost their preference for sucrose upon exposure to the stress regime, indicating an anhedonia-like state. At the same time, L-ascorbic acid administration alleviated this stress-induced anhedonia-like behavior (PI increased from −0.1645 ± 0.2155 to 0.2187 ± 0.1922 in males and from −0.1747 ± 0.2906 to 0.3129 ± 0.1239 in females that were administered an L-ascorbic acid diet). Administration of 100 mM L-ascorbic acid for 20 days also reversed the despair-like phenotypes observed in both male and female flies exposed to the stress regime. Intake of L-ascorbic acid led to an increase in latency to immobility (swimming time increased from 260.20 ± 123.98 to 556.30 ± 314.68 s in males and from 453.70 ± 195.39 to 890.30 ± 351.37 s in females) (Figures 7M and 7N).
Figure 7.
L-Ascorbic acid intake phenocopies the antidepressant and antioxidant effects of C. pluricaulis
(A) The dietary scheme used to determine the impact of L-ascorbic acid (100 mM) supplementation during development and adulthood in the stress-induced depression model. Canton S flies were fed L-ascorbic acid throughout development and adulthood (E, embryonic stage; L, larval stage; A, adult stage). Three- to five-day-old flies were subjected to a stress regime, and their anhedonia-like behavior was measured using the sucrose preference test (SPT) and forced swimming test (FST).
(B and C) Male (B) and female (C) Canton S flies consume comparable amounts of normal fly food and L-ascorbic acid-supplemented food. Food intake was measured by the Ex-Q assay. Each data point represents a group of 10 flies. Data are represented as the mean ± SD, n = 7 (males) and n = 8 (females). p value was calculated using an unpaired t test with Welch’s correction.
(D and E) The preference index of male Canton S flies (D) and female Canton S flies (E). Each circle represents the preference index using 10 flies. The boxplot shows the mean, and the box spans from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points. Panel 1 represents flies that were exposed to stress and fed a control diet (Ctrl), and panel 2 represents flies that were exposed to a stress regime and fed a diet supplemented with 100 mM L-ascorbic acid. Statistical significance was determined using an unpaired t test with Welch’s correction, and we used an α level of 0.05 to assess statistical significance.
(F and G) L-ascorbic acid-fed male (F) and female (G) Canton S flies exposed to a stress regime showed increased latency time to first immobility bout, indicating decreased despair-like phenotype in comparison to the stress-exposed control flies raised on regular fly food, showing a lower latency time to first immobility, indicating a despair-like state. The boxplots show the median, and the box spans from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points, and we used an α level of 0.05 to assess statistical significance. ∗p < 0.05, ∗∗∗p < 0.005 by Student’s t test.
(H) The dietary scheme used to determine the impact of L-ascorbic acid (100 mM) supplementation during adulthood in the stress-induced depression model. Canton S flies were fed a control diet throughout development (E, embryonic stage; L, larval stage; A, adult stage) and an L-ascorbic acid-supplemented diet for 20 days during adulthood. Twenty-day-old flies were subjected to a stress regime, and their anhedonia-like behavior was measured using the SPT and FST.
(I and J) Male (I) and female (J) Canton S flies consume comparable amounts of normal fly food and L-ascorbic acid-supplemented food. The Ex-Q assay measured food intake. Each data point represents a group of 10 flies. Data are represented as the mean ± SD, n = 6 (males) and n = 6 (females). p value was calculated using an unpaired t test with Welch’s correction.
(K and L) The preference index of male Canton S flies (K) and female Canton S flies (L). Each circle represents the preference index using 10 flies. The boxplot shows the mean, and the box spans from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points. Panel 1 represents flies that were exposed to stress and fed a control diet (Ctrl), and panel 2 represents flies that were exposed to a stress regime and fed a diet supplemented with 100 mM L-ascorbic acid. Statistical significance was determined using an unpaired t test with Welch’s correction, and we used an α level of 0.05 to assess statistical significance.
(M and N) L-ascorbic acid-fed male (M) and female (N) Canton S flies exposed to a stress regime showed increased latency time to first immobility bout, indicating decreased despair-like phenotype in comparison to stress-exposed control flies maintained on regular fly food, showing a lower latency time to first immobility, indicating a despair-like state. The boxplots show the median, and the box spans from the first quartile to the third quartile. The whiskers extend from the box to the minimum and maximum data points, and we used an α level of 0.05 to assess statistical significance. ∗p < 0.05, ∗∗∗p < 0.005 by Student’s t test.
(O) Dietary scheme for the analysis of Canton S flies that were fed 5 mM paraquat (PQ) in either a control diet or an L-ascorbic acid-supplemented diet during adulthood. Survivability of flies that were fed a control or L-ascorbic acid-supplemented diet was measured in the presence of 5 mM PQ.
(P and Q) Two experiments denoting the survivability of female Canton S flies that were fed a control or L-ascorbic acid diet with 5 mM PQ in adult stages. A statistically significant increase in survivability was observed in flies that were fed an L-ascorbic acid-supplemented diet in both experimental trials. For statistical comparison of survival curves, p values and χ2 were calculated with the log rank test and are noted in the figures and Table S4. The maximum and medium lifespan and the number of flies are noted in Table S4.
To examine the antioxidant effect of L-ascorbic acid, the survivability of stressed flies was measured with or without L-ascorbic acid (Figure 7O). Canton S female flies that were fed an L-ascorbic acid diet had a 16.6% and 11.1% increase in median lifespan and a 21.2% and 17.64% increase in maximum lifespan in experimental trials 1 and 2, respectively (Figures 7P and 7Q; Table S4). Taken together, these data indicate that the antidepressant and antioxidant effects of C. pluricaulis are primarily mediated by the increased physiological levels and increased transport of L-ascorbate. Our genetic analysis also uncovered Rdl, sod1, and GABA-B-R1 as mediators of the oxidative stress protection offered by intake of C. pluricaulis. Future studies are needed to examine whether these genes operate downstream of L-ascorbic acid.
Discussion
C. pluricaulis regulates metabolic pathways associated with oxidative stress defense and brain function
C. pluricaulis plant extract has been extensively utilized in the pharmaceutical and nutraceutical industries as an antidepressant, anxiolytic, and antioxidant.33,37,42,43,45,72,81,82 Several studies have reported the phytochemical characterization of different plant parts, and other reports in animal models have confirmed its antioxidant effects.32,33,36,39,83,84,85 Despite the extensive pharmacological characterization, the molecular players underlying the beneficial effects of this medicinal plant extract remain unknown. Here, we employed tissue-specific, untargeted metabolomic analysis of wild-type Drosophila fed a diet containing C. pluricaulis to investigate the metabolic changes induced by C. pluricaulis. Intake of C. pluricaulis induced significant changes in metabolites such as L-ascorbate and glucose, specifically in the head tissue and not in the body (Figures 2, S2, and S3). This analysis was further validated by examining the expression of genes involved in the associated metabolic pathways (Figures 3 and 5). Together, these data helped narrow down some key biological targets (CG6293, sod1, rdl, GABA-B-R1, and glut1). The identification of these neuronally enriched effectors would not have been possible if the metabolomic analysis had been performed in whole animals instead of the tissue. The use of D. melanogaster allowed us to narrow down the relevant targets by analyzing readily available mimic lines and RNAi lines. Thus, our approach highlights the utility and effectiveness of the genetically amenable fruit fly, D. melanogaster, for illuminating the molecular mechanisms underlying natural dietary interventions.
Evidence for the role of L-ascorbic acid and ascorbate transporter in the antidepressant and antioxidant effects of C. pluricaulis
Chronic stress elevates ROS levels and lipid peroxidation in neural tissues.86,87,88 This cascade of events leads to a cascade of pathological events that are ultimately responsible for depression. These oxidative stress-induced events include neuroinflammation, mitochondrial dysfunction, dysregulation of the Nrf2 pathway, autophagy, and ferroptosis. Antioxidants intervene at several downstream pathways, including the neutralization of ROS and RNS by donating electrons or by removing excess ROS and RNS to maintain redox balance, thus protecting neuronal cells from damage to DNA, proteins, and lipids.89 Increased levels of ROS initiate signaling pathways associated with inflammation, leading to the production of pro-inflammatory cytokines that, in turn, further stimulate the production of ROS, thereby perpetuating the cycle.90 Antioxidants help break this cycle by promoting anti-inflammatory signaling and suppressing pro-inflammatory cytokines such as interleukin (IL)-1β, IL-6, and tumor necrosis factor alpha.91 ROS are mainly produced in the mitochondria, and excess ROS production impairs the ability of the mitochondria to produce energy (ATP). Deregulation of the mitochondrial respiratory chain reduces energy supply to neurons, compromising neuroplasticity and, consequently, mood. The nuclear factor erythroid 2-related factor 2 (Nrf2) is a key player in the antioxidant system that plays a dual role of activating the expression of several antioxidant genes and simultaneously regulating the expression of genes involved in autophagy, inflammatory pathways, and ferroptosis.92 While stress reduces Nrf2 expression, antioxidants reactivate the Nrf2 pathway, leading to the production of antioxidant enzymes such as Sod and heme oxygenase-1.93
L-ascorbate is the physiological anionic form of ascorbic acid or vitamin C. Humans and insects are unable to synthesize L-ascorbate and are dependent on its dietary intake. L-ascorbic acid is a key cellular antioxidant in the central nervous system and plays a role in remodeling the epigenome by promoting ten-eleven translocation (TET) enzyme-mediated DNA oxidation.94,95,96,97,98 Evidence from animal and human studies also indicates that psychosocial stressors lead to depression by driving epigenetic changes such as altered DNA methylation.99,100 Converging evidence has also revealed that oxidative stress is a key player in the pathogenesis of MDD.101,102 Oxidative stress leads to the oxidation of ascorbic acid, resulting in the generation of dehydroascorbic acid and an increased turnover of ascorbic acid. These findings from multiple studies suggest that disrupted ascorbic acid homeostasis may be responsible for the alterations in DNA methylation with oxidative stress under depression. Ascorbic acid homeostasis is regulated by two isoforms of the sodium-dependent vitamin C transporters (SVCT1 and SVCT2), which are coded by the solute carrier family 23 member 1 gene (SLC23A1) and solute carrier family 23 member 2 gene (SLC23A2). SVCT1 functions as the predominant carrier of ascorbic acid in the intestine, and SVCT2 is primarily responsible for the transport of ascorbic acid in the brain.56 Previous studies have reported that the oral administration of ascorbic acid can increase the fluoxetine antidepressant efficacy as an adjunct.103 Pretreatment with a low dose of ascorbic acid has been shown to prevent chronic stress-induced depression-like behavior.104,105 Several preclinical studies that have tested the use of ascorbate in managing MDD provide support for our work in Drosophila.54,106 These studies have utilized metabolomic approaches, treatment with inhibitors, and polymorphisms in gene coding for ascorbate transporters such as SVCT1. Some of the mechanisms proposed for the antidepressant action of L-ascorbate include: (1) functioning as a cofactor for dopamine beta-monooxygenase that converts dopamine into norepinephrine, which is a key neurotransmitter that regulates attention, cognition, and stress responses107; (2) inhibiting nitric oxide production when NMDA receptors are activated108,109; (3) modulating glutaminergic signaling110; (4) interfering with the transcription of antioxidant enzymes111; (5) acting as a cofactor for TET enzymes, which demethylate DNA and aid in the removal of methyl groups, thereby reversing stress-induced epigenetic changes in genes that regulate mood; (6) activating the ErbB4-brain-derived neurotrophic factor (BDNF) signaling pathway, which is linked to the demethylation and consequential activation of an S100 calcium-binding protein A498; BDNF protein is required for survival and growth of neurons, and low levels of BDNF have been linked to depression; and (7) increasing the expression of SVCT2 in the medial prefrontal cortex, thereby helping L-ascorbic acid to improve its own uptake in the brain through epigenetic regulation, including DNA and histone demethylation, activation of the JAK-STAT pathway, and stimulation of SVCT2 trafficking to the membrane.112,113 According to Flybase (FB2025_2), the Drosophila gene CG6293 has been predicted to be involved in the transmembrane transport of L-ascorbic acid and is orthologous to SLC23A1 and SLC23A2. Our metabolomic analysis of brain tissue indicates that L-ascorbic acid levels in the brain tissue are enriched upon intake of C. pluricaulis, and the ubiquitous knockdown of CG6293 abolished the antidepressant effects of C. pluricaulis extract (Figure 4). By identifying a previously unknown link between C. pluricaulis intake and the expression and/or activity of ascorbate transporter, we have uncovered one mechanism by which C. pluricaulis exerts its effect as an antidepressant. In addition, our study has also uncovered Sod1, GABA-B-R1, Rdl, and CG6293 as molecular effectors of the antioxidant effect of C. pluricaulis. It is likely that the antioxidant protection offered by dietary supplementation of C. pluricaulis provides behavioral resilience under stress conditions. There is evidence from several studies to indicate that chronic stress leads to an increase in ROS in neural tissues by activating the hypothalamic-pituitary-adrenal axis.86
Taken together, our findings have uncovered key conserved downstream molecular targets responsible for the neuropharmacological effects of C. pluricaulis. Our work highlights the genetically amenable fruit fly, D. melanogaster, as an ideal model for evaluating the antidepressant efficacy of natural medicinal extracts. Future strategies aimed at developing and evaluating combinations of natural plant-based extracts will likely aid in designing an optimal supplement for the prevention and/or treatment of MDD.
Limitations of the study
A non-targeted metabolomics approach was utilized to examine the antidepressant and antioxidant properties of C. pluricaulis in D. melanogaster. The chemical composition of the purified extract used in the study remains to be determined. This is necessary background information, but it does not explain how these components interact with the body’s physiology. Identification of the phytochemical constituents of the pure extract would aid in reproducing the experiments and dosing. The main focus of this study was to quantify the in vivo response; however, the extract may have multiple bioactive compounds working in concert. For example, the targeted supplementation of L-ascorbic acid was able to mimic the antidepressant and antioxidant effects of C. pluricaulis; however, L-ascorbic acid is highly unstable due to its redox reactivity. Ultraviolet and visible light, heat, and atmospheric oxygen speed up the oxidative degradation of L-ascorbic acid. Many medicinal plants are rich in polyphenols, flavonoids, and tannins, which act as antioxidants that scavenge oxygen radicals or chelate transition metals, thereby slowing the oxidation of L-ascorbic acid and increasing its half-life in biological systems. Plant extracts also contain polysaccharides, fibers, and secondary metabolites that can create a microenvironment that reduces direct exposure of L-ascorbic acid to oxygen, light, or metals. Some phytochemicals may modulate transporters of metabolites such as L-ascorbate, aid in its stability, absorption, or increase its bioavailability. In contrast, there may also be some pro-oxidants in the extract that may accelerate L-ascorbic acid breakdown.
Some other reported beneficial properties of C. pluricaulis include cognitive enhancement, anti-inflammatory effects, hepatoprotective effects, metabolic benefits, and cardioprotective effects. The causal effectors for these beneficial properties are not yet known. Future phytochemical profiling of the purified C. pluricaulis extract by a systematic fractionation, together with targeted bioassays followed by mechanistic validation using knockdowns, overexpression, or selective antagonists in cell/animal models, will aid in identifying other molecular effectors that mediate the beneficial effects of this natural medicinal plant extract.
Resource availability
Lead contact
Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Geetanjali Chawla (geetanjali.chawla@snu.edu.in).
Materials availability
All unique/stable reagents generated in this study are available from the lead contact with a completed materials transfer agreement.
Data and code availability
-
•
Metabolomics data have been deposited at NIH Common Fund’s National Metabolomics Data Repository website and will be released on 2025-12-14 at DOI (PR002774): https://doi.org/10.21228/M8383Q.
-
•
This paper does not report original code.
-
•
Any additional information required to reanalyze the data reported in this article will be shared upon request by the lead contact. Correspondence and requests for materials should be addressed to G.C. (geetanjali.chawla@snu.edu.in).
Acknowledgments
We thank the Fly Facility at the Department of Life Sciences, Shiv Nadar Institution of Eminence, for their continuous support. We thank Sakshi Bansal and Haseeb Ul Arfin for their technical assistance during the initial stages of this study. Dr. Animesh Samanta and Mr. Rafique Sanukhan are acknowledged for their support in the attempt made to determine the chemical composition of the extract. We are also grateful to the Regional Centre for Biotechnology, India, and the Shiv Nadar Institution of Eminence, India for providing infrastructural support at different stages of the study. Metabolomics analysis was performed at the Metabolomics Core Facility at the University of Utah. Mass spectrometry equipment at the University of Utah was obtained through NCRR Shared Instrumentation Grant 1S10OD016232-01, 1S10OD018210-01A1, and 1S10OD021505-01. We thank the NIH Common Fund’s National Metabolomics Data Repository (NMDR) that is supported by NIH U2C-DK119886 and OT2-OD030544 grants. We thank the Bloomington Drosophila Stock Center (NIH P40OD018537) and VDRC for providing fly stocks, as well as Flybase (NIH5U41HG000739). This research was supported by the DBT/Wellcome Trust India Alliance Fellowship/Grant (grant number IA/I(S)/17/1/503085) and SERB-CRG grant (grant number CRG/2023/007491) to G.C. and Shiv Nadar Institution of Eminence fellowship to S.M. and A.K.
Author contributions
Conceptualization, G.C.; methodology, M.P., S.M., A.K., and G.C.; investigation, M.P., S.M., A.K., A.G., S.P., M.J., M.S., and G.C.; writing – original draft, S.M., A.K., and G.C.; writing – review and editing, S.M., A.K., and G.C.; funding acquisition, G.C.; resources, G.C.; supervision, G.C.
Declaration of interests
The authors declare no competing interests.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Chemicals, peptides, and recombinant proteins | ||
| Erioglaucine | SRL | 98188; CAS: 3844-45-9 |
| Flutax-20 | Leeford | N/A |
| L-ascorbic acid | SRL | 32488; CAS: 50-81-7 |
| Methyl viologen dichloride, Paraquat | Sigma Aldrich | 856177; CAS: 75365-73-0 |
| N-methyl-N-trimethylsilyltrifluoracetamide | ThermoFisher Scientific | #TS48913 |
| O-methoxylamine hydrochloride | MP Bio | MP Bio #155405 |
| RNAiso Plus | Takara Bio | N/A |
| RU-486 | Cayman Chemicals | 10006317; CAS: 84371-65-3 |
| Critical commercial assays | ||
| High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher Scientific | 4368814 |
| Deposited data | ||
| Raw and analyzed metabolomics data | National Metabolomics Data Repository114 | Study_id:ST004376. The DOI for this project(PR002774) is: https://doi.org/10.21228/M8383Q |
| Experimental models: Organisms/strains | ||
| D. melanogaster: UAS-Sod2RNAi | Bloomington Drosophila Stock Centre | RRID: BDSC_36871 |
| D. melanogaster: UAS-Sod1RNAi | Bloomington Drosophila Stock Centre | RRID: BDSC_24491 |
| D. melanogaster: UAS-CG6293RNAi | Vienna Drosophila Resource Centre | RRID: VDRC108619 |
| D. melanogaster: Rdl[1] | Bloomington Drosophila Stock Centre | RRID: BDSC_1687 |
| D. melanogaster: GABA-B-R1 mimic line | Bloomington Drosophila Stock Centre | RRID: BDSC_36226 |
| D. melanogaster: CG6293 mimic line | Bloomington Drosophila Stock Centre | RRID: BDSC_59511 |
| D. melanogaster: Glut1 mimic line | Bloomington Drosophila Stock Centre | RRID: BDSC_37890 |
| D. melanogaster: sod1 mimic line | Bloomington Drosophila Stock Centre | RRID: BDSC_44929 |
| D. melanogaster: Actin GS Gal4 | Gift from Pankaj Kapahi’s laboratory | N/A |
| D. melanogaster: Da-GS Gal4 | Gift from David Walker’s laboratory | N/A |
| Oligonucleotides | ||
| act-5c For, cacaccaaatcttacaaaatgtgt | This paper (IDT) | N/A |
| act-5c Rev, aatccggccttgcacatg | This paper (IDT) | N/A |
| Sod 2 For, agaacctctcgcccaacaag | This paper (IDT) | N/A |
| Sod 2 Rev, actgcagatagtaggcgtgc | This paper (IDT) | N/A |
| Catalase For, caaccccttcgatgtcacca | This paper (IDT) | N/A |
| Catalase Rev, catcctggttgtccgtcaca | This paper (IDT) | N/A |
| Sod1 For, caagggcacggttttcttcg | This paper (IDT) | N/A |
| Sod1 Rev, tacggattgaagtgcggtcc | This paper (IDT) | N/A |
| HSP70 For, tggacaagtgcaacgacact | This paper (IDT) | N/A |
| HSP70 Rev, tcgatcgaaacattcttatcagtct | This paper (IDT) | N/A |
| Dop1R1 For, tgatacttgggtggcctttg | This paper (IDT) | N/A |
| Dop1R1 Rev, cagagcgcatgttggatact | This paper (IDT) | N/A |
| Rdl For, cgacctggtgtagaaacactat | This paper (IDT) | N/A |
| Rdl Rev, ccgatgacccaagaccttaaat | This paper (IDT) | N/A |
| GABA-B-R1 For, cgaggagggttacgacattaac | This paper (IDT) | N/A |
| GABA-B-R1 Rev, ggcaatctccttgtccgtatag | This paper (IDT) | N/A |
| CG6293 For, tcgagcacgcagctgaaa | This paper (IDT) | N/A |
| CG6293 Rev, ccgcacagaccccacatt | This paper (IDT) | N/A |
| Glut1 For, tttcctatgtgcaccgggtc | This paper (IDT) | N/A |
| Glut1 Rev, gcgaaaatggataccgccac | This paper (IDT) | N/A |
| Software and algorithms | ||
| MassHunter | Agilent | N/A |
| MassHunter Quant | Agilent | N/A |
| MetaboAnalyst 5.0 | Xia Lab, McGill | https://www.metaboanalyst.ca/ |
| GraphPad Prism 10 | GraphPad Prism | N/A |
| Biorender | BioRender | N/A |
| Online Application for the Survival Analysis of lifespan assays (OASIS) | Postech | https://sbi.postech.ac.kr/oasis/ |
Experimental model and study participant details
Drosophila strains and maintenance
Drosophila melanogaster stocks of the wildtype strain Canton S and w1118 have been in the laboratory since 2017 and maintained in a sugar-yeast cornmeal-based diet (please see section on media preparation for the recipe). Canton S flies were used for experiments depicted in Figures 1, 2, 3, 5, 7, and S1. The UAS-Sod2 RNAi line (RRID: BDSC_36871), UAS-Sod1RNAi (RRID: BDSC_24491), UAS-CG6293RNAi (VDRC108619), Rdl[1] (RRID: BDSC_1687), GABA-B-R1 mimic line (RRID: BDSC_36226), Glut1 mimic line (RRID: BDSC_37890), CG6293 mimic line (RRID: BDSC_59511), sod1 mimic line (RRID: BDSC_44929), and Da-GS Gal4 (gift from David Walker’s laboratory) driver were used for the experiments in Figure 6. The Da-GS lines and UAS lines used for lifespan were backcrossed three times into a homogenous control background w1118 by setting up crosses with a single male from each line with three female w1118 virgin flies. The process was repeated with F2 males crossed to w1118 virgin flies, F3 males crossed to w1118 virgin flies, and the F4 male progeny were crossed with a compound chromosome 2:3 lab balancer stock. The resulting balanced stocks were used for setting up crosses for lifespan analysis. All flies used in the study were maintained in standard cornmeal/agar medium at 25°C with a 12h light: 12h dark cycle in 60% humidity. For steroid-mediated knockdown of Sod1 and Sod2 using the Gene-Switch driver, flies were fed a diet containing 200 μM RU-486 (Mifepristone, Cayman Chemicals, Ann Arbor, MI). Comparisons of lifespan were made in parallel with the same strain on different diets (with and without C. pluricaulis). The lack of any effect of RU-486 on Da-GS and UAS Sod2 RNAi has been reported previously.75,115 To confirm the effect of Sod1 knockdown, Sod1 mimic line (insertion allele) was utilized, and similar results were obtained with both the RNAi and mimic lines. Since our analysis has been done using the same genotype in different diets, the genetic background of the experimental strain in the different diets is identical. Hence, the statistical difference in lifespan in the experiment can be attributed to the effect of C. pluricaulis versus the solvent-formulated diet. Unless otherwise noted, all lifespan assays utilized adult mated (48h) female flies of the indicated ages. All the experiments were performed at 25°C.
Method details
Drosophila medium preparation and maintenance
-
1.
Cornmeal/Agar Food: The cornmeal/agar food was prepared by mixing 86 g of cornmeal, 25g of sucrose, 51g of Dextrose, 15g of Yeast extract, 6g of agar, 1% Acid mix (10 ml) and Tegosept (5ml; 1 gm of Methyl 4-hydroxybenzoate [SRL] in 5ml 100% Ethanol) per 1000 mL of food. The acid mix stock solution was prepared by combining propionic acid (164 ml milliQ water with 836 ml propionic acid [SRL]) and orthophosphoric acid (917 ml MilliQ water to 83 ml of orthophosphoric acid [SRL]).
-
2.
C. pluricaulis-supplemented food: C. pluricaulis food was made by dissolving 10 mg C. pluricaulis extract in 1 ml of water overnight at 4°C with continuous shaking (For Figures 1, 4, and 6). C. pluricaulis was dissolved in Ethanol for Experiments performed in Figures 2, 3, and 5. For all other experiments, C. pluricaulis was dissolved in autoclaved MilliQ water. Pure C. pluricaulis extract was procured from a readily available commercial source (Nature’s Velvet Lifecare Shankhpushpi pure extract available as 500mg capsules). A 10 mg/mL stock was prepared fresh for each experiment and stored at 4°C, and then diluted to 0.1 mg/mL. To prepare 25X, 50X, and 100X C. pluricaulis-supplemented food, 181.3μL, 362.9 μL, and 725.8 μL of 0.1mg/ml C. pluricaulis extract were added to 50 mL standard yeast-cornmeal food, respectively. The cornmeal food was melted by heating and cooled down to 40°C before addition of C. pluricaulis. Parental generation Canton S flies were allowed to lay eggs on C. pluricaulis-supplemented medium. The progeny flies were allowed to feed on this food throughout development, and behavioural assays were then performed with 2-5-day-old adult flies.
-
3.
Paraquat Food: Methyl viologen dichloride, Paraquat (Sigma Aldrich), was used to study the ability of flies fed on C. pluricaulis-supplemented food to resist the oxidative stress induced. To prepare a 5 mM Paraquat solution, 64 mg of Paraquat was weighed and dissolved in 500 mL of water. 50 mL of cornmeal food was melted and cooled down to 40°C. The Paraquat solution was added to the melted food. It was mixed evenly by stirring and layered 2 mL each on 1.5% Agar vials.
-
4.
Fluoxetine administration: Fluoxetine (Flutax-20; Leeford, India) was diluted to a concentration of 10mM in the Drosophila medium.116 The medium was cooled to 50°C before addition of the powder. The medium was pipetted into isolation vials, and flies were administered the fluoxetine diet for 18 hours.
-
5.
100mM L-ascorbate administration: To make a 1.85M stock solution, 880 grams of L-ascorbate (SRL) was dissolved in 2.7ml of water with continuous vortexing in dark. Regular fly food was cooled to 50°C and 2.7ml of 1.85M L-ascorbate stock was added to make 100mM concentration. Vials were poured and stored in a 4°C (dark condition). Flies were transferred to fresh food every 3 days. Control flies are placed on regular food.
RNAi-mediated knockdown of target genes
Actin GS (Gift from Pankaj Kapahi’s laboratory) virgin flies were crossed to UAS CG6293RNAi and UAS Sod1RNAi male flies. Crosses were set on 50x C. pluricaulis-supplemented food. Progeny were allowed to grow on this food. Then, 2-5 days old F1 flies were segregated into groups of 10 flies each, and males and females were kept separately. Flies were then randomly assigned to two groups, and one group was fed 50x C. pluricaulis food containing 1 ml RU-486 (4.34 mg/ml) for 5 days, while the other group was fed 50x C. pluricaulis food containing 1 ml ethanol for 5 days. These flies were then subjected to a short variable stress (SVS) regime followed by SPT.
Measurement of food intake
The food intake in flies fed the C. pluricaulis diet was measured by the EX-Q assay.75,117 Ex-Q tubes were 14 mL round-bottom dual-position snap cap tubes (Tarsons 860020). The inbuilt cavity in the cap of the tube was used as a food container. Six air holes were made in the cap around the cavity using a pushpin. For C. pluricaulis food used in EX-Q experiments, 1% agarose (Seakem LE agarose, Lonza 50004) was used for preparation instead of agar. The Erioglaucine (SRL 98188, for food) was added to the medium after cooling to 60°C.
Three-day old adult mated female or male flies were acclimatized to the experimental food for 48h for EX-Q assays in Figure panels 1A-B. C. pluricaulis-cornmeal medium containing 2.5% (w/v) Erioglaucine was used as the assay medium. Absorbance of solubilized excreta (1000μl) was measured at 630nm (Molecular Devices, SpectraMax i3x) in a 96-well plate. The food intake per fly was calculated from a standard curve prepared from stock solutions of pure dye (0.01-0.065 mg/ml). The absorbance of a 200 μL sample was measured at 630nm. A minimum of 6 replicates of 10 flies each were used for assays, and individual data points were plotted in each panel, and the number of replicates was noted in the figure legends. The blank calculations were performed by preparing homogenates from age-matched flies that were fed a food that lacked Erioglaucine.
Short variable stress (SVS) regime for inducing depression-like state in Drosophila
2-5-day-old adult flies were sorted according to sex in empty glass vials, containing 10 flies each. Male flies were exposed to 37°C for 20 minutes, fasted in empty vials for 6 hours, individually housed in 14 mL tubes for 18 hours, and placed in a -5°C ice-water bath for 10 minutes. Female flies were exposed to 37°C for 30 minutes, fasted for 8 hours, socially isolated in individual 14 ml tubes for 18 hours, and introduced to a -5°C ice-water bath for two rounds of cold shock, for 10 minutes each. Flies were then allowed to recover completely from cold anaesthesia before being used for behavioral assays.
Sucrose preference test (SPT)
The sucrose preference test was utilized to examine the reduced ability to experience pleasure, a core symptom of depression. Control and SVS regime subjected flies were transferred to empty vials in groups of 10 and uniformly fasted for 1.5 hours to allow them to develop an appetite. The cotton plugging of vials were then replaced with sponge cap containing two holes. Two capillaries containing 5 μL each of autoclaved RO water coloured with blue food dye and 5% sucrose solution coloured with red food dye were introduced through these sponge caps. Flies were then allowed to consume both liquids for 3 hours. A control vial without flies was kept to account for evaporative loss. After 3 hours, the capillaries were removed, and the liquid left in the capillary was measured.118 All vials were kept at 24°C and at 50% RH. Assays were performed during the daytime of their circadian cycle. The Sucrose preference index was calculated using the following formula:
| Preference Index = (Sucrose consumed per fly - water consumed per fly)/total liquid consumed per fly. |
Forced swimming test (FST)
Control and SVS-regime-exposed wild-type flies, housed in individual 14-ml polystyrene tubes, were introduced into a novel arena containing 4ml of 0.08% SDS solution. Petri dishes with a diameter of 40 mm were filled with 4 mL of 0.08% SDS (to prevent the flies from flying). Flies were individually put in the Petri dishes containing SDS, and their activity was recorded. The flies were allowed to swim, and their swimming time until absolute immobility was recorded in real time. Each video was analyzed for the latency until first immobility.119 To confirm that the locomotor activity of flies was not compromised by the stress regime or the assay, each fly was gently transferred onto a blotting paper and assessed for its ability to walk. Only flies that were capable of normal walking behavior after the assay were included in the final analyses. Until the experiment, flies were maintained with a mean number of 20 flies per vial under controlled conditions at 25°C, 55–65% humidity, and 12:12h dark-light cycle.
Sample preparation for metabolomic analysis
Samples were prepared from 25 adult flies exposed to a control corn meal diet or C. pluricaulis-supplemented diet. Briefly, the samples were frozen in liquid nitrogen in 2 mL screw cap vials with ceramic beads and stored in -80°C until preparation of the lysate. The sample lysate was prepared by homogenizing the samples in 90% chilled methanol, followed by one hour incubation at -20°C to precipitate proteins, and the sample was centrifuged to remove insoluble debris. The supernatant was dried in a SpeedVac, and the metabolite containing precipitate was analysed.
RNA isolation and quantitative real-time PCR
Total RNA was extracted from 5-10 adult flies using RNAiso Plus (Takara Bio, Inc).120,121 Animals were homogenized in 0.2 ml of RNAiso Plus with a white micropestle (Tarsons) prior to extraction. The cDNA was generated by using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, MA, USA). In each reaction 0.5-1μg of RNA was mixed with random hexamers, MgCl2, 10X RT Buffer, dNTPs, RNAse Inhibitor and MultiScribe Reverse transcriptase in a 10μL total volume. The cDNA synthesis was performed as per the manufacturer’s protocol in a Bio-Rad C1000 Touch Thermal Cycler or Bio-Rad T100 Thermal Cycler. The synthesized cDNA was diluted (1:5) and used as template for quantitative real-time PCR (qRT-PCR) using SYBR premix EX-taq plus (TaKaRa) and analyzed on Quant Studio 6 Real-Time PCR machine (Applied Biosystems, Foster City, CA, USA) or Bio-Rad CFX Opus 96 real-time PCR system. The expression of the target genes was normalized to actin-5C. Primers used for RT-PCR are noted in the key resources table.
Survivability assay
The Kaplan-Meier method was utilized to generate survival curves for all lifespan experiments using the Online Application for the Survival Analysis of lifespan assays (OASIS) and GraphPad prism and the p-values were calculated using the log-rank (Mantel-cox) test (Table S4).122,123 All experiments were performed with flies that were allowed 48 h to mate after emerging as adults. On the third day after eclosion, flies were anesthetized with carbon dioxide, sorted, and distributed between different dietary regimes for experiments. Around 20 flies were transferred to each vial. For longevity assay live flies were transferred to fresh medium every 2 day and counted every alternate day until no flies remained.
Mass spectrometry analysis of samples
All GC-MS analysis was performed at the Core facility in the university of Utah with an Agilent 5977b GC-MS MSD-HES and an Agilent 7693A automatic liquid sampler. Dried samples were suspended in 40 μL of a 40 mg/mL O-methoxylamine hydrochloride (MOX) (MP Bio #155405) in dry pyridine (EMD Millipore #PX2012-7) and incubated for one hour at 37°C in a sand bath. 25 μL of this solution was added to auto sampler vials. 60 μL of N-methyl-N-trimethylsilyltrifluoracetamide (MSTFA with 1%TMCS, Thermo #TS48913) was added automatically via the auto sampler and incubated for 30 minutes at 37°C. After incubation, samples were vortexed and 1 μL of the prepared sample was injected into the gas chromatograph inlet in the split mode with the inlet temperature held at 250°C. A 5:1 split ratio was used for analysis for the majority of metabolites. Any metabolites that saturated the instrument at the 5:1 split were analyzed at a 50:1 split ratio. The gas chromatograph had an initial temperature of 60°C for one minute followed by a 10°C/min ramp to 325°C and a hold time of 10 minutes. A 30-meter Agilent Zorbax DB-5MS with 10 m Duraguard capillary column was employed for chromatographic separation. Helium was used as the carrier gas at a rate of 1 mL/min.
Data was collected using MassHunter software (Agilent). Metabolites were identified and their peak area was recorded using MassHunter Quant. This data was transferred to an Excel spread sheet (Microsoft, Redmond WA). Metabolite identity was established using a combination of an in-house metabolite library developed using pure purchased standards, the NIST library and the Fiehn library. Data was analyzed using in-house software to prepare for analysis by the ”MetaboAnalyst“ software tool.
Quantification and statistical analysis
Statistical analysis and data presentation were performed with GraphPad Prism 10 software, OASIS, and Microsoft Excel. Survival curves were compared using log-rank tests and in figures where multiple comparisons were made p-values were calculated after applying Bonferroni’s correction and noted in the figure legends and Tables. All survival and lifespan graphs show two repeats with cohorts of 150-200 female flies per genotype, with 20 flies per vial. An ordinary one-way ANOVA was used to analyze data from the fluoxetine treatment, with multiple comparisons. All RT-PCR analyses were performed with three independent biological replicates and two technical replicates per biological replicate; individual data points were plotted in all graphs. The Fisher Least Significant Difference (LSD) Method was used to compare means from multiple processes, and adjusted p-values for all comparisons were computed by applying Bonferroni’s correction and noted in the figure legends. The significant p-values were denoted in red font, and the non-significant values were noted in black font. Statistical significance was set at p < 0.05.
Metabolomic datasets were analyzed using MetaboAnalyst 5.0. Data was analyzed using one-factor statistical analysis. Raw peak intensities were entered in rows. Data were then normalized to the median and autoscaled. The variance filter was set at 5% Mean Absolute Deviation (MAD), and the Abundance filter was set at 0% Median Intensity Value. Principal Component Analysis (PCA) was performed, and the scores plot was obtained. The volcano plot was generated using the same parameters.
Additional resources
The Metabolomic analysis raw data files can be accessed directly via its Project DOI: https://doi.org/10.21228/M8383Q.
Published: December 1, 2025
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2025.114296.
Supplemental information
References
- 1.Ormel J., Kessler R.C., Schoevers R. Depression: more treatment but no drop in prevalence: how effective is treatment? And can we do better? Curr. Opin. Psychiatry. 2019;32:348–354. doi: 10.1097/yco.0000000000000505. [DOI] [PubMed] [Google Scholar]
- 2.Hengartner M.P., Passalacqua S., Andreae A., Heinsius T., Hepp U., Rössler W., von Wyl A. Antidepressant Use During Acute Inpatient Care Is Associated With an Increased Risk of Psychiatric Rehospitalisation Over a 12-Month Follow-Up After Discharge. Front. Psychiatry. 2019;10:79. doi: 10.3389/fpsyt.2019.00079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rootes-Murdy K., Carlucci M., Tibbs M., Wachtel L.E., Sherman M.F., Zandi P.P., Reti I.M. Non-suicidal self-injury and electroconvulsive therapy: Outcomes in adolescent and young adult populations. J. Affect. Disord. 2019;250:94–98. doi: 10.1016/j.jad.2019.02.057. [DOI] [PubMed] [Google Scholar]
- 4.Liang S., Wu X., Hu X., Wang T., Jin F. Recognizing Depression from the Microbiota(-)Gut(-)Brain Axis. Int. J. Mol. Sci. 2018;19 doi: 10.3390/ijms19061592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Troubat R., Barone P., Leman S., Desmidt T., Cressant A., Atanasova B., Brizard B., El Hage W., Surget A., Belzung C., Camus V. Neuroinflammation and depression: A review. Eur. J. Neurosci. 2021;53:151–171. doi: 10.1111/ejn.14720. [DOI] [PubMed] [Google Scholar]
- 6.Moylan S., Berk M., Dean O.M., Samuni Y., Williams L.J., O'Neil A., Hayley A.C., Pasco J.A., Anderson G., Jacka F.N., Maes M. Oxidative & nitrosative stress in depression: why so much stress? Neurosci. Biobehav. Rev. 2014;45:46–62. doi: 10.1016/j.neubiorev.2014.05.007. [DOI] [PubMed] [Google Scholar]
- 7.Mikulska J., Juszczyk G., Gawrońska-Grzywacz M., Herbet M. HPA Axis in the Pathomechanism of Depression and Schizophrenia: New Therapeutic Strategies Based on Its Participation. Brain Sci. 2021;11 doi: 10.3390/brainsci11101298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Autry A.E., Monteggia L.M. Brain-derived neurotrophic factor and neuropsychiatric disorders. Pharmacol. Rev. 2012;64:238–258. doi: 10.1124/pr.111.005108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Foster J.A., McVey Neufeld K.A. Gut-brain axis: how the microbiome influences anxiety and depression. Trends Neurosci. 2013;36:305–312. doi: 10.1016/j.tins.2013.01.005. [DOI] [PubMed] [Google Scholar]
- 10.Allen J., Romay-Tallon R., Brymer K.J., Caruncho H.J., Kalynchuk L.E. Mitochondria and Mood: Mitochondrial Dysfunction as a Key Player in the Manifestation of Depression. Front. Neurosci. 2018;12:386. doi: 10.3389/fnins.2018.00386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Duman R.S., Aghajanian G.K., Sanacora G., Krystal J.H. Synaptic plasticity and depression: new insights from stress and rapid-acting antidepressants. Nat. Med. 2016;22:238–249. doi: 10.1038/nm.4050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cui L., Li S., Wang S., Wu X., Liu Y., Yu W., Wang Y., Tang Y., Xia M., Li B. Major depressive disorder: hypothesis, mechanism, prevention and treatment. Signal Transduct. Target. Ther. 2024;9:30. doi: 10.1038/s41392-024-01738-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ménard C., Hodes G.E., Russo S.J. Pathogenesis of depression: Insights from human and rodent studies. Neuroscience. 2016;321:138–162. doi: 10.1016/j.neuroscience.2015.05.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jesulola E., Micalos P., Baguley I.J. Understanding the pathophysiology of depression: From monoamines to the neurogenesis hypothesis model - are we there yet? Behav. Brain Res. 2018;341:79–90. doi: 10.1016/j.bbr.2017.12.025. [DOI] [PubMed] [Google Scholar]
- 15.Mrozek W., Socha J., Sidorowicz K., Skrok A., Syrytczyk A., Piątkowska-Chmiel I., Herbet M. Pathogenesis and treatment of depression: Role of diet in prevention and therapy. Nutrition. 2023;115 doi: 10.1016/j.nut.2023.112143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wang H.-Q., Wang Z.-Z., Chen N.-H. The receptor hypothesis and the pathogenesis of depression: Genetic bases and biological correlates. Pharmacol. Res. 2021;167 doi: 10.1016/j.phrs.2021.105542. [DOI] [PubMed] [Google Scholar]
- 17.Karad V., Gupta G.L. Phytochemicals encouraging neurotrophic pathways: brain-derived neurotrophic factors as molecular targets in depression. Naunyn-Schmiedebergs Arch Pharmacol. 2025;398:15075–15094. doi: 10.1007/s00210-025-04298-2. [DOI] [PubMed] [Google Scholar]
- 18.Cipriani A., Furukawa T.A., Salanti G., Chaimani A., Atkinson L.Z., Ogawa Y., Leucht S., Ruhe H.G., Turner E.H., Higgins J.P.T., et al. Comparative efficacy and acceptability of 21 antidepressant drugs for the acute treatment of adults with major depressive disorder: a systematic review and network meta-analysis. Lancet. 2018;391:1357–1366. doi: 10.1016/S0140-6736(17)32802-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Blier P., El Mansari M. Serotonin and beyond: therapeutics for major depression. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2013;368 doi: 10.1098/rstb.2012.0536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Arroll B., Chin W.-y., Martis W., Goodyear-Smith F., Mount V., Kingsford D., Humm S., Blashki G., MacGillivray S. Antidepressants for treatment of depression in primary care: a systematic review and meta-analysis. J. Prim. Health Care. 2016;8:325–334. doi: 10.1071/HC16008. [DOI] [PubMed] [Google Scholar]
- 21.Baldwin D.S., Waldman S., Allgulander C. Evidence-based pharmacological treatment of generalized anxiety disorder. Int. J. Neuropsychopharmacol. 2011;14:697–710. doi: 10.1017/S1461145710001434. [DOI] [PubMed] [Google Scholar]
- 22.Bandelow B., Michaelis S. Epidemiology of anxiety disorders in the 21st century. Dialogues Clin. Neurosci. 2015;17:327–335. doi: 10.31887/DCNS.2015.17.3/bbandelow. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Rush A.J., Trivedi M.H., Wisniewski S.R., Nierenberg A.A., Stewart J.W., Warden D., Niederehe G., Thase M.E., Lavori P.W., Lebowitz B.D., et al. Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR∗D report. Am. J. Psychiatry. 2006;163:1905–1917. doi: 10.1176/ajp.2006.163.11.1905. [DOI] [PubMed] [Google Scholar]
- 24.Fava M., Kendler K.S. Major depressive disorder. Neuron. 2000;28:335–341. doi: 10.1016/s0896-6273(00)00112-4. [DOI] [PubMed] [Google Scholar]
- 25.Fava M. Weight gain and antidepressants. J. Clin. Psychiatry. 2000;6:37–41. [PubMed] [Google Scholar]
- 26.Duman R.S., Aghajanian G.K. Synaptic dysfunction in depression: potential therapeutic targets. Science. 2012;338:68–72. doi: 10.1126/science.1222939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Krishnan V., Nestler E.J. The molecular neurobiology of depression. Nature. 2008;455:894–902. doi: 10.1038/nature07455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sarris J., McIntyre E., Camfield D.A. Plant-based medicines for anxiety disorders, part 2: a review of clinical studies with supporting preclinical evidence. CNS Drugs. 2013;27:301–319. doi: 10.1007/s40263-013-0059-9. [DOI] [PubMed] [Google Scholar]
- 29.Jonas W.B., Eisenberg D., Hufford D., Crawford C. The evolution of complementary and alternative medicine (CAM) in the USA over the last 20 years. Forsch. Komplementmed. 2013;20:65–72. doi: 10.1159/000348284. [DOI] [PubMed] [Google Scholar]
- 30.Ding W., Wang L., Li L., Li H., Wu J., Zhang J., Wang J. Pathogenesis of depression and the potential for traditional Chinese medicine treatment. Front. Pharmacol. 2024;15 doi: 10.3389/fphar.2024.1407869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Remali J., Aizat W.M. Medicinal plants and plant-based traditional medicine: Alternative treatments for depression and their potential mechanisms of action. Heliyon. 2024;10 doi: 10.1016/j.heliyon.2024.e38986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sharma R., Singla R.K., Banerjee S., Sinha B., Shen B., Sharma R. Role of Shankhpushpi (Convolvulus pluricaulis) in neurological disorders: An umbrella review covering evidence from ethnopharmacology to clinical studies. Neurosci. Biobehav. Rev. 2022;140 doi: 10.1016/j.neubiorev.2022.104795. [DOI] [PubMed] [Google Scholar]
- 33.Mishra S., Sethiya N.K. Review on ethnomedicinal uses and phytopharmacology of memory boosting herb'Convolvulus pluricaulis' Choisy. Aust. J. Med. Herbal. 2010;22:19–25. [Google Scholar]
- 34.Halder S., Anand U., Nandy S., Oleksak P., Qusti S., Alshammari E.M., El-Saber Batiha G., Koshy E.P., Dey A. Herbal drugs and natural bioactive products as potential therapeutics: A review on pro-cognitives and brain boosters perspectives. Saudi Pharm. J. 2021;29:879–907. doi: 10.1016/j.jsps.2021.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Verma S., Sinha R., Kumar P., Amin F., Jain J., Tanwar S. Study of Convolvulus pluricaulis for antioxidant and anticonvulsant activity. Cent. Nerv. Syst. Agents Med. Chem. 2012;12:55–59. doi: 10.2174/187152412800229161. [DOI] [PubMed] [Google Scholar]
- 36.Sethiya N.K., Nahata A., Singh P.K., Mishra S.H. Neuropharmacological evaluation on four traditional herbs used as nervine tonic and commonly available as Shankhpushpi in India. J. Ayurveda Integr. Med. 2019;10:25–31. doi: 10.1016/j.jaim.2017.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Nahata A., Patil U.K., Dixit V.K. Anxiolytic activity of Evolvulus alsinoides and Convulvulus pluricaulis in rodents. Pharm. Biol. 2009;47:444–451. [Google Scholar]
- 38.Dhingra D., Valecha R. Evaluation of the antidepressant-like activity of Convolvulus pluricaulis choisy in the mouse forced swim and tail suspension tests. Med. Sci. Monit. 2007;13:Br155–Br161. [PubMed] [Google Scholar]
- 39.Kizhakke P A., Olakkaran S., Antony A., Tilagul K S., Hunasanahally P G. Convolvulus pluricaulis (Shankhapushpi) ameliorates human microtubule-associated protein tau (hMAPτ) induced neurotoxicity in Alzheimer’s disease Drosophila model. J. Chem. Neuroanat. 2019;95:115–122. doi: 10.1016/j.jchemneu.2017.10.002. [DOI] [PubMed] [Google Scholar]
- 40.Gupta G.L., Fernandes J. Protective effect of Convolvulus pluricaulis against neuroinflammation associated depressive behavior induced by chronic unpredictable mild stress in rat. Biomed. Pharmacother. 2019;109:1698–1708. doi: 10.1016/j.biopha.2018.11.046. [DOI] [PubMed] [Google Scholar]
- 41.Shalavadi M.H., Chandrashekhar V.M., Muchchandi I.S. Neuroprotective effect of Convolvulus pluricaulis Choisy in oxidative stress model of cerebral ischemia reperfusion injury and assessment of MAP2 in rats. J. Ethnopharmacol. 2020;249 doi: 10.1016/j.jep.2019.112393. [DOI] [PubMed] [Google Scholar]
- 42.Bihaqi S.W., Singh A.P., Tiwari M. In vivo investigation of the neuroprotective property of Convolvulus pluricaulis in scopolamine-induced cognitive impairments in Wistar rats. Indian J. Pharmacol. 2011;43:520–525. doi: 10.4103/0253-7613.84958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Bihaqi S.W., Sharma M., Singh A.P., Tiwari M. Neuroprotective role of Convolvulus pluricaulis on aluminium induced neurotoxicity in rat brain. J. Ethnopharmacol. 2009;124:409–415. doi: 10.1016/j.jep.2009.05.038. [DOI] [PubMed] [Google Scholar]
- 44.Garg G., Patil A.N., Kumar R., Bhatia A., Kasudhan K.S., Pattanaik S. Protective role of Convolvulus pluricaulis on lipid abnormalities in high-fat diet with low dose streptozotocin-induced experimental rat model. J. Ayurveda Integr. Med. 2020;11:426–431. doi: 10.1016/j.jaim.2020.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Rachitha P., Krupashree K., Jayashree G.V., Kandikattu H.K., Amruta N., Gopalan N., Rao M.K., Khanum F. Chemical composition, antioxidant potential, macromolecule damage and neuroprotective activity of Convolvulus pluricaulis. J. Tradit. Complement. Med. 2018;8:483–496. doi: 10.1016/j.jtcme.2017.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Bhalerao S.A., Verma D.R., Teli N.C., Trikannad A.A. Ethnobotany, phytochemistry and pharmacology of Convolvulus pluricaulis, choisy. Res. J. Pharm., Biol. Chem. Sci. 2014;5:629–636. [Google Scholar]
- 47.Agarwa P., Sharma B., Fatima A., Jain S.K. An update on Ayurvedic herb Convolvulus pluricaulis Choisy. Asian Pac. J. Trop. Biomed. 2014;4:245–252. doi: 10.1016/S2221-1691(14)60240-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Abelaira H.M., Réus G.Z., Quevedo J. Animal models as tools to study the pathophysiology of depression. Brazilian Journal of Psychiatry. 2013;35:S112–S120. doi: 10.1590/1516-4446-2013-1098. [DOI] [PubMed] [Google Scholar]
- 49.Hibicke M., Nichols C.D. Validation of the forced swim test in Drosophila, and its use to demonstrate psilocybin has long-lasting antidepressant-like effects in flies. Sci. Rep. 2022;12 doi: 10.1038/s41598-022-14165-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Rasti A.R., Coombe V.E., Muzik J.R., Kliethermes C.L. Pharmacological characterization of the forced swim test in Drosophila melanogaster. Invert. Neurosci. 2020;20:22. doi: 10.1007/s10158-020-00255-1. [DOI] [PubMed] [Google Scholar]
- 51.Heier C., Kühnlein R.P. Triacylglycerol Metabolism in Drosophila melanogaster. Genetics. 2018;210:1163–1184. doi: 10.1534/genetics.118.301583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Wat L.W., Chowdhury Z.S., Millington J.W., Biswas P., Rideout E.J. Sex determination gene transformer regulates the male-female difference in Drosophila fat storage via the adipokinetic hormone pathway. eLife. 2021;10 doi: 10.7554/eLife.72350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Yellman C., Tao H., He B., Hirsh J. Conserved and sexually dimorphic behavioral responses to biogenic amines in decapitated Drosophila. Proc. Natl. Acad. Sci. USA. 1997;94:4131–4136. doi: 10.1073/pnas.94.8.4131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Ferreira N.R., Vitorino C., Fortuna A. From antioxidant to neuromodulator: The role of ascorbate in the management of major depression disorder. Biochem. Pharmacol. 2022;206 doi: 10.1016/j.bcp.2022.115300. [DOI] [PubMed] [Google Scholar]
- 55.Suh H.J., Shin B., Han S.-H., Woo M.J., Hong K.-B. Behavioral Changes and Survival in Drosophila melanogaster: Effects of Ascorbic Acid, Taurine, and Caffeine. Biol. Pharm. Bull. 2017;40:1873–1882. doi: 10.1248/bpb.b17-00321. [DOI] [PubMed] [Google Scholar]
- 56.May J.M. Vitamin C transport and its role in the central nervous system. Subcell. Biochem. 2012;56:85–103. doi: 10.1007/978-94-007-2199-9_6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Pan J.-X., Xia J.-J., Deng F.-L., Liang W.-W., Wu J., Yin B.-M., Dong M.-X., Chen J.-J., Ye F., Wang H.-Y., et al. Diagnosis of major depressive disorder based on changes in multiple plasma neurotransmitters: a targeted metabolomics study. Transl. Psychiatry. 2018;8:130. doi: 10.1038/s41398-018-0183-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Calero C.I., Vickers E., Moraga Cid G., Aguayo L.G., von Gersdorff H., Calvo D.J. Allosteric modulation of retinal GABA receptors by ascorbic acid. J. Neurosci. 2011;31:9672–9682. doi: 10.1523/jneurosci.5157-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Chung B.Y., Kilman V.L., Keath J.R., Pitman J.L., Allada R. The GABA(A) receptor RDL acts in peptidergic PDF neurons to promote sleep in Drosophila. Curr. Biol. 2009;19:386–390. doi: 10.1016/j.cub.2009.01.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Kauffman M.R., DiAngelo J.R. Glut1 Functions in Insulin-Producing Neurons to Regulate Lipid and Carbohydrate Storage in Drosophila. Biomolecules. 2024;14 doi: 10.3390/biom14081037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Betz L.S., DiAngelo J.R. The regulation of triglyceride and glycogen storage by Glucose transporter 1 ( Glut1 ) in Drosophila fat tissue. MicroPubl. Biol. 2024;2024 doi: 10.17912/micropub.biology.001134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Reveillaud I., Phillips J., Duyf B., Hilliker A., Kongpachith A., Fleming J.E. Phenotypic rescue by a bovine transgene in a Cu/Zn superoxide dismutase-null mutant of Drosophila melanogaster. Mol. Cell Biol. 1994;14:1302–1307. doi: 10.1128/mcb.14.2.1302-1307.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Wicks S., Bain N., Duttaroy A., Hilliker A.J., Phillips J.P. Hypoxia rescues early mortality conferred by superoxide dismutase deficiency. Free Radic. Biol. Med. 2009;46:176–181. doi: 10.1016/j.freeradbiomed.2008.09.036. [DOI] [PubMed] [Google Scholar]
- 64.Parkes T.L., Elia A.J., Dickinson D., Hilliker A.J., Phillips J.P., Boulianne G.L. Extension of Drosophila lifespan by overexpression of human SOD1 in motorneurons. Nat. Genet. 1998;19:171–174. doi: 10.1038/534. [DOI] [PubMed] [Google Scholar]
- 65.Lebovitz R.M., Zhang H., Vogel H., Cartwright J., Jr., Dionne L., Lu N., Huang S., Matzuk M.M. Neurodegeneration, myocardial injury, and perinatal death in mitochondrial superoxide dismutase-deficient mice. Proc. Natl. Acad. Sci. USA. 1996;93:9782–9787. doi: 10.1073/pnas.93.18.9782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Li Y., Huang T.T., Carlson E.J., Melov S., Ursell P.C., Olson J.L., Noble L.J., Yoshimura M.P., Berger C., Chan P.H., et al. Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat. Genet. 1995;11:376–381. doi: 10.1038/ng1295-376. [DOI] [PubMed] [Google Scholar]
- 67.Samet J.M., Wages P.A. Oxidative Stress from Environmental Exposures. Curr. Opin. Toxicol. 2018;7:60–66. [PMC free article] [PubMed] [Google Scholar]
- 68.Eleutherio E.C.A., Silva Magalhães R.S., de Araújo Brasil A., Monteiro Neto J.R., de Holanda Paranhos L. SOD1, more than just an antioxidant. Arch. Biochem. Biophys. 2021;697 doi: 10.1016/j.abb.2020.108701. [DOI] [PubMed] [Google Scholar]
- 69.von Ossowski I., Hausner G., Loewen P.C. Molecular evolutionary analysis based on the amino acid sequence of catalase. J. Mol. Evol. 1993;37:71–76. doi: 10.1007/bf00170464. [DOI] [PubMed] [Google Scholar]
- 70.Deisseroth A., Dounce A.L. Catalase: Physical and chemical properties, mechanism of catalysis, and physiological role. Physiol. Rev. 1970;50:319–375. doi: 10.1152/physrev.1970.50.3.319. [DOI] [PubMed] [Google Scholar]
- 71.Osterwalder T., Yoon K.S., White B.H., Keshishian H. A conditional tissue-specific transgene expression system using inducible GAL4. Proc. Natl. Acad. Sci. USA. 2001;98:12596–12601. doi: 10.1073/pnas.221303298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Dhuna K., Dhuna V., Bhatia G., Singh J., Kamboj S.S. Neuroprotective Effect of Convolvulus pluricaulis Methanol Extract on Hydrogen Peroxide Induced Oxidative Stress in Human IMR32 Neuroblastoma Cell Line. Br. Biotechnol. J. 2012;2:192–210. [Google Scholar]
- 73.Rzezniczak T.Z., Douglas L.A., Watterson J.H., Merritt T.J.S. Paraquat administration in Drosophila for use in metabolic studies of oxidative stress. Anal. Biochem. 2011;419:345–347. doi: 10.1016/j.ab.2011.08.023. [DOI] [PubMed] [Google Scholar]
- 74.Bus J.S., Gibson J.E. Paraquat: model for oxidant-initiated toxicity. Environ. Health Perspect. 1984;55:37–46. doi: 10.1289/ehp.845537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Pandey M., Bansal S., Chawla G. Evaluation of lifespan promoting effects of biofortified wheat in Drosophila melanogaster. Exp. Gerontol. 2022;160 doi: 10.1016/j.exger.2022.111697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Magwere T., West M., Riyahi K., Murphy M.P., Smith R.A.J., Partridge L. The effects of exogenous antioxidants on lifespan and oxidative stress resistance in Drosophila melanogaster. Mech. Ageing Dev. 2006;127:356–370. doi: 10.1016/j.mad.2005.12.009. [DOI] [PubMed] [Google Scholar]
- 77.Missirlis F., Phillips J.P., Jäckle H. Cooperative action of antioxidant defense systems in <em>Drosophila</em>. Curr. Biol. 2001;11:1272–1277. doi: 10.1016/S0960-9822(01)00393-1. [DOI] [PubMed] [Google Scholar]
- 78.Goyal M., Tomar A., Madhwal S., Mukherjee T. Blood progenitor redox homeostasis through olfaction-derived systemic GABA in hematopoietic growth control in Drosophila. Development. 2022;149 doi: 10.1242/dev.199550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Andrisse S., Koehler R.M., Chen J.E., Patel G.D., Vallurupalli V.R., Ratliff B.A., Warren D.E., Fisher J.S. Role of GLUT1 in regulation of reactive oxygen species. Redox Biol. 2014;2:764–771. doi: 10.1016/j.redox.2014.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Gęgotek A., Skrzydlewska E. Antioxidative and Anti-Inflammatory Activity of Ascorbic Acid. Antioxidants. 2022;11 doi: 10.3390/antiox11101993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Sharma P. Cinnamic acid derivatives: A new chapter of various pharmacological activities. J. Chem. Pharmaceut. Res. 2011;3:403. [Google Scholar]
- 82.Ravichandra V.D., Ramesh C., Sridhar K.A. Hepatoprotective potentials of aqueous extract of Convolvulus pluricaulis against thioacetamide induced liver damage in rats. Biomedicine & Aging Pathology. 2013;3:131–135. [Google Scholar]
- 83.Sethiya N.K., Nahata A., Mishra S.H., Dixit V.K. An update on Shankhpushpi, a cognition-boosting Ayurvedic medicine. Zhong xi yi jie he xue bao= Journal of Chinese integrative medicine. 2009;7:1001–1022. doi: 10.3736/jcim20091101. [DOI] [PubMed] [Google Scholar]
- 84.Siddiqui N.A., Ahmad N., Musthaq N., Chattopadhyaya I., Kumria R., Gupta S. Neuropharmacological Profile of Extracts of Aerial Parts of Convolvulus pluricaulis Choisy in Mice Model. Open Neurol. J. 2014;8:11–14. doi: 10.2174/1874205X01408010011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Balkrishna A., Thakur P., Varshney A. Phytochemical Profile, Pharmacological Attributes and Medicinal Properties of Convolvulus prostratus - A Cognitive Enhancer Herb for the Management of Neurodegenerative Etiologies. Front. Pharmacol. 2020;11:171. doi: 10.3389/fphar.2020.00171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Juszczyk G., Mikulska J., Kasperek K., Pietrzak D., Mrozek W., Herbet M. Chronic Stress and Oxidative Stress as Common Factors of the Pathogenesis of Depression and Alzheimer's Disease: The Role of Antioxidants in Prevention and Treatment. Antioxidants. 2021;10 doi: 10.3390/antiox10091439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Herbet M., Korga A., Gawrońska-Grzywacz M., Izdebska M., Piątkowska-Chmiel I., Poleszak E., Wróbel A., Matysiak W., Jodłowska-Jędrych B., Dudka J. Chronic Variable Stress Is Responsible for Lipid and DNA Oxidative Disorders and Activation of Oxidative Stress Response Genes in the Brain of Rats. Oxid. Med. Cell. Longev. 2017;2017 doi: 10.1155/2017/7313090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Salim S. Oxidative stress and psychological disorders. Curr. Neuropharmacol. 2014;12:140–147. doi: 10.2174/1570159x11666131120230309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Kurutas E.B. The importance of antioxidants which play the role in cellular response against oxidative/nitrosative stress: current state. Nutr. J. 2016;15:71. doi: 10.1186/s12937-016-0186-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Bhol N.K., Bhanjadeo M.M., Singh A.K., Dash U.C., Ojha R.R., Majhi S., Duttaroy A.K., Jena A.B. The interplay between cytokines, inflammation, and antioxidants: mechanistic insights and therapeutic potentials of various antioxidants and anti-cytokine compounds. Biomed. Pharmacother. 2024;178 doi: 10.1016/j.biopha.2024.117177. [DOI] [PubMed] [Google Scholar]
- 91.Wu A., Zhang J. Neuroinflammation, memory, and depression: new approaches to hippocampal neurogenesis. J. Neuroinflammation. 2023;20:283. doi: 10.1186/s12974-023-02964-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Zuo C., Cao H., Song Y., Gu Z., Huang Y., Yang Y., Miao J., Zhu L., Chen J., Jiang Y., Wang F. Nrf2: An all-rounder in depression. Redox Biol. 2022;58 doi: 10.1016/j.redox.2022.102522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Xu Y., Wang C., Klabnik J.J., O'Donnell J.M. Novel therapeutic targets in depression and anxiety: antioxidants as a candidate treatment. Curr. Neuropharmacol. 2014;12:108–119. doi: 10.2174/1570159x11666131120231448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Nualart F., Mack L., García A., Cisternas P., Bongarzone E.R., Heitzer M., Jara N., Martínez F., Ferrada L., Espinoza F., et al. Vitamin C Transporters, Recycling and the Bystander Effect in the Nervous System: SVCT2 versus Gluts. J. Stem Cell Res. Ther. 2014;4:209. doi: 10.4172/2157-7633.1000209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Yin R., Mao S.Q., Zhao B., Chong Z., Yang Y., Zhao C., Zhang D., Huang H., Gao J., Li Z., et al. Ascorbic acid enhances Tet-mediated 5-methylcytosine oxidation and promotes DNA demethylation in mammals. J. Am. Chem. Soc. 2013;135:10396–10403. doi: 10.1021/ja4028346. [DOI] [PubMed] [Google Scholar]
- 96.Chen J., Guo L., Zhang L., Wu H., Yang J., Liu H., Wang X., Hu X., Gu T., Zhou Z., et al. Vitamin C modulates TET1 function during somatic cell reprogramming. Nat. Genet. 2013;45:1504–1509. doi: 10.1038/ng.2807. [DOI] [PubMed] [Google Scholar]
- 97.Agathocleous M., Meacham C.E., Burgess R.J., Piskounova E., Zhao Z., Crane G.M., Cowin B.L., Bruner E., Murphy M.M., Chen W., et al. Ascorbate regulates haematopoietic stem cell function and leukaemogenesis. Nature. 2017;549:476–481. doi: 10.1038/nature23876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Han Q.-Q., Wu P.-F., Li Y.-H., Cao Y., Chen J.-G., Wang F. SVCT2–mediated ascorbic acid uptake buffers stress responses via DNA hydroxymethylation reprogramming of S100 calcium-binding protein A4 gene. Redox Biol. 2022;58 doi: 10.1016/j.redox.2022.102543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Barbu M.C., Shen X., Walker R.M., Howard D.M., Evans K.L., Whalley H.C., Porteous D.J., Morris S.W., Deary I.J., Zeng Y., et al. Epigenetic prediction of major depressive disorder. Mol. Psychiatry. 2021;26:5112–5123. doi: 10.1038/s41380-020-0808-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Wang J., Hodes G.E., Zhang H., Zhang S., Zhao W., Golden S.A., Bi W., Menard C., Kana V., Leboeuf M., et al. Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice. Nat. Commun. 2018;9:477. doi: 10.1038/s41467-017-02794-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Kokacya M.H., Bahceci B., Bahceci I., Dilek A.R., Dokuyucu R. Prolidase activity and oxidative stress in patients with major depressive disorder. Psychiatr. Danub. 2014;26:314–318. [PubMed] [Google Scholar]
- 102.Ghaemi Kerahrodi J., Michal M. The fear-defense system, emotions, and oxidative stress. Redox Biol. 2020;37 doi: 10.1016/j.redox.2020.101588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103.Amr M., El-Mogy A., Shams T., Vieira K., Lakhan S.E. Efficacy of vitamin C as an adjunct to fluoxetine therapy in pediatric major depressive disorder: a randomized, double-blind, placebo-controlled pilot study. Nutr. J. 2013;12:31. doi: 10.1186/1475-2891-12-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Moretti M., Colla A., de Oliveira Balen G., dos Santos D.B., Budni J., de Freitas A.E., Farina M., Severo Rodrigues A.L. Ascorbic acid treatment, similarly to fluoxetine, reverses depressive-like behavior and brain oxidative damage induced by chronic unpredictable stress. J. Psychiatr. Res. 2012;46:331–340. doi: 10.1016/j.jpsychires.2011.11.009. [DOI] [PubMed] [Google Scholar]
- 105.Moretti M., Budni J., Dos Santos D.B., Antunes A., Daufenbach J.F., Manosso L.M., Farina M., Rodrigues A.L.S. Protective effects of ascorbic acid on behavior and oxidative status of restraint-stressed mice. J. Mol. Neurosci. 2013;49:68–79. doi: 10.1007/s12031-012-9892-4. [DOI] [PubMed] [Google Scholar]
- 106.Binfaré R.W., Rosa A.O., Lobato K.R., Santos A.R.S., Rodrigues A.L.S. Ascorbic acid administration produces an antidepressant-like effect: Evidence for the involvement of monoaminergic neurotransmission. Prog. Neuro Psychopharmacol. Biol. Psychiatr. 2009;33:530–540. doi: 10.1016/j.pnpbp.2009.02.003. [DOI] [PubMed] [Google Scholar]
- 107.Gonzalez-Lopez E., Vrana K.E. Dopamine beta-hydroxylase and its genetic variants in human health and disease. J. Neurochem. 2020;152:157–181. doi: 10.1111/jnc.14893. [DOI] [PubMed] [Google Scholar]
- 108.Moretti M., Budni J., Ribeiro C.M., Rodrigues A.L.S. Involvement of different types of potassium channels in the antidepressant-like effect of ascorbic acid in the mouse tail suspension test. Eur. J. Pharmacol. 2012;687:21–27. doi: 10.1016/j.ejphar.2012.04.041. [DOI] [PubMed] [Google Scholar]
- 109.Maratha S., Sharma V., Walia V. Antidepressant Like Effect of Ascorbic Acid in Mice: Possible Involvement of NO-sGC-cGMP Signaling. Neurochem. Res. 2022;47:967–978. doi: 10.1007/s11064-021-03496-7. [DOI] [PubMed] [Google Scholar]
- 110.Grünewald R.A. Ascorbic acid in the brain. Brain Res. Rev. 1993;18:123–133. doi: 10.1016/0165-0173(93)90010-W. [DOI] [PubMed] [Google Scholar]
- 111.Moretti M., Budni J., Freitas A.E., Neis V.B., Ribeiro C.M., de Oliveira Balen G., Rieger D.K., Leal R.B., Rodrigues A.L.S. TNF-α-induced depressive-like phenotype and p38MAPK activation are abolished by ascorbic acid treatment. Eur. Neuropsychopharmacol. 2015;25:902–912. doi: 10.1016/j.euroneuro.2015.03.006. [DOI] [PubMed] [Google Scholar]
- 112.Covarrubias-Pinto A., Parra A.V., Mayorga-Weber G., Papic E., Vicencio I., Ehrenfeld P., Rivera F.J., Castro M.A. Impaired intracellular trafficking of sodium-dependent vitamin C transporter 2 contributes to the redox imbalance in Huntington's disease. J. Neurosci. Res. 2021;99:223–235. doi: 10.1002/jnr.24693. [DOI] [PubMed] [Google Scholar]
- 113.Covarrubias-Pinto A., Acuña A.I., Boncompain G., Papic E., Burgos P.V., Perez F., Castro M.A. Ascorbic acid increases SVCT2 localization at the plasma membrane by accelerating its trafficking from early secretory compartments and through the endocytic-recycling pathway. Free Radic. Biol. Med. 2018;120:181–191. doi: 10.1016/j.freeradbiomed.2018.03.013. [DOI] [PubMed] [Google Scholar]
- 114.Sud M., Fahy E., Cotter D., Azam K., Vadivelu I., Burant C., Edison A., Fiehn O., Higashi R., Nair K.S., et al. Metabolomics Workbench: An international repository for metabolomics data and metadata, metabolite standards, protocols, tutorials and training, and analysis tools. Nucleic Acids Res. 2016;44:D463–D470. doi: 10.1093/nar/gkv1042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Bolukbasi E., Khericha M., Regan J.C., Ivanov D.K., Adcott J., Dyson M.C., Nespital T., Thornton J.M., Alic N., Partridge L. Intestinal Fork Head Regulates Nutrient Absorption and Promotes Longevity. Cell Rep. 2017;21:641–653. doi: 10.1016/j.celrep.2017.09.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 116.Ramos-Hryb A.B., Ramirez M.F., Lino-de-Oliveira C., Pagani M.R. Stress-mediated hyperactivity and anhedonia resistant to diazepam and fluoxetine in drosophila. Stress. 2021;24:96–106. doi: 10.1080/10253890.2020.1759547. [DOI] [PubMed] [Google Scholar]
- 117.Wu Q., Yu G., Park S.J., Gao Y., Ja W.W., Yang M. Excreta Quantification (EX-Q) for Longitudinal Measurements of Food Intake in Drosophila. iScience. 2020;23 doi: 10.1016/j.isci.2019.100776. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Diegelmann S., Jansen A., Jois S., Kastenholz K., Velo Escarcena L., Strudthoff N., Scholz H. The CApillary FEeder Assay Measures Food Intake in Drosophila melanogaster. J. Vis. Exp. 2017;121:55024. doi: 10.3791/55024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 119.Neckameyer W.S., Nieto-Romero A.R. Response to stress in Drosophila is mediated by gender, age and stress paradigm. Stress. 2015;18:254–266. doi: 10.3109/10253890.2015.1017465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 120.Pandey M., Chawla G. In: Experiments with Drosophila for Biology Courses. Ranganath H.A., Lakhotia S.C., editors. Indian Academy of Sciences; 2021. Total RNA isolation from Drosophila using TRIzol based reagent; pp. 341–350. [Google Scholar]
- 121.Pandey M., Bansal S., Chawla G. In: Fundamental Approaches to Screen Abnormalities in Drosophila. Mishra M., editor. Springer US; 2020. Molecular Approaches for Analysis of Drosophila MicroRNAs; pp. 169–188. [DOI] [Google Scholar]
- 122.Han S.K., Lee D., Lee H., Kim D., Son H.G., Yang J.S., Lee S.J.V., Kim S. OASIS 2: online application for survival analysis 2 with features for the analysis of maximal lifespan and healthspan in aging research. Oncotarget. 2016;7:56147–56152. doi: 10.18632/oncotarget.11269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 123.Yang J.S., Nam H.J., Seo M., Han S.K., Choi Y., Nam H.G., Lee S.J., Kim S. OASIS: online application for the survival analysis of lifespan assays performed in aging research. PLoS One. 2011;6 doi: 10.1371/journal.pone.0023525. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
-
•
Metabolomics data have been deposited at NIH Common Fund’s National Metabolomics Data Repository website and will be released on 2025-12-14 at DOI (PR002774): https://doi.org/10.21228/M8383Q.
-
•
This paper does not report original code.
-
•
Any additional information required to reanalyze the data reported in this article will be shared upon request by the lead contact. Correspondence and requests for materials should be addressed to G.C. (geetanjali.chawla@snu.edu.in).







