ABSTRACT
Bone is a metabolically active tissue that is constantly being reformed and resorbed by osteoblasts and osteoclasts. Abnormal increases in osteoclast activity can lead to bone deterioration. This study investigated the potential beneficial effects of chrysin on osteoclast formation in RAW 264.7 murine macrophages and bone health in Sprague–Dawley rats. Tartrate‐resistant acid phosphatase (TRAP) staining was conducted to determine the effect of chrysin on osteoclast differentiation. Quantitative polymerase‐chain reaction, western blotting, and immunofluorescence were conducted to determine the molecular mechanism of chrysin in osteoclasts. Sprague–Dawley rats were fed a diet of 50 mg/kg chrysin from postnatal Day 7 until 22. On Day 130, the rats were euthanized, and their tibiae were extracted and assessed by micro‐computed tomography (microCT). Chrysin reduced the number of TRAP‐positive osteoclasts formed by inhibiting nuclear factor κB (NFκB) nuclear translocation. Crucial genes involved in the activation of osteoclasts were further down‐regulated. Chrysin significantly increased the area, volume, and segmented bone density of the midpoint of the tibiae. The findings suggest that chrysin inhibits osteoclastogenesis via the inhibition of the NFκB signaling pathway. Chrysin further induced moderate improvements in bone health parameters. These findings suggest chrysin may exert bone‐protective effects by inhibiting osteoclasts.
Keywords: bone health, chrysin, micro‐CT, osteoclasts
The effects of chrysin, a plant‐derived compound, were investigated on osteoclast formation in cell culture and bone health parameters in Sprague–Dawley rats. Chrysin was shown to disrupt key osteoclast signaling pathways and inhibit osteoclast formation. Furthermore, chrysin moderately improved bone health parameters in the rats. This study suggests that chrysin may have the potential to improve bone health.

Abbreviations
- cFos
Fos proto‐oncogene
- CRS
chrysin‐fed rats
- DW
control rats given distilled water
- ERK
extracellular signal‐regulated kinase
- JNK
c‐Jun N‐terminal kinase
- APK
mitogen‐activated protein kinases
- micro‐CT
micro‐computed tomography
- NFATc1
nuclear factor of activated T‐cells 1
- NFκB
nuclear factor κB
- PND
postnatal day
- RANK
receptor activator of NFκB
- RANKL
RANK ligand
- TRAP
tartrate‐resistant acid phosphatase
1. Introduction
The process of bone accrual to achieve peak bone mass is a crucial aspect of childhood development [1, 2]. In fact, the ability to achieve peak bone mass may be the single most crucial factor in preventing bone degenerative disorders later in life [2]. During childhood, bone accrual occurs through the coordinated action of two crucial bone cells: osteoclasts, which break down bone, and osteoblasts, which deposit bone. This process can be influenced by several factors, such as hormones, physical activity, and diet, which can impact bone accrual [1]. Therefore, targeting the activity of these bone cells can help protect the bone and improve the ability to achieve peak bone mass. (Supporting information)
Osteoclasts are specialized multinucleate cells that possess the unique ability to degrade or resorb bone tissue [3]. They originate from hemopoietic stem cells within the monocyte‐macrophage lineage [3]. The binding of receptor activator of NFκB (RANK) ligand (RANKL) to its receptor RANK will trigger the differentiation of osteoclast precursors into mature bone‐resorbing osteoclasts. RANK signaling involves the activation of the mitogen‐activated protein kinases (MAPK), extracellular signal‐regulated kinase (ERK), c‐Jun N‐terminal kinase (JNK), and p38, as well as the nuclear factor κB (NFκB) pathway [4]. NFκB translocates into the nucleus, where it will bind to DNA and lead to the activation of the Fos proto‐oncogene (cFos) and the master regulator of osteoclast formation and function, nuclear factor of activated T‐cells 1 (NFATc1) [4]. This will lead to the activation of genes such as tartrate‐resistant acid phosphatase (TRAP), which are crucial for osteoclast formation and function [3]. Several studies have shown that targeting osteoclast formation is a viable strategy to improve bone health and reduce fracture risk in murine and human models [5, 6]. However, due to the increased risk of side effects with current bone‐related therapies, novel therapies are being constantly sought.
Medicinal plants have been used for many generations to address several health problems, including bone metabolic disorders. The therapeutic efficacy of medicinal plants is attributed to the presence of bioactive phytochemicals. Chrysin is a bioactive flavone that naturally occurs in some medicinal plants such as honey, Passiflora edulis (passionflower), and Tilia tomentosa (silver linden) [7]. Several studies have demonstrated that chrysin possesses anti‐cancer, antioxidant, anti‐inflammatory, and anti‐spasmodic properties [7, 8, 9]. Prior investigations on the effect of chrysin on osteogenesis have revealed that chrysin induces osteogenic differentiation and improves bone health parameters in Wistar rats [10, 11]. Despite these insights, there remains a lack of detailed understanding regarding the possible mechanisms of action of chrysin in bone. The current study intends to address this lack of information by investigating the effects of chrysin through the utilization of in vitro and in vivo experimental approaches on bone metabolism. This research seeks to contribute valuable insights into potential therapeutic strategies for promoting bone health using natural approaches by elucidating the mechanisms underlying the impact of chrysin on bone health.
2. Materials and Methods
2.1. Materials
DMEM was supplied by GIBCO (Grand Island, USA). Cell culture plates were purchased from LASEC (Cape Town, South Africa). FBS was bought from Capricorn Scientific (Ebsdorfergrund, Germany). RANKL was sourced from Research and Diagnostic Systems (Minneapolis, USA; St. Louis, USA). Resazurin was bought from Life Technologies (Carlsbad, USA). Antibodies against GAPDH, ERK, pERK, and NFκB, pNFκB were supplied by Abcam (Cambridge, UK). Western Substrate ECL was sourced from Bio‐RAD (Hercules, USA). Trypan blue, chrysin, and other chemicals were acquired from Sigma‐Aldrich Inc. (St. Louis, USA).
2.2. Cell Culture
This study was approved by the Faculty of Health Sciences Ethics Committee and Animal Ethics Committee of the University of Pretoria (ethical clearance number: 536/2022). RAW 264.7 cells were purchased from the American Tissue Culture Collection (Manassas, USA). Cells were cultured in DMEM containing 10% FBS in a 37°C incubator that was humidified at 5% CO2. When the cells reached 80% confluency, they were passaged by scraping and then counted using the Trypan Blue dye (0.5%) exclusion method and a hemocytometer. The passage range used was between 8 and 18. Cells were then seeded for the respective experiment in DMEM containing 10% FBS and exposed to chrysin (0.5–100 µM). DMSO concentrations did not exceed 0.1% during the experiments and served as the vehicle control. Mycoplasma testing was performed every 2 weeks.
2.3. Resazurin Assay
RAW 264.7 cells were seeded at a density of 16 000 cells cm−2 in a sterile 96‐well plate and allowed to attach overnight. After attachment, the cells were exposed to chrysin (0.5, 1, 5, 10, 50, 100 µM) or the vehicle control (0.1% DMSO) for 48 h. At the end of the incubation, 10% of 0.8 µM resazurin solution was added to all the wells. Triton‐X (0.2%) was added to the positive control well. The plate was incubated for 1–4 h until a color change from blue to purple was observed. Wavelengths of 570 and 600 nm were used to measure absorbance values using a Micro‐Plate Spectrophotometer (BioTek Instruments Inc., USA).
2.4. TRAP Staining
Cells were seeded into a 96‐well plate at a density of 16 000 cells cm−2 and exposed to chrysin (0.5, 1, 5, 10, 50, 100 µM) in the presence of RANKL (15 ng mL−1) [12, 13]. RAW 264.7 cells do not require the addition of macrophage colony‐stimulating factor in order to differentiate into multinucleated osteoclasts [14]. The negative control was not exposed to RANKL. On the third day, the media was aspirated, and the cells were re‐exposed to chrysin and RANKL at the same concentrations in complete DMEM. On the fifth day, the cells were fixed in 10% formalin, and the cells were stained using a naphthol/dimethylformamide solution and sodium nitrite solution, as previously mentioned [15]. Only osteoclasts with three nuclei or more were counted manually using an Olympus BH2 microscope equipped with an SC30 camera (Olympus, Tokyo, Japan), and the IC50 of chrysin was determined.
2.5. Quantitative Polymerase Chain Reaction
RAW 264.7 cells were seeded at 12 000 cells cm−2 in a 48‐well plate and exposed to chrysin at 14 µM in the presence of RANKL (15 ng mL−1) for 48 h. The negative control was not exposed to RANKL. Thereafter, mRNA was extracted using an ISOLATE II RNA Mini Kit (Bioline Meridian Bioscience, UK) according to the manufacturer's instructions. cDNA was then reverse transcribed from RNA by incubating the RNA with M‐MuLV reverse transcriptase for an hour at 42°C. The enzyme was inactivated at 90°C for 10 min.
The Luna Universal qPCR Master Mix was used for the qPCR according to the instructions given by the manufacturer. The samples were then centrifuged and placed in a LightCycler Nano (Roche, Switzerland) and run on 3‐step cycling. The qPCR was performed for 40 cycles, with denaturation for 5 s at 95°C, annealing for 10 s at 60°C–65°C, and extension for 5 min at 72°C. The analysis was performed using the 2−ΔΔCT method. The primers for markers GAPDH (GenBank Accession Number: NM_001289726.2) [16]: forward CCAGCTTAGGTTCATCAGGT and reverse TTGATGGCAACAATCTCCAC; cFos (GenBank Accession Number: NM_010234.3) [17]: forward CCCATCGCAGACCAGAGC and reverse ATCTTGCAGGCAGGTCGGT; and NFATc1 (GenBank Accession Number: NM_001164109.1) [18]: forward GTGGAGAAGCAGAGCAC and reverse ACGCTGGTACTGGCTTC were synthesized by Inqaba Biotec (Pretoria, South Africa).
2.6. Western Blots
RAW 264.7 were seeded at a density of 100 000 cells cm−2 and allowed to attach overnight. Thereafter, the cells were exposed to chrysin (14 µM) for 4 h before treatment with RANKL (15 ng mL−1) for 1, 2, or 5 min. The negative control was not treated with chrysin or RANKL. After treatment, the cells were then lysed using ice‐cold RIPA buffer, containing phosphatase inhibitors, protease inhibitors, and phenylmethylsulphonyl (PMSF). Equal amounts of protein were loaded onto 4%–20% polyacrylamide gel and transferred to a nitrocellulose membrane using a Tris‐glycine buffer containing 139 mM glycine, 25 mM Tris, and 20% methanol. The membranes were blocked for 1 h using a Tris‐buffered saline solution containing 5% bovine serum albumin before incubation with primary antibody (1:1000) overnight at 4°C. Thereafter, they were incubated with a secondary antibody (1:20 000) for 1 h at room temperature. The blots were developed using a Clarity Western ECL Substrate before being visualized on a Chemidoc MP (BioRad, Hercules, USA) (Supplementary Figure S3). ImageJ software was used to analyze the images [19].
2.7. Immunofluorescence
RAW 264.7 were seeded at a density of 16 000 cells cm−2 in a 12‐well plate and allowed to attach overnight. Subsequently, the cells were treated with chrysin (14 µM) and incubated for 4 h. Following chrysin exposure, the cells were then treated with RANKL (15 ng mL−1) for 1 h. After fixation with 4% paraformaldehyde, the cells were permeated with 0.1% Triton X‐100 and blocked with 1% BSA for 1 h. The cells were then incubated overnight at 4°C with a primary antibody targeting NFκB (1 µg mL−1). Following PBS washing, the cells were incubated with conjugated goat anti‐rabbit IgG (AlexaFluor‐568 anti‐rabbit) (excitation: 493 nm; emission: 517 nm) secondary antibody (15 µg mL−1) for 1 h. Nuclei were stained with 4′,6‐diamidino‐2‐phenylindole (DAPI) (excitation: 359 nm; emission: 457 nm), and images were captured using a Zeiss Laser Scanning Microscope 800 (Zeiss, Oberkochen, Germany). The quantification involved counting the number of cells exhibiting translocation of NFκB from the cytoplasm to the nucleus in 15 images per treatment group.
2.8. Dosage Regimen
The animal experiments were conducted as part of a larger study on the effects of orally administered chrysin on metabolic dysfunction (ethical clearance number: 2019/07/042B) [17]. Briefly, the study made use of twelve 4‐day‐old male Sprague–Dawley rats. The rats were randomly assigned to either the control group (n = 6) or the chrysin‐fed group (n = 6). The suckling neonatal rats were housed and treated as previously described [20]. Treatment began on postnatal day (PND) 7. The control group (DW) was given distilled water. The chrysin‐fed group (CRS) was given 50 mg/kg/day of chrysin (HED = 8.11 mg/kg) via oral gavage. On PND 21, the rats were weaned and given standard chow and unlimited access to drinking water. There were no interventions between PND 22 and 56. During the adult intervention, PND 56–130, half of the rats in each group were treated with a 20% w/v fructose solution in drinking water as a secondary dietary insult, while the other half continued on a standard diet. Only the rats that continued on the standard diet were included in this study. The rats were euthanized on PND 130 using an overdose (200 mg/kg body weight) of sodium pentobarbital (Euthanaze, Bayer, Johannesburg, South Africa). The tibiae from the right hind limb were dissected out, defleshed, defatted in acetone, and then dried using the oven (Salvis, Salvis Lab, Schweiz, Switzerland) at a temperature of 40°C for 5 days and stored in a desiccator for imaging. The tibia was selected for µCT analysis based on its accessibility, consistent anatomical landmarks, and its well‐established use in preclinical models of metabolic bone disease.
2.9. Micro‐Computed Tomography (Micro‐CT) and Bone Morphometry
The dried tibial bones collected at termination were used for micro‐CT scans. The bones were scanned in their respective groups: DW and CRS. Each group contained six tibia bones. Low‐density Styrofoam was used to mount the bones. The bone samples were scanned using a micro‐focus x‐ray (Nikon XTH 225 ST, Leuven, Belgium). The mounted bone samples were then placed within the scanning chamber on a 360° rotating platform. The resolution was set at 20 µm, and scans took approximately 30 min for each group. The voxel size was 0.02899. Reconstruction of the projected images was required to transform 2D images into 3D projections. The projected images were reconstructed using CT‐Pro reconstruction software from Nikon (Nikon, Leuven, Belgium). The 3D projection data was then imported to visualization software (VGStudioMax, Hexagon, Sweden) for analysis. VGStudioMax visualization software was used to determine all parameters excluding weight. Whole bone parameters and the midpoint of the bone parameters were determined using the visualization software (VGStudioMax, Hexagon, Sweden). The weight of the bones was measured using an A&D BA‐6TE scale (A&D Company, Tokyo, Japan).
2.10. Data Analysis
All data was reported as mean ± SEM. The data was analyzed using GraphPad Prism 9 software (GraphPad Software Inc., California, USA). A one‐way ANOVA was employed to compare differences between means, followed by the Bonferroni post hoc test for multiple comparisons. An unpaired Student's t‐test was performed to compare differences between the control and chrysin‐treated rats in the animal study. Descriptive statistics (means and standard deviations) were performed on all assays. Three biological repeats were performed in triplicate for each experiment. Statistical significance was defined as p < 0.05.
3. Results
3.1. Chrysin Significantly Inhibited the Differentiation of RAW Cells Into Osteoclasts
Chrysin (5–100 µM) was shown to have no effect on the cell viability of the RAW 264.7 murine macrophages (Figure 1A and Supplementary Figure S1). The TRAP staining showed that chrysin significantly reduced osteoclast formation at concentrations above 5 µM when compared to the RANKL positive control (Figure 1B). TRAP‐positive cells with three nuclei or more were counted as mature osteoclasts (Figure 1C). The IC50 of chrysin was determined to be 14 µM, and this concentration was used for downstream experiments.
FIGURE 1.

(A) The effect of chrysin on cell viability was determined by a resazurin assay. Triton X‐100 was used as the positive control. (B) RAW 264.7 murine macrophages were treated with chrysin (0.5–100 µM) and RANKL (15 ng/mL) for 5 days. Thereafter, TRAP‐positive cells with three or more nuclei were counted as mature osteoclasts. An IC50 of 14 µM was determined and used for downstream experiments. (C) Photomicrographs of TRAP‐positive cells were taken. TRAP stains the cells pink. Hematoxylin was used to counterstain the nuclei purple. Three biological repeats were performed. Data are represented as the mean ± SEM. ANOVA with Bonferroni's post hoc test was performed. Scale bar: 500 µm. −ve, vehicle control; R+, RANKL positive control. **p < 0.01, ***p < 0.001, ****p < 0.0001 versus R+.
3.2. Chrysin Significantly Inhibited the Expression of NFATc1 and TRAP
The effect of chrysin on the expression of key osteoclast genes was next determined (Supplementary Figure S2). Chrysin was shown to have no effect on the expression of cFos when compared to the RANKL positive control (Figure 2A). However, chrysin significantly decreased the expression of NFATc1 (Figure 2B) and TRAP (Figure 2C).
FIGURE 2.

(A)–(C) The effect of chrysin on the expression of key osteoclast genes, cFos, NFATc1, and TRAP, was determined. (D) Western blotting was used to determine the effect of chrysin on the activation of ERK and NFκB after exposure to RANKL (15 ng/mL) for 1, 2, and 5 min. The blots were visualized using a ChemiDoc MP. (E)–(F) The band intensities were then quantified using ImageJ software. All bands were normalized to the loading control GAPDH. (G) Immunofluorescence was used to determine the nuclear translocation of NFκB. The nuclei were stained blue, while the NFκB was stained red. Scale bar: 10 µm. (H) The number of cells with NFκB nuclear translocation was then quantified in 15 images per treatment group. Three biological repeats were performed. Data are represented as the mean ± SEM. ANOVA with Bonferroni's post hoc test was performed. −ve, vehicle control; R+, RANKL positive control; R + C, RANKL and Chrysin. *p < 0.05, ** p < 0.01, ***p < 0.001, ****p < 0.0001 versus R+.
3.3. Chrysin Did Not Affect MAPK Signaling but Significantly Decreased NFκB Nuclear Translocation
Western blotting and immunofluorescence experiments were conducted to analyze the molecular mechanisms of chrysin in osteoclasts. RANKL significantly increased the expression of phosphorylated ERK after 1 min when compared to the vehicle control (Figure 2D,E). Chrysin did not show any significant effect on the phosphorylation of ERK after 1, 2, and 5 min. Similarly, chrysin did not significantly affect the expression of pNFκB at all the time points measured (Figure 2F).
The immunofluorescence experiments showed that in the absence of RANKL, NFκB did not translocate to the nucleus (Figure 2G). RANKL was shown to increase the presence of NFκB in the nuclei of the cells when compared to the vehicle control. However, when the cells were exposed to chrysin, a significant decrease in NFκB nuclear translocation was observed (Figure 2H).
3.4. Chrysin Improves Midpoint Bone Health Parameters in Sprague–Dawley Rats
Lastly, the effect of chrysin on bone health parameters was determined in Sprague–Dawley rats (Figure 3A). There was a significant increase in body mass in both the control and chrysin‐fed rats from the induction of the experiment until the termination (Figure 3A). However, there was no significant difference in body weight between the control and chrysin‐fed rats at induction and termination of the experiment (Figure 3B). Whole bone images of the tibia were taken for analysis (Figure 3C and Supplementary Figure S4). No visible differences in the bone structure could be seen between the control and chrysin‐fed rats. After the bones were analyzed by micro‐CT, there was no significant difference seen in the whole bone parameters of the control and chrysin‐fed rats (Table 1).
FIGURE 3.

(A) Sprague–Dawley rats were fed a standard diet with the absence or addition of 50 mg/kg/day of chrysin. The rats were given chrysin during the neonatal and adult periods. All rats were euthanized on PND 130. (B) The rats were weighed at the induction of the study (PND 4) and at termination (PND 130). Thereafter, the rats were euthanized, and the right tibiae were extracted. (C) Whole bone images of the right tibia were taken using micro‐CT. Scale bar: 10 mm. (D) Furthermore, midpoint images were taken. Scale bar: 1 mm. All images were then reconstructed and analyzed using the appropriate software. The sample size was n = 6. Data are represented as the mean ± SEM. An unpaired t‐test was performed. CRS, chrysin‐treated; DW, distilled water (control); PND, postnatal day. ****p < 0.0001.
TABLE 1.
Whole bone and midpoint parameters were analyzed using VGStudioMax.
| Whole bone parameter | Unit | DW | CRS | p value |
|---|---|---|---|---|
| Mass to length ratio | mgmm | 14.54 ± 0.3049 | 14.98 ± 0.5139 | 0.4723 |
| Area | mm2 | 2033 ± 66.43 | 2179 ± 66.40 | 0.1522 |
| Volume | mm3 | 337.3 ± 10.46 | 329.9 ± 11.11 | 0.6381 |
| Bone volume fraction (BV/TV) | mm | 0.04276 ± 0.0028 | 0.04090 ± 0.0043 | 0.7214 |
| Trabecular thickness | mm | 0.3350 ± 0.0159 | 0.3017 ± 0.0108 | 0.1128 |
| Trabecular number | mm−1 | 0.1346 ± 0.0079 | 0.1360 ± 0.0159 | 0.9436 |
| Trabecular spacing | mm | 7.610 ± 0.5334 | 7.588 ± 0.9380 | 0.9844 |
| Cortical thickness | mm | 0.5320 ± 0.0256 | 0.5033 ± 0.0349 | 0.5396 |
| Midpoint parameter | DW | CRS | p value | |
|---|---|---|---|---|
| Area | mm2 | 10.51 ± 0.2873 | 11.65 ± 0.3002 | 0.0207 a |
| Volume | mm3 | 0.1586 ± 0.0067 | 0.1794 ± 0.0053 | 0.0351 a |
| Bone surface density (BS/BV) | mm−1 | 0.4284 ± 0.1306 | 1.139 ± 0.2134 | 0.0380 a |
Note: Data are displayed as the mean ± SEM.
Abbreviations: CRS, chrysin‐treated; BS, bone surface area; BV, bone volume; DW, distilled water (control); TV, total volume.
p < 0.05 versus DW.
Thereafter, midpoint images of the tibiae were taken for analysis (Figure 3D and Supplementary Figure S5). The midpoint parameters did show some significant improvements in the chrysin‐fed rats. Chrysin‐fed rats had a significantly greater midpoint area, volume, and bone surface density when compared to the control rats (Table 1).
4. Discussion
Previous studies have demonstrated that chrysin may have bone‐protective effects [10, 21]. However, further studies are needed to elucidate the mechanisms of action of chrysin in bone. In this present study, we demonstrated that chrysin inhibited osteoclast formation in RANKL‐induced RAW 264.7 murine macrophages. The binding of RANK‐RANKL initiates the signaling pathways of MAPKs and NFκB, resulting in the stimulation of key genes vital for osteoclastogenesis, such as TRAP and NFATc1 [22]. NFATc1 is the most crucial transcription factor in osteoclast formation [22, 23]. Therefore, further investigation into the effects of chrysin on MAPK and NFκB signaling pathways was required, given their role in NFATc1 activation and osteoclast differentiation.
ERK is a crucial MAPK that is associated with the differentiation, proliferation, and survival of osteoclasts [24]. Flavonoids have been shown to have a significant effect on the MAPK signaling pathway in osteoclasts, leading to a decrease in osteoclast formation and function [25, 26, 27]. Hong et al. indicated that robinin, a flavone glycoside, inhibited osteoclast formation through inhibition of the phosphorylation of ERK, JNK, and p38 in bone marrow macrophages (BMM) [25]. Similarly, Li et al. showed that galangin, a dihydroxyflavone, inhibited osteoclast formation and the phosphorylation of ERK [26]. Chrysin is a trihydroxyflavone that differs from galangin by the additional hydroxyl group on position 3 [8, 28]. These similarities in structure between chrysin and galangin may explain why chrysin was shown to have similar anti‐osteoclast effects as galangin. In this present study, it was observed that cells treated with chrysin did not affect the phosphorylation of ERK at 1, 2, and 5 min when compared to the RANKL positive control. In contrast, Wu et al. demonstrated that chrysin at 20 µM inhibited ERK phosphorylation at 5, 10, 20, and 30 min when compared to the RANKL positive control [21]. The higher concentration and longer exposure time used by Wu et al. may explain the difference in their findings. Nevertheless, the effect of chrysin on NFκB signaling was determined next.
The NFκB signaling pathway is a major pathway in the differentiation of osteoclasts [29]. As previously mentioned, when RANKL binds to RANK, it triggers an intracellular cascade that leads to the nuclear translocation of NFκB and activation of NFATc1 [29]. Novack et al. showed that the global loss of NFκB results in severe osteoporosis in mice [30]. Similar to their effects on the MAPK signaling pathway, flavonoids have been shown to inhibit NFκB phosphorylation and translocation [26, 31]. In this present study, chrysin did not significantly affect the phosphorylation of NFκB. However, chrysin significantly reduced the translocation of NFκB from the cytoplasm to the nucleus. Despite no significant changes observed in the expression of the phosphorylated NFκB protein, the significant decrease in its nuclear translocation highlights a potential inhibitory mechanism of chrysin on osteoclast formation. The discrepancy between the significant decrease of NFκB nuclear translocation observed in the immunofluorescence compared to the western blots, which observed no change, may be due to the sensitivity and specificity of the detection techniques that were used, as well as the difference in time points. While immunofluorescence was used to measure the localization of NFκB at single‐cell resolution, Western blot measured the expression of pNFκB in whole‐cell lysates across multiple cells. Therefore, subtle changes in NFκB signaling may have been missed by the Western blot. Furthermore, phosphorylation is transient, and therefore, the peak phosphorylation may have been missed by the Western blot, whereas NFκB may accumulate in the nucleus and allow for sustained detection by immunofluorescence. It is important to note that NFκB may translocate to the nucleus using alternative mechanisms, independent of NFκB phosphorylation [32]. However, alternative mechanisms of NFκB nuclear translocation were not investigated in the present study. Nevertheless, similar to the results of this present study, Byun et al. showed that a chrysin derivative (CM1) inhibits the translocation of NFκB in RAW 264.7 cells [33]. However, Wu et al., using higher concentrations of chrysin (20 µM), showed that chrysin inhibited NFκB phosphorylation at 5 and 10 min [21]. Chrysin has been shown to have an effect on the NFκB signaling pathway in vitro in this study and others, as well as in vivo [21, 26, 31, 34]. Faheem et al. showed that chrysin [50–100 mg/kg] reduces NFκB mRNA expression in Wistar rats [34]. These results show that the anti‐inflammatory effects of chrysin may be translated into an in vivo model. Therefore, the effect of chrysin on bone health parameters was next investigated in the tibia bones of Sprague–Dawley rats.
The present study used bone samples from a study performed by Ajah et al., who investigated the effects of neonatal administration of chrysin on health profile markers in nonalcoholic fatty liver disease and kidney function in Sprague–Dawley rats [20]. Through this approach, this present study sought to elucidate the impact of neonatal administration of chrysin on bone metabolism. Several bone health parameters were evaluated, including whole bone parameters such as mass‐to‐length ratio, area, volume, bone volume fraction, cortical thickness, and trabecular thickness, spacing, and number. Additionally, parameters specific to the midpoint of the bone, including area, volume, and segmented surface density, were assessed. The results analysis showed that chrysin had no significant impact on the whole bone parameters of Sprague–Dawley rats. However, our findings showed that chrysin significantly increased the area, volume, and bone surface density at the midpoint of the tibia bones in Sprague–Dawley rats. These findings indicate that chrysin may enhance the midpoint strength of the tibia.
Ibrahim et al. investigated the effects of chrysin (50 and 100 mg/kg) on femur bones in ovariectomized (OVX) Wistar rats [35]. Induction of menopause, achieved through OVX, significantly affects estrogen levels, leading to disrupted bone metabolism and bone disease [36, 37]. Chrysin was shown to have no effect on the length of the femur bone but did significantly increase the dry weight of the femur at both chrysin concentrations compared to the untreated OVX group [35]. Similarly, Orsolic et al. investigated the effect of chrysin (100 mg/kg) on a drug‐induced bone loss study in Y59 female rats [38]. Their findings revealed that chrysin significantly increased the relative femur weight when compared to the drug‐induced treatment group [38]. There was no change in the femur bone mineral density when treated with chrysin and compared to the drug‐induced treatment group [38]. This present study used a chrysin concentration of 50 mg/kg. The absence of bone metabolic disorder, unlike studies by Ibrahim et al. and Orsolic et al., may account for the lack of significant changes observed in bone parameters in this study. Nevertheless, this study still reported improvements in midpoint tibia parameters in chrysin‐fed rats compared to control rats. Interestingly, although chrysin was only administered during the neonatal period, the improvements in midpoint bone parameters were observed in the adult rats. These results suggest that chrysin may potentially improve bone accrual in these developing rats. As bone accrual in early life is crucial in preventing bone degenerative disorders in adulthood [2], this could suggest that chrysin has bone protective potential. Although the micro‐CT analysis provided information on the trabecular and cortical morphology of the bone, further histological and molecular analysis should be performed in the future to analyze the cellular and molecular changes in the bone. These future studies could help confirm and contextualize the structural findings that were observed using the micro‐CT. It is important to note that chrysin has low oral bioavailability, which may limit its systemic efficacy in humans. While this was not assessed in the current study, future research should also explore formulation strategies or delivery systems such as nanoparticle carriers or bioavailability enhancers to improve chrysin's pharmacokinetic properties and therapeutic potential.
In conclusion, this study improves our understanding of the effects of chrysin on osteoclastogenesis and bone metabolism. The in vitro results indicate that chrysin may inhibit osteoclast formation via the NFκB pathway. The increase in midpoint bone health parameters in the in vivo model demonstrates for the first time that postnatal administration of chrysin can lead to improvements in bone health in Sprague–Dawley rats. These findings suggest that chrysin has the potential to enhance bone accrual in developing rats and highlight the importance of early nutritional intervention in promoting long‐term skeletal health. However, the lack of human studies on chrysin in bone health underscores the complexity of translating these effects into a clinical setting, necessitating further investigation into the conditions under which chrysin may be most effective in improving bone accrual.
Funding
The study was funded by the National Research Foundation of South Africa (Grant number: 121828).
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Supporting File: mnfr70403‐sup‐0001‐SuppMat.docx.
Acknowledgments
We acknowledge Dr. Lunga Bam and the South African Nuclear Energy Corporation (NECSA) for the assistance with the use of the micro‐CT and analysis of the data. We further acknowledge Dr. Austin Ajah and the University of the Witwatersrand for their assistance with the animal studies.
Mason C., Nyakudya T. T., and Kasonga A. E., “Chrysin Exhibits Bone‐Protective Effects Through Osteoclastogenesis Inhibition: In Vitro and In Vivo Evaluation in RAW 264.7 Murine Macrophages and Sprague–Dawley Rats.” Molecular Nutrition & Food Research 70, no. 3 (2026): e70403. 10.1002/mnfr.70403
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Kralick A. E. and Zemel B. S., “Evolutionary Perspectives on the Developing Skeleton and Implications for Lifelong Health,” Frontiers in Endocrinology (Lausanne) 11 (2020): 99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Hernandez C. J., Beaupre G. S., and Carter D. R., “A Theoretical Analysis of the Relative Influences of Peak BMD, Age‐Related Bone Loss and Menopause on the Development of Osteoporosis,” Osteoporosis International 14 (2003): 843–847. [DOI] [PubMed] [Google Scholar]
- 3. Veis D. J. and O'Brien C. A., “Osteoclasts, Master Sculptors of Bone,” Annual Review of Pathology: Mechanisms of Disease 18 (2023): 257–281. [DOI] [PubMed] [Google Scholar]
- 4. Bar‐Shavit Z., “The Osteoclast: A Multinucleated, Hematopoietic‐Origin, Bone‐Resorbing Osteoimmune Cell,” Journal of Cellular Biochemistry 102 (2007): 1130–1139. [DOI] [PubMed] [Google Scholar]
- 5. Kostenuik P. J., Nguyen H. Q., McCabe J., et al., “Denosumab, a Fully Human Monoclonal Antibody to RANKL, Inhibits Bone Resorption and Increases BMD in Knock‐in Mice That Express Chimeric (Murine/Human) RANKL,” Journal of Bone and Mineral Research 24 (2009): 182–195. [DOI] [PubMed] [Google Scholar]
- 6. Bilezikian J. P., “Efficacy of Bisphosphonates in Reducing Fracture Risk in Postmenopausal Osteoporosis,” American Journal of Medicine 122 (2009): S14–S21. [DOI] [PubMed] [Google Scholar]
- 7. Naz S., Imran M., Rauf A., et al., “Chrysin: Pharmacological and Therapeutic Properties,” Life Sciences 235 (2019): 116797. [DOI] [PubMed] [Google Scholar]
- 8. Mani R. and Natesan V., “Chrysin: Sources, Beneficial Pharmacological Activities, and Molecular Mechanism of Action,” Phytochemistry 145 (2018): 187–196. [DOI] [PubMed] [Google Scholar]
- 9. Shukla R., Pandey V., Vadnere G. P., and Lodhi S., Bioactive Food as Dietary Interventions for Arthritis and Related Inflammatory Diseases (Elsevier, 2019), 293–322. [Google Scholar]
- 10. Zeng W., Yan Y., Zhang F., Zhang C., and Liang W., “Chrysin Promotes Osteogenic Differentiation via ERK/MAPK Activation,” Protein & Cell 4 (2013): 539–547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Kasarla S. S., Dodoala S., Sampathi S., et al., “Therapeutic Potential of Chrysin in Improving Bone Health,” Applied Sciences 12 (2022): 8728. [Google Scholar]
- 12. Kasonga A., Kruger M. C., and Coetzee M., “Activation of PPARs Modulates Signalling Pathways and Expression of Regulatory Genes in Osteoclasts Derived From Human CD14+ Monocytes,” International Journal of Molecular Sciences 20 (2019): 1798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Kaneko H., Mehrotra M., Alander C., et al., “Effects of Prostaglandin E2 and Lipopolysaccharide on Osteoclastogenesis in RAW 264.7 Cells,” Prostaglandins Leukotrienes and Essential Fatty Acids 77 (2007): 181–186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Collin‐Osdoby P. and Osdoby P., “RANKL‐Mediated Osteoclast Formation From Murine RAW 264.7 Cells,” Methods in Molecular Biology 816 (2012): 187–202. [DOI] [PubMed] [Google Scholar]
- 15. Sithole C., Pieterse C., Howard K., and Kasonga A., “GPR120 Inhibits RANKL‐Induced Osteoclast Formation and Resorption by Attenuating Reactive Oxygen Species Production in RAW264.7 Murine Macrophages,” International Journal of Molecular Sciences 22 (2021): 10544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Luo L., Feng P., Yang Q., et al., “Transcription Factor TOX Maintains the Expression of Mst1 in Controlling the Early Mouse NK Cell Development,” Theranostics 13 (2023): 2072–2087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. van Heerden B., Kasonga A., Kruger M. C., and Coetzee M., “Palmitoleic Acid Inhibits RANKL‐Induced Osteoclastogenesis and Bone Resorption by Suppressing NF‐kappaB and MAPK Signalling Pathways,” Nutrients 9 (2017): 441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Siriarchavatana P., Kruger M. C., Miller M. R., Tian H., and Wolber F. M., “Non‐Polar Lipid From Greenshell Mussel (Perna canaliculus) Inhibits Osteoclast Differentiation,” Bone Reports 15 (2021): 101132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Schneider C. A., Rasband W. S., and Eliceiri K. W., “NIH Image to ImageJ: 25 Years of Image Analysis,” Nature Methods 9 (2012): 671–675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Ajah A. A., Lembede B. W., Nkomozepi P., Erlwanger K. H., and Nyakudya T. T., “Neonatal Oral Administration of Chrysin Prevents Long‐Term Development of Non‐Alcoholic Fatty Liver Disease in a Sexually Dimorphic Manner in Fructose Nurtured Sprague–Dawley Rats,” Life (Basel) 12 (2022): 790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Wu Z., Li C., Chen Y., et al., “Chrysin Protects Against Titanium Particle‐Induced Osteolysis by Attenuating Osteoclast Formation and Function by Inhibiting NF‐kappaB and MAPK Signaling,” Frontiers in Pharmacology 13 (2022): 793087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Park J. H., Lee N. K., and Lee S. Y., “Current Understanding of RANK Signaling in Osteoclast Differentiation and Maturation,” Molecules and Cells 40 (2017): 706–713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Jeong J. W., Choi S. H., Han M. H., et al., “Protective Effects of Fermented Oyster Extract Against RANKL‐Induced Osteoclastogenesis Through Scavenging ROS Generation in RAW 264.7 Cells,” International Journal of Molecular Sciences 20 (2019): 1439. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 24. Lee K., Seo I., Choi M. H., and Jeong D., “Roles of Mitogen‐Activated Protein Kinases in Osteoclast Biology,” International Journal of Molecular Sciences 19 (2018) 3004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Hong G., Chen Z., Han X., et al., “A Novel RANKL‐Targeted Flavonoid Glycoside Prevents Osteoporosis Through Inhibiting NFATc1 and Reactive Oxygen Species,” Clinical and Translational Medicine 11 (2021): 392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Li X., Jiang J., Yang Z., et al., “Galangin Suppresses RANKL‐Induced Osteoclastogenesis via Inhibiting MAPK and NF‐kappaB Signalling Pathways,” Journal of Cellular and Molecular Medicine 25 (2021): 4988–5000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Liu Y., Wang C., Wang G., et al., “Loureirin B Suppresses RANKL‐Induced Osteoclastogenesis and Ovariectomized Osteoporosis via Attenuating NFATc1 and ROS Activities,” Theranostics 9 (2019): 4648–4662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Liu R., Li H., Wei N., and Tan Y., “Simultaneous Determination of Two Galangin Metabolites From Alpinia Officinarum Hance in Rat Plasma by UF LC‐MS/MS and Its Application in Pharmacokinetics Study,” PeerJ 9 (2021): 11041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Kenkre J. S. and Bassett J., “The Bone Remodelling Cycle,” Annals of Clinical Biochemistry 55 (2018): 308–327. [DOI] [PubMed] [Google Scholar]
- 30. Novack D. V., “Role of NF‐kappaB in the Skeleton,” Cell Research 21 (2011): 169–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Li J., Zeng L., Xie J., et al., “Inhibition of Osteoclastogenesis and Bone Resorption In Vitro and In Vivo by a Prenylflavonoid Xanthohumol From Hops,” Scientific Reports 5 (2015): 17605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Fagerlund R., Kinnunen L., Kohler M., Julkunen I., and Melen K., “NF‐kappaB Is Transported Into the Nucleus by Importin Alpha3 and Importin Alpha4,” Journal of Biological Chemistry 280 (2005): 15942–15951.. [DOI] [PubMed] [Google Scholar]
- 33. Byun E. B., Song H. Y., Kim W. S., et al., “Chrysin Derivative CM1 and Exhibited Anti‐Inflammatory Action by Upregulating Toll‐Interacting Protein Expression in Lipopolysaccharide‐Stimulated RAW264.7 Macrophage Cells,” Molecules (Basel, Switzerland) 26 (2021): 1532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Faheem M. A., Akhtar T., Naseem N., et al., “Chrysin Is Immunomodulatory and Anti‐Inflammatory Against Complete Freund's Adjuvant‐Induced Arthritis in a Pre‐Clinical Rodent Model,” Pharmaceutics 15 (2023): 1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Ibrahim S. O., Mada S. B., Abarshi M. M., Tanko M. S., and Babangida S., “Chrysin Alleviates Alteration of Bone‐Remodeling Markers in Ovariectomized Rats and Exhibits Estrogen‐Like Activity In Silico,” Human & Experimental Toxicology 40 (2021): S125–S136. [DOI] [PubMed] [Google Scholar]
- 36. Guan Z., Xuanqi Z., Zhu J., et al., “Estrogen Deficiency Induces Bone Loss Through the Gut Microbiota,” Pharmacological Research 196 (2023): 106930. [DOI] [PubMed] [Google Scholar]
- 37. Emmanuelle N. E., Marie‐Cecile V., Florence T., et al., “Critical Role of Estrogens on Bone Homeostasis in Both Male and Female: From Physiology to Medical Implications,” International Journal of Molecular Sciences 22 (2021): 1568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Orsolic N., Nemrava J., Jelec Z., et al., “Antioxidative and Anti‐Inflammatory Activities of Chrysin and Naringenin in a Drug‐Induced Bone Loss Model in Rats,” International Journal of Molecular Sciences 23 (2022): 2872. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supporting File: mnfr70403‐sup‐0001‐SuppMat.docx.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
