Skip to main content
Biology logoLink to Biology
. 2026 Feb 3;15(3):276. doi: 10.3390/biology15030276

Cloning and Characterization of GDSL Esterases from Bacillus paralicheniformis T7

Arman Mussakhmetov 1,2,3, Magzhan Astrakhanov 1, Dmitriy Silayev 1, Bekbolat Khassenov 1,2,*
PMCID: PMC12896513  PMID: 41677747

Simple Summary

Various contemporary biotechnological and industrial procedures rely on enzymes that effectively degrade lipids and associated substances. However, enzymes that maintain activity across diverse conditions remain scarce. Microorganisms are a key source of these enzymes; however, numerous bacterial enzymes remain insufficiently studied. In this study, we focused on the identification and characterization of novel enzymes derived from bacteria isolated from natural environments. We specifically examined a soil bacterium, Bacillus paralicheniformis T7, which synthesizes enzymes known as esterases. Two esterases produced by this bacterium were identified, isolated, and comprehensively examined. The study findings indicated that B. paralicheniformis T7 represents a promising biological source of enzymes for sustainable technologies that depend on environmentally benign degradation of fat-based materials.

Keywords: esterases, Bacillus, enzyme, cloning, strain, recombinant

Abstract

Esterases catalyze the hydrolysis and transesterification of short-chain fatty acid esters, and microbial esterases are used in the production of biofuels, cosmetics, food, and pharmaceuticals. The soil strain Bacillus paralicheniformis T7 secretes enzymes with esterase activity; however, many bacterial enzymes remain insufficiently studied. Therefore, this study aimed to identify and characterize novel GDSL esterases produced by B. paralicheniformis. Protein mass spectrometry, combined with proteomics and genomics, identified genes encoding two GDSL esterases, which were cloned into the pET-28c(+) vector. The resulting proteins were obtained in Escherichia coli BL21(DE3) as the recombinant esterases rEST-24 and rEST-28. These recombinant GDSL esterases showed maximum activity at 40 °C and pH 7.0. Moreover, Ca2+, Zn2+, Cu2+, and Fe2+ ions inhibited their activity, and rEST-28 was resistant to the detergents Tween-20, Tween-80, and Triton X-100. High-yield esterase activity was detected in bacteria cultured on feather medium and nutrient broth, and submerged fermentation of the B. paralicheniformis T7 strain on feather medium enabled the production of an esterase extract exhibiting activity of 17,618 ± 610 U/g. These results suggest that the B. paralicheniformis T7 strain can produce esterases and shows promising potential for application in technologies that degrade fatty acid esters using hydrolytic enzymes.

1. Introduction

Esterases are ubiquitous enzymes found in all living organisms, including animals, plants, and microorganisms [1]. These enzymes participate in various biological processes, including cell signalling, remodelling, phosphorus metabolism, detoxification of natural and synthetic substances, and the synthesis and breakdown of biomolecules and polymers, such as nucleic acids, lipids, and esters [2]. This class of hydrolase enzymes, particularly EC 3.1.1.1, catalyse the hydrolysis and transesterification of fatty acid esters [3].

In terms of structural organisation, these enzymes are serine hydrolase group members and have a characteristic α/β-hydrolase fold [4]. Their catalytic mechanism is based on an amino acid triad comprising serine, histidine, and aspartate or glutamate, which is located in the active centre [3]. For example, the amino acid residues Ser77, His76, and Gly103 of Bacillus subtilis E9 esterase interact with the ligand, thus providing the enzyme with the necessary activity [5]. Unlike lipases, esterases exhibit differences in kinetic properties and substrate specificity [6]. Specifically, esterases predominantly hydrolyse water-soluble esters of fatty acids with short hydrocarbon chains (<10 carbon atoms), whereas lipases act on insoluble triglycerides with long-chain residues (≥10 carbon atoms) [7].

In terms of practical applications, microbial esterases have high value owing to their high activity, stability over a wide range of temperatures and pH values, and resistance to solvents and detergents. Hence, microbial esterases are used in industries such as biofuel production, food processing, pesticide removal, pharmaceutical synthesis and cosmetics [8,9].

Among the estarase-producing microorganisms of industrial importance are bacteria of the genera Aeromonas, Streptomyces, Pseudomonas, and Bacillus [10,11,12]. In particular, esterases of bacillary origin have attracted attention from researchers. The specificity and enantioselectivity of Bacillus esterases and lipases render them valuable tools for synthesizing optically pure compounds, such as D-methyl lactates, which are used to produce many pharmaceuticals and chiral chemicals [13,14]. Furthermore, these enzymes are used to prepare compounds with high enantiomeric excess in a stereoselective manner, thereby reducing the costs of subsequent purification and improving the overall efficiency of pharmaceutical manufacturing processes [14]. Moreover, the high substrate specificity and robust catalytic profiles of Bacillus lipases facilitate their use in drug metabolism studies to mimic human metabolic pathways and evaluate potential drug interactions [15].

Notably, GDSL esterases, which are a subfamily of serine hydrolases, are distinguished among esterases by a characteristic motif (GDSxxDxG) near the N-terminus, belonging to the SGNH superfamily. Unlike carboxyl esterases, GDSL esterases often have multiple catalytic blocks, which determine a wide range of substrate specificity and regio- and enantioselectivity [16]. Thus, such enzymes are used as biocatalysts in the synthesis of esters and aromatic compounds, in the biodegradation of lipophilic pollutants, and in the food and oil processing industries [10,17,18]. Suitably, representatives of the genus Bacillus possess functional GDSL esterases with desirable industrial properties, such as thermal and alkaline stability, and the ability to function in the presence of detergents [17]. Specifically, esterase activity was previously detected in the secretory extract of Bacillus paralicheniformis T7 isolated from soil [19,20]. Although, bacteria are a key source of esterases, many bacterial enzymes remain insufficiently studied.

Therefore, this study aimed to identify and characterize novel GDSL esterases produced by the Bacillus paralicheniformis T7 strain. The esterase genes were cloned and expressed in Escherichia coli cells. Recombinant enzymes were then isolated and purified, and their biochemical properties, substrate specificity, and kinetic parameters were determined. Moreover, various culture media were tested to increase the esterase yield when culturing the B. paralicheniformis T7 strain. The strain was then fermented in a bioreactor to produce a dried preparation with esterase activity.

2. Materials and Methods

2.1. Reagents, Media, and Enzymes

All chemical reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) and AppliChem (Darmstadt, Germany). The following media were used to culture the B. paralicheniformis and E. coli strains: lysogeny broth (pH 7.0) comprising 0.5% yeast extract (Condalab, Madrid, Spain), 1% tryptone (Sigma-Aldrich), and 0.5% NaCl (Sigma-Aldrich); nutrient broth (HiMedia, Mumbai, India); feather medium with yeast extract (pH 7.0) comprising 0.03% NaH2PO4, 0.035% Na2HPO4, 0.2% yeast extract, and 0.75% feather powder; salt medium with Tween-20 (pH 7.0) comprising 0.01% (NH4)2SO4, 0.016% K2HPO4, 0.02% KH2PO4, 0.002% CaCl2, 0.02% MgSO4, 0.005% ZnSO4, 0.005% MnSO4, 0.001% FeSO4, and 1% Tween 20; and yeast extract peptone (YEPT; pH 7.0) comprising 0.3% yeast extract, 0.5% peptone (TM Media, Delhi, India), and 1% tributyrin.

2.2. Strains, Vectors, and Oligonucleotides

The following bacterial strains were used: Bacillus paralicheniformis T7, which was isolated from soil [21], and E. coli strains DH5α (Promega, Madison, WI, USA) and BL21(DE3) (Novagen, Madison, WI, USA). The pET-28c(+) vector (Novagen) was used to clone the esterase genes and produce recombinant proteins in E. coli cells. The oligonucleotides used to clone the esterase genes and sequence the insert are listed in Table 1.

Table 1.

Oligonucleotides for cloning.

Name Sequence in 5′–3′ Direction
EST-24fw GGGAATTCCATATGTGCGGAGAGGACGATCCC
EST-24rv CGCGGATCCTCAAGAAGTTTTTATAACTTTACTTTCAT
EST-28fw GGGAATTCCATATGTGCGGAGAGGACGATCCC
EST-28rv CGCGGATCCTCAAGAAGTTTTTATAACTTTACTTTCAT
T7fw TAATACGACTCACTATAGGG
T7rv GCTAGTTATTGCTCAGCGG

2.3. Cloning of Esterase Genes into Vectors

The B. paralicheniformis T7 was cultured in 5 mL of nutrient broth in a shaking incubator at 37 °C and 150 rpm for 18 h. Thereafter, the cells were collected via centrifugation at 6000× g and 4 °C for 7 min. Subsequently, the genomic DNA was isolated using a Monarch Nucleic Acid Purification Kit (New England Biolabs, Ipswich, MA, USA). The est-24 and est-28 esterase genes were then amplified from the genomic DNA via PCR using the oligonucleotides EST-24fw/EST-24rv and EST-28fw/EST-28rv. The amplified fragments were cloned into the pET-28c(+) vector at the NdeI and BamHI sites using appropriate restriction endonucleases in 2X Tango buffer (Thermo Fisher Scientific, Vilnius, Lithuania). The T7 region of the resulting construct was sequenced using the Sanger method [22] and BigDyeTerminator v3.1 (Thermo Fisher Scientific). The sequenced DNA fragments were then separated using an ABI 3730 xl automated sequencer (Applied Biosystems, Foster City, CA, USA). The resulting pET-28/EST-24 and pET-28/EST-28 plasmid vectors were produced in E. coli DH5α cells and isolated using a GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific).

2.4. Esterase Expression and Purification of Recombinant Proteins

Competent E. coli BL21(DE3) cells were transformed with the pET-28/EST-24 and pET-28/EST-28 vectors. Transformation was performed using a MicroPulser electroporator (Bio-Rad Laboratories, Hercules, CA, USA). The transformant clones were then selected on Luria–Bertani (LB) agar containing kanamycin (50 μg/mL) and cultured in LB broth containing kanamycin until an optical density of 0.6 at a wavelength of 600 nm was achieved. Thereafter, isopropyl β-d-1-thiogalactopyranoside (0.5 mM) was added, and protein induction was carried out for 16 h at 18 °C.

The cells were collected via centrifugation at 6000× g for 6 min and lysed using a Ruptor 4000 (OMNI, Kennesaw, GA, USA) sonicator. The water-soluble fraction was then separated via centrifugation at 40,000× g for 1 h at 4 °C. Thereafter, the fraction was applied to a column with nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Invitrogen, Carlsbad, CA, USA), which had been pre-equilibrated with a buffer containing 20 mM Tris-HCl (pH 8.0), 500 mM NaCl, and 20 mM imidazole. Subsequently, the recombinant protein was eluted using a stepwise increase in imidazole concentration: 100, 150, 200, and 250 mM in a buffer containing 20 mM Tris-HCl (pH 8.0) and 500 mM NaCl. Fractions were analysed via sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE). The fractions containing target proteins were concentrated and buffered using a protein concentrator (Pierce™ Protein Concentrators PES, Thermo Fisher Scientific) with a cutoff of 10,000. The protein concentrations were measured and used in subsequent experiments.

2.5. SDS-PAGE

Electrophoretic separation of proteins via SDS-PAGE was performed in a 12% polyacrylamide gel according to the Laemmli method [23] in a MiniProtean IV cell (Bio-Rad Laboratories). A Pierce™ Unstained Protein MW Marker (Thermo Fisher Scientific, cat. #26610) was used as a molecular weight marker for the proteins.

2.6. Protein Concentration Measurements

The protein concentration was determined using the Bradford method [24] with Protein Assay Dye Reagent (Bio-Rad Laboratories), and bovine serum albumin was used as the standard. Briefly, 100 μL of Bradford reagent was mixed with 860 μL of 10% phospahte buffered saline (PBS) solution containing 1% glycerol, and 40 μL of the sample was added. The solution was shaken and incubated for 2 min at room temperature. The optical density was then measured using a spectrophotometer at a wavelength of 595 nm.

2.7. Enzyme Activity Assays

Esterase activity was measured according to Zhao et al. [25]. Briefly, 100 μL of the sample and 50 μL of the substrate (10 mM p-nitrophenyl acetate dissolved in isopropanol) were added to 350 μL of 50 mM sodium phosphate buffer at pH 7.0. The mixture was then incubated at 40 °C for 10 min, and the reaction was stopped by adding 1 mL of ethanol. The solution was then centrifuged at 1000× g for 3 min, and the absorbance was measured at 410 nm using a UV1900i spectrophotometer (Shimadzu, Kyoto, Japan). One unit of esterase activity corresponded to the formation of 1 μmol of 4-nitrophenol (pNP) per minute under these conditions.

2.8. Effect of Temperature and pH on Enzyme Activity and Stability of Recombinant Esterases

Enzyme activity was measured within a pH range of 3.0–11.0. The following buffer systems were used: citrate buffer (pH 3.0–5.0), sodium phosphate buffer (pH 6.0–7.0), and glycine-NaOH buffer (pH 8.0–11.0). The obtained values were converted to relative units, with the maximum value set at 100%. For the pH stability experiments, the enzyme extract was pre-incubated for 2 h at 23 °C in 10 mM citrate buffer at pH 4.0 and 6.0 and in 50 mM Tris-HCl buffer at pH 8.0 and 10.0. The residual activity was then measured in 50 mM sodium phosphate buffer at pH 7.0. The results were expressed as a percentage of the activity of the unpreincubated extract, set at 100%. The effect of temperature on esterase activity was assessed in the range of 30–80 °C in intervals of 5 °C. The maximum enzymatic activity was taken as 100%. To analyse the thermal stability, the enzyme extract was pre-incubated for 5 h at 40, 50, 60 or 70 °C in 50 mM Tris-HCl buffer solution (pH 7.0). The residual activity was then measured at 40 °C in 50 mM sodium phosphate-buffered solution (pH 7.0). The results were expressed as a percentage of the activity of the extract not subjected to thermal incubation. All experiments were performed in triplicate.

2.9. Effect of Metal Ions and Detergents on Esterase Activity

The effect of metal ions on esterase activity was determined using the following ions: Ca2+, Mg2+, Mn2+, Cu2+, Zn2+, and Fe2+. The effect of the metal ions, the reducing agents β-mercaptoethanol and dithiothreitol (DTT), the inhibitor phenylmethylsulfonyl fluoride, the chelating agent ethylenediaminetetraacetic acid (EDTA), and the detergents Tween-20, Tween-80, Triton X-100, and SDS on enzymatic activity was determined by adding the reagents to the reaction mixture. Enzymatic activity was then assessed at 40 °C in a 50 mM sodium phosphate-buffered solution (pH 7.0). Activity values in the absence of metal ions and chemicals were considered 100% activity.

2.10. Substrate Specificity of Recombinant Esterases

The substrate specificity of the recombinant esterases was determined using pNP esters with different acyl chain lengths (C2–C18). The reaction was carried out in 50 phosphate buffer (pH 7.0) at 40 °C for 10 min and the concentration of each substrate was 10 mM. The following substrates were used to determine substrate specificity: 4-nitrophenyl acetate, 4-nytrophenyl octanoate (Thermo Fisher Scientific), 4-nitrophenyl palmitate, 4-nitrophenyl dodecanoate (Sigma-Adlrich), 4-nitrophenyl decanoate, 4-nitrophenyl stearate (BLDpharm, Songjiang, Shanghai, China), 4-nitrophenyl butyrate (Cayman chemical company, Ann Arbor, MI, USA), 4-nytrophenyl myristate, and 4-nytrophenyl hexanoate (Apollo Scientific, Stockport, UK).

2.11. Kinetic Parameters and Specific Activity of Recombinant Esterases

The kinetic parameters were measured using an enzymatic reaction to cleave p-nitrophenyl acetate at concentrations of 0.01–2.00 mM in a 50 mM sodium phosphate-buffered solution at pH 7.0 and a temperature of 40 °C. The Michaelis constant (Km) and maximum velocity (Vmax) values were calculated using the Michaelis–Menten equation [26]. To determine the Km and catalytic rate (Kcat) constants, the linear velocity was measured, and the constants were determined using the one-site binding (hyperbolic) model with GraphPad Prism 8.0.1 (GraphPad Software, San Diego, CA, USA). The specific activity was measured under optimal conditions with p-nitrophenyl acetate serving as the substrate for rEST-28 and p-nitrophenyl decanoate for rEST-24.

2.12. Effect of Culture Media on Esterase Activity

Bacillus paralicheniformis T7 cultures were grown independently in four 1 L flasks in a KS4000i Control shaker incubator (IKA, Staufen im Breisgau, Germany). To obtain a total inoculum, the culture was grown in 50 mL of lysogeny broth overnight at 37 °C and 150 rpm. The cells were collected via centrifugation at 6000× g at 4 °C for 7 min. The supernatant was removed, and the pellet washed in 1 mL of PBS. This process was repeated, and the supernatant removed again. Thereafter, the pellet was suspended in 1 mL of PBS, and 200 μL of the suspension was inoculated into 200 mL of sterile nutrient broth, feather medium with yeast extract, salt medium with Tween 20, and YEPT medium. The cultures were then grown at 37 °C and 150 rpm for 102 h. After 6, 24, 30, 48, 54, 72, 78, 96, and 102 h, 1 mL samples were taken and centrifuged at 10,000× g for 5 min at 4 °C. The esterase activity of the resulting supernatants was then measured using p-nitrophenyl acetate.

2.13. Effect of Fermentation on Esterase Activity

The ability of B. paralicheniformis T7 to produce esterases during submerged fermentation was tested using a 10 L Biostat bioreactor (Sartorius, Göttingen, Germany). Submerged fermentation was carried out according to Akishev et al. [27]. Briefly, a single colony was inoculated into 5 mL of nutrient broth, cultured at 37 °C in a shaker incubator at 180 rpm for 18 h, and then transferred to 200 mL of feather medium supplemented with 0.2% yeast extract. This was grown under the same conditions for a further 24 h. Thereafter, the culture was inoculated into 6 L of sterile feather medium with 0.2% yeast extract in a 10 L fermenter. The submerged fermentation conditions were as follows: temperature, 37 °C; stirring, 450 rpm; and aeration, 6–10 L/min. Subsequently, the strain culture was freed from the cells and substrate residues via centrifugation at 11,000× g, and sterilised via microfiltration using a UPIRO-018 benchtop filter apparatus (Vladisart, Vladimir, Russia) and an MKM46020 polyethersulfone membrane module (Vladisart) with a cutoff threshold of 0.22 µm. The clarified cultures were frozen at −80 °C in a U570 ultra-low freezer (New Brunswick Scientific, Enfield, CT, USA) and then dried under vacuum (0.028 mbar) at −90 °C in a BETA 2-8 LDplus lyophilizator (Christ, Osterode, Germany) for 48 h. The lyophilised enzyme preparation was ground into a powder, and the esterase activity was measured using p-nitrophenyl acetate.

2.14. Sequence Analysis

To compare conserved motifs in the amino acid sequence, peptide sequences of bacterial SGNH esterases/lipases containing the GDSL motif were searched in the National Center for Biotechnology Information and Protein Data Bank databases. Multiple sequence alignment was performed using Clone Manager software7, version 7.11 (Sci-Ed Software, Westminnster, CO, USA). The secondary structure prediction and the analysis of multiple sequence alignments were conducted using ESPript 3.0 (https://espript.ibcp.fr/ESPript/ESPript/index.php, accessed on 29 January 2026). Multiple sequence alignment of Est-24 was performed using the sequences of Lipase Lip_vut3 from the Goat Rumen metagenome and GDSL-type esterase/lipase family proteins (pdb_00006nkd) from Bacillus halotolerans (Accession No. WP_326139525), B. haynesii (Accession No. WP_268350347), B. swezeyi (Accession No. WP_414557567), B. velezensis (Accession No. WP_413544555), and B. safensis (Accession No. WP_075622364), which were identical to Est-24 by 94%, 57%, 95%, 82%, 53%, and 45%, respectively. Multiple sequence alignment of Est-28 was performed using the sequences of GDSL-type esterase/lipase family proteins из multispecies of Bacillus (Accession No. WP_035428200), B. swezeyi (Accession No. WP_414555771), B. maginnsis (Accession No. WP_435302229), multispecies of Bacillus (Accession No. WP_010335020), and B. pumilus (Accession No. WP_260980731), which were identical to Est-28 84%, 89%, 59%, 65%, and 60%, respectively.

2.15. Software Tools, Bioinformatics, and Statistical Analysis

Capillary sequencing chromatograms were analyzed using Vector NTI Advance 11 software (Thermo Fisher Scientific). The online SignalP 5.0 platform was used to analyze the protein sequence for the presence of a secretory peptide (http://www.cbs.dtu.dk/services/SignalP/, accessed on 29 January 2026). All activity experiments were performed in triplicate. Enzyme activity data were obtained from independent assays, and mean values, standard deviations (SD), and p-values were calculated using GraphPad Prism version 8.0.1 (GraphPad Software, USA). All data are presented as the mean ± SD (n = 3).

3. Results

3.1. Cloning of Esterases est-24 and est-28 from Bacillus paralicheniformis T7

Oligonucleotides were designed to amplify the GDSL esterase genes est-24 (636 bp) and est-28 (678 bp) based on the complete genome sequence of B. paralicheniformis T7 (GenBank accession no. CP124861). These genes were then cloned into the rEST-28c(+) vector. The recombinant proteins contained a 6×His-tag at the N-terminus of the open reading frame comprising 232 and 247 amino acids, respectively. The calculated molecular masses and predicted pI values for the rEST-24 and rEST-28 proteins were 26.1 and 27.9 kDa and 6.05 and 9.56, respectively.

3.2. Purification of rEST-24 and rEST-28 Esterases

The expression of rEST-24 and rEST-28 in E. coli BL21(DE3) cells revealed that the recombinant esterases were present in both the water-soluble fraction and the pellet, where they accumulated as inclusion bodies. During chromatographic purification, rEST-24 and rEST-28 were eluted from Ni-NTA at an imidazole concentration of 250 mM (Figure 1). The yields of the purified enzymes were 42 mg and 2.9 mg per litre of induced culture, respectively.

Figure 1.

Figure 1

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis following the chromatographic purification of rEST-24 (a) and rEST-28 (b) on nickel-nitrilotriacetic acid (Ni-NTA). Line M, protein marker (Thermo Scientific, cat. # 26610); line 1 the supernatant passed through colomn with Ni-NTA, lines 2–7 eluates with 20, 80, 100, 150, 250, and 500, respectively.

3.3. Effects of pH and Temperature on the Enzymatic Activity of rEST-24 and rEST-28

The effects of pH on the activity of rEST-24 and rEST-28 was evaluated using p-nitrophenyl acetate as a substrate in the pH range of 3.0–10.0. The rEST-24 esterase exhibited maximum activity at pH 7.0 only, whereas rEST-28 exhibited maximum activity at pH 6.0–7.0 (Figure 2a). Moreover, assessment of pH stability during enzyme incubation at pH 4.0, 6.0, 7.0, 8.0 and 10.0 showed that the residual activity of rEST-24 did not exceed 30%, whereas rEST-28 retained over 80% of its esterase activity at pH values of >7.0. Furthermore, incubation of rEST-28 at pH 10.0 increased esterase activity by 15% (Figure 2b).

Figure 2.

Figure 2

Effect of pH on esterase activity (a) and stability (b) of rEST-24 and rEST-28. Values are presented as mean ± standard deviation (SD) and are representative data obtained in triplicate assays.

In addition, the effects of temperature on the activity of rEST-24 and rEST-28 were investigated at temperatures ranging from 25 to 80 °C. Overall, the enzymes exhibited maximum activity at 40 °C (Figure 3a); however, within the temperature range of 30–50 °C, both rEST-24 and rEST-28 demonstrated 50% of their maximum activity. At 60 °C, their relative esterase activities were 37% and 28%, respectively. Notably, rEST-24 was no longer active at 70 °C, whereas rEST-28 exhibited over 30% of its maximum activity at this temperature. Figure 3b illustrates the residual activity of rEST-24 and rEST-28 following a 120 min incubation period at temperatures of 40, 50, and 60 °C. Both enzymes exhibited similar temperature stability. After a 2 h incubation, the residual activity of rEST-24 was 23.5, 31.5, and 12.5% at 40, 50, and 60 °C, respectively, whereas that of rEST-28 was 20, 33.5, and 13.5%, respectively.

Figure 3.

Figure 3

Effect of temperature on esterase activity (a) and stability (b) of rEST-24 and rEST-28. Values are presented as mean ± standard deviation (SD) and are representative data obtained in triplicate assays.

3.4. Effects of Metal Ions, Detergents, Reducing Agents, and Inhibitors on Stability of rEST-24 and rEST-28

The effects of metal ions on the activity of rEST-24 and rEST-28 were investigated and revealed that a concentration of 10 mM Ca2+ (Table 2) reduced the esterase activity of rEST-24 and rEST-28 by 50% and 86%, respectively. Unlike rEST-28, which was sensitive to Mg2+ ions, rEST-24 esterase was tolerant of Mg2+. Moreover, Mn2+ increased the esterase activity of rEST-24 and rEST-28 by 26% and 62%, respectively, whereas Cu2+ completely inhibited rEST-24 activity and reduced rEST-28 activity by 68%. Zn2+ ions reduced the esterase activity of rEST-24 and rEST-28 by 77% and 67%, respectively, whereas Fe2+ ions inhibited rEST-24 activity and reduced rEST-28 activity by 66%. The addition of 10 mM EDTA reduced esterase activity by more than 40%. DTT and β-mercaptoethanol markedly inhibited esterase activity, thereby reducing rEST-28 activity to zero when added. The addition of the non-ionic detergents Tween-20, Tween-80, and Triton X-100 reduced esterase activity by 10–54%. Furthermore, SDS reduced the esterase activity of rEST-24 and rEST-28 by 70% and 11%, respectively.

Table 2.

Effect of metal ions and detergents on esterase activity of rEST-24 and rEST-28.

Metal Ion Concentration Residual Activity, %
rEST-24 rEST-28
Control 10 mM 100 ± 5 100 ± 1
Ca2+ 10 mM 52 ± 6 14 ± 1
Mg2+ 10 mM 102 ± 3 52.3 ± 0.5
Mn2+ 10 mM 126 ± 5 37.7 ± 0.6
Cu2+ 10 mM 0 32.7 ± 0.5
Zn2+ 10 mM 23 ± 4 33 ± 3
Fe2+ 10 mM 0 34 ± 3
EDTA 10 mM 78 ± 2 54.5 ± 0.7
DTT 10 mM 12 ± 1 0
β-Mercaptoethanol 10 mM 37 ± 1 0
Tween-20 0.1% 54 ± 1 80.0 ± 0.6
Tween-80 0.1% 64 ± 2 74 ± 0.6
Triton X-100 0.1% 90 ± 5 46 ± 2
SDS 0.1% 30 ± 2 89 ± 3

All measurements were performed three times independently, and the average of the three replicates was reported as the defined result ± standard deviation (±SD). EDTA, ethylenediaminetetraacetic acid; DTT, dithiothreitol; SDS, sodium dodecyl sulfate.

3.5. Substrate Specificity and Kinetic Characteristics

The substrate specificity of EST-24 and EST-28 was studied using p-nitrophenyls with different acyl chains: from C2 (pNP-acetate) to C18 (pNP-stearate). Table 3 shows the specific activity of these substrates.

Table 3.

Substrate specificity of rEST-24 and rEST-28.

Substrate Abbreviation Specific Activity, U/mg
rEST-24 rEST-28
4-Nitrophenyl acetate (C2) pNPA 16 ± 1 250.3 ± 0.1
4-Nitrophenyl butyrate (C4) pNPB 39 ± 2 47.8 ± 0.2
4-Nitrophenyl hexanoate (C6) pNPH 39 ± 2 93 ± 1
4-Nitrophenyl octanoate (C8) pNPO 44 ± 2 24.4 ± 0.2
4-Nitrophenyl decanoate (C10) pNPD 60 ± 2 31.1 ± 0.2
4-Nitrophenyl dodecanoate (C12) pNPL 52 ± 1 42.3 ± 0.2
4-Nitrophenyl myristate (C14) pNPM 51 ± 1 15.6 ± 0.2
4-Nitrophenyl palmitate (C16) pNPP 45 ± 4 11.1 ± 0.1
4-Nitrophenyl stearate (C18) pNPS 31 ± 16 32.2 ± 0.4

The highest activity of rEST-24 was observed for pNPD, whereas the maximum activity of rEST-28 was observed for pNPA. The Km values for rEST-24 and rEST-28 for pNPD and pNPA were 11.5 and 26.18 mM, respectively. The Vmax value was 23.2 and 52.37 U/mg for rEST-24 and rEST-28, respectively. The Kkat value was 0.18 s−1 and 1.74 s−1 for rEST-24 and rEST-28, respectively.

3.6. Effect of Culture Media and Fermentation on Esterase Activity

The wild strain of B. paralicheniformis T7 was cultured for five days in four different media: nutrient broth, feather medium with yeast extract, salt medium with Tween 20, and YEPT. Figure 4 shows how the esterase activity of the culture depends on the cultivation time. The highest activity was observed in the feather medium, with an esterase activity of 163 ± 6 U/mL after 96 h. Cultivation in nutrient broth also yielded the highest activity after 96 h (150 ± 3 U/mL). No esterase activity was observed in the salt medium with Tween 20 or YEPT (Figure 4).

Figure 4.

Figure 4

Flask culture of Bacillus paralicheniformis T7 in nutrient broth (NB), feather medium with yeast extract (FMYE), salt medium with Tween 20 (SMT), and yeast extract peptone medium (YEPT). Values are presented as the mean ± standard deviation (SD) and are representative data obtained in triplicate assays.

In addition, the B. paralicheniformis T7 strain was cultivated via submerged fermentation in a 10 L bioreactor using feather medium with yeast extract. The culture fluid was then lyophilized at −52 °C under vacuum for 63 h to obtain the enzyme preparation. The esterase activity of the preparation was 17,618 ± 610 U/g.

4. Discussion

Microorganisms isolated from the environment are a source of a various enzymes of great industrial importance [28]. Particular attention is given to the genus Bacillus, which has several advantages, including high protein synthesis, the ability to secrete enzymes, and potential industrial applications [29]. Esterases are in high demand in various fields of microbial enzyme research, including biodiesel production, advanced food processing, the removal of chemical pesticides from fruit and vegetables, the cosmetics industry, chemical synthesis, and pharmaceutical production [8,9,30]. In particular, GDSL esterases have attracted considerable interest owing to their unique structural features and catalytic properties that distinguish them from classical esterases and lipases. One such distinctive feature is their conserved N-terminal motif, which distinguishes them from classical lipases and renders them members of the SGNH hydrolase superfamily. A detailed analysis of the enzyme sequences revealed the presence of the following four conserved sequence blocks containing invariant residues: serine in block I, glycine in block II, asparagine in block III, and histidine in block V [17]. Collectively, these blocks form a highly conserved catalytic centre, which is crucial for efficient substrate hydrolysis. Unlike classical lipases, which typically contain a Gly-X-Ser-X-Gly motif, Bacillus GDSL esterases are characterised by a GDSL tetrapeptide, which is often embedded within a larger conserved pentapeptide, such as GLSLG [31]. The three-dimensional structure of these enzymes is determined by the α/β-hydrolase fold, which is renowned for its structural stability and versatility. Molecular modelling of Bacillus GDSL esterases, based on homologous structures in Bacillus and related bacteria, reveals a central β-sheet surrounded by α-helices. This arrangement creates a stable scaffold that supports the catalytic triad and facilitates the formation of a narrow active site pocket [17,32].

In this study, recombinant GDSL esterases were obtained from B. paralicheniformis T7 and their biochemical properties evaluated. Two GDSL esterases were identified in the B. paralicheniformis T7 genome: an esterase with a molecular weight of 26.8 kDa and a signal peptide (MVLIFLLLLAG) in the secretory proteome of the strain; and intracellular esterase with a molecular weight of 23.4 kDa. The open reading frames of EST-24 and EST-28 contain 212 and 237 amino acid residues, respectively. Multiple alignment of the EST-24 and EST-28 sequences with other bacillary GDSL esterases/lipases revealed that EST-24 and EST-28 possesses a conserved GDSX motif near the N-terminus of the protein (Figure 5 and Figure 6). The four invariant essential catalytic residues Ser, Gly, Asn, and His in blocks I, II, III, and V of EST-24 and EST-28, respectively, confirm their classification as SGNH hydrolase superfamily members. The catalytic triad of serine, aspartate, and histidine for EST-24 is located in blocks I and V at positions Ser11-Asp186-His189. In EST-28, this triad is located at positions Ser26-Asp200-His205.

Figure 5.

Figure 5

Amino acid sequence alignment analysis of EST-24. Sequences retrieved from National Center for Biotechnology Information (NCBI) server and aligned in Clustal W and rendered using ESPript output. 6MKD_1—Lipase Lip_vut3 from Goat Rumen metagenome; EST-24 from Bacillus paralicheniformis T7; WP_326139525 from B. halotolerans; WP_268350347 from B. haynesii; WP_414557567 from B. swezeyi; WP_413544555 from B. velezensis; and WP_075622364 from B. safensis. Conserved motifs are highlighted. Residues strictly conserved among groups are shown in white font on red background. Four conserved blocks of I, II, III, and V are bracketed. Green triangles at the top of the alignment represent the location of the SGNH. The possible catalytic triads (serine (S), aspartic acid (D), histidine (H)) are shown at the bottom of the alignment with blue asterisks. Symbols above sequences represent the secondary structures; springs represent α-helices, and arrows represent β-sheets based on 6MKD_1 retrieved from PDB (pdb_00006nkd).

Figure 6.

Figure 6

Amino acid sequence alignment analysis of EST-28. Sequences retrieved from National Center for Biotechnology Information (NCBI) server and aligned in Clustal W and rendered using ESPript output. WP_035428200 from multispecies of Bacillus; EST-28 from B. paralicheniformis T7; WP_414555771 from B. swezeyi; WP_435302229 from B. maginnsis; WP_010335020 from multispecies of Bacillus; and WP_260980731 from B. pumilus. Conserved motifs are highlighted. Residues strictly conserved among groups are shown in white font on red background. Four conserved blocks of I, II, III, and V are bracketed. Green triangles at the top of the alignment represent the location of the SGNH. The possible catalytic triads (serine (S), aspartic acid (D), histidine (H)) are shown at the bottom of the alignment with blue asterisks. Symbols above sequences represent the secondary structures; springs represent α-helices, and arrows represent β-sheets based on WP_035428200 retrieved from NCBI (A0A6I7FER0).

Two recombinant analogues of these esterases were obtained via cloning: rEST-24, an analogue of the intracellular GDSL esterase; and rEST-28, an analogue of the extracellular GDSL esterase, but without the secretory peptide. Considering that the open reading frame in the pET-28/EST-24 and pET-28/EST-28 vectors contains 6× His-tag along with additional amino acid residues, the molecular mass of the recombinant rEST-24 and rEST-28 proteins changed to 26.1 kDa and 27.9 kDa, respectively.

Among bacillary esterases, exist monomeric proteins, such as enzymes [17,18,33,34,35,36,37,38,39,40,41,42,43,44,45,46], dimers [44,47], and oligomers [48] of subunits (Table 4). In terms of size, esterases are medium-sized proteins. Specifically, the molecular weight of monomeric bacillary esterases ranges from 24.5 kDa for and 25.0 kDa for Bacillus licheniformis [33] to 55.0 kDa for Bacillus megaterium WZ009 [34] and 60.3 kDa for Bacillus subtilis DR8806 [46]. The esterases EST-24 and EST-28 from B. paralicheniformis T7 also fall within this molecular weight range and are monomeric proteins.

Table 4.

Characteristics of bacillary esterases.

Enzyme Source Weight, kDa Specific Activity, U/mg Optimal pH Optimal Temperature, °C Reference
rEST-28 Bacillus paralicheniformis T7 27.9 193 7.0 40 this study
rEST-24 Bacillus paralicheniformis T7 26.1 250 6.0–7.0 40 this study
Est700 Bacillus licheniformis 25 no data 8.0 30 [33]
Est8 Bacillus sp. K91 24.5 no data 9.0 50 [17]
EST Bacillus megaterium WZ009 55 135.3 11.5 25 [34]
BaCEs04 Bacillus velezensis SYBC H47 31.9 (monomer), 63.8 (dimer) 0.55 7.5 60 [47]
Esterase Bacillus pumilus 17 (monomer), 170 (oligomer) 67.7 8.0 37 [48]
CarEW Bacillus sp. K91 54 no data 4.5 45 [35]
AE6L Bacillus sp. HR21-6 26 39.64 7.3 37 [18]
BS2 Bacillus subtilis DSM402 54 218 8.0–9.0 50 [36]
EST2 Bacillus acidocaldarius 34 1278 7.1 65 [37,38]
LipJ Bacillus sp. JR3 46 0.05 7.0 30 [39]
EstE9 Bacillus subtilis E9 45 384 7.0 40 [40]
Esterase Bacillus cereus WZZ001 55 no data 7.0 40 [41]
Esterase Bacillus sp. 4 no data 833.33 6.0 65 [42]
Esterase Bacillus aerophilus 28 238 8.0 37 [43]
Esterase I Bacillus subtilis NRRL 365 36 80 8.0 30 [44]
Esterase II Bacillus subtilis NRRL 365 57 and 48 (monomer), 105 (dimer) 520 8.0 30 [44]
BpFae12 Bacillus pumilus W3 35 12.8 8.0 50 [45]
Esterase Bacillus subtilis DR8806 60.3 369 8.0 50 [46]

Comparative analysis of the biochemical characteristics of esterases revealed that both esterases are neutral enzymes that display maximum activity at a pH of 7.0. Additionally, rEST-28 esterase exhibits activity under slightly acidic conditions. Both esterases exhibit maximum activity at 40 °C; however, unlike rEST-24, which is completely inactivated at 70 °C, rEST-28 remains active up to 80 °C. Similarly, most bacillary esterases are neutral or alkaline enzymes. However, the CarEW esterase from Bacillus sp. K91 is an acid esterase [35]. The temperature range at which Bacillus esterases exhibit maximum activity varies from 25 °C for esterases from B. megaterium WZ009 [34] to 65 °C for B. subtilis WB600 [49], Bacillus acidocaldarius [37,38], and Bacillus sp. 4 esterases [42]. Comparing the temperature indices of bacillary esterases with those of esterases from other genera revealed no pronounced differences; thus, an optimal temperature of 45 °C was established for the esterase from Alteromonas sp. 39-G1 [3], whereas the esterase from Geobacillus sp. JM6 [50] demonstrated maximum activity at 60 °C.

Bacillary GDSL esterases are characterised by their resistance to denaturation under pH fluctuations. Some retain over 80% of their maximum activity across a relatively wide pH range, rendering them ideal for use in changing chemical environments [17]. The evaluation of the pH stability of rEST-24 and rEST-28 revealed differences between the two enzymes. Following a 2 h incubation period under acidic (pH 4.0), neutral (pH 7.0), and alkaline (pH 10.0) conditions, rEST-24 retained no more than 25% of its esterase activity. However, rEST-28, exhibited greater stability, ranging from 35% under acidic pH to 120% under alkaline pH. The greater stability of rEST-28 under alkaline conditions may be attributed to the fact that it is an extracellular enzyme of B. paralicheniformis T7 that is capable of growing in a medium with a pH of 6.0–8.5. In contrast, the rEST-24 esterase functions inside the cell, where cytoplasmic pH fluctuations are less pronounced.

In addition, bacillary GDSL esterases are stable under fairly harsh temperature conditions. Thermostability studies show that many of these esterases retain optimal activity at temperatures between 50 and 60 °C and, in some cases, retain noteworthy catalytic function even after prolonged incubation at elevated temperatures [17]. This thermal stability is attributable to the stable structure of the α/β-hydrolase, which consists of a network of hydrogen bonds and hydrophobic interactions that strengthen the three-dimensional structure as a whole. The two GDSL esterases, rEST-24 and rEST-28, exhibited virtually identical thermal stability. Specifically, 1 h incubations at 40 °C and 50 °C reduced activity by no more than 40%, whereas after 2 h, residual activity was reduced to no more than 20%. Furthermore, incubation at 60 °C did not depend on the length of the incubation period; in both cases, the enzymes retained approximately 12% of their residual activity.

The esterases rEST-24 and rEST-28 are sensitive to divalent ions. These metal ions generally reduced the activity of the esterases in this study; however, rEST-24 exhibited tolerance to Mg2+, and the addition of 10 mM Mn2+ increased its activity. Copper and iron ions strongly inhibited rEST-24; however, rEST-28 activity remained at 33–34% despite being reduced. Furthermore, 10 mM DTT and β-mercaptoethanol completely inhibited rEST-28 activity, and rEST-28 exhibited resistance to non-ionic detergents, such as Tween-20, Tween-80, and Triton X-100. Given that rEST-24 is an intracellular enzyme and rEST-28 is an extracellular enzyme, the relative resistance of rEST-28 to detergents and inhibitors (except DTT and β-mercaptoethanol) may be attributed to its extracellular localisation. The same Mg2+ tolerance of rEST-24 was previously noted for esterases from Bacillus aerophilus, B. pumilus W3, and B. velezensis SYBC H47 [43,45,47]. The inhibitory effect of Cu2+ and Fe2+ ions was also established for the esterase of B. subtilis DR8806 [46]. As with rEST-24, resistance to 1% Triton X-100 was noted for the same esterase [46].

The substrates for bacillary esterases are fatty acid esters with short hydrocarbon chains [7]. Depending on the number of carbon atoms in the chain, the substrates are acetates (C2) [18,32,33,36,46,47,48], butyrates (C4) [32,33,39,42,47], or hexanoates (C6) [47] (Table 4). Analysis of the substrate specificity of rEST-24 and rEST-28 (Table 3) showed that rEST-28 is more specific to short-chain substrates (C2–C6) and is a true esterase, whereas rEST-24 demonstrates specificity to long-chain substrates (C10–C14), which may indicate its lipase activity. Previously, two enzymes with different substrate specificities were discovered in Geobacillus thermocatenulatus KCTC 3921. The enzyme Est29, which showed the highest activity on pNP-octanoate (C8), was classified as an esterase, whereas Lip29, which was more active on pNP-myristate (C14), was identified as a lipase [51]. A comparative analysis of Vmax and Km shows that the maximum reaction rate for bacillary esterases varies considerably, ranging from 0.22 U/mg for LipJ from Bacillus sp. JR3 [39] to 1449 U/mg for esterase from B. subtilis DSM402 [36] (Table 5). In this sstudy, esterases rEST-24 and rEST-28 exhibited average Vmax values. Bacillus esterases are characterised by high substrate affinity, as evidenced by low Km values (Table 5), thus suggesting that B. paralicheniformis T7 esterases require more substrate to achieve the maximum reaction rate.

Table 5.

Kinetic parameters of bacillary esterases.

Esterase Vmax, U/mg Km, mM Substrate Reference
EST-24 from Bacillus paralicheniformis T7 23.2 11.5 pNP decanoate (C10) this study
EST-28 from Bacillus paralicheniformis T7 52.4 26.2 pNP acetate (C2) this study
Esterase from Bacillus subtilis DR8806 151 4.2 pNP acetate (C2) [46]
Esterase from Bacillus pumilus 49.02 3.94 pNP acetate (C2) [48]
Est700 from Bacillus licheniformis 63.04 2.11 pNP acetate (C2) [33]
Est19 from Bacillus sp. K91 277.78 0.42 pNP acetate (C2) [32]
BaCEs04 from Bacillus velezensis SYBC H47 2.63 0.68 pNP acetate (C2) [47]
AE6L from Bacillus sp. HR21-6 13.6 1.7 pNP acetate (C2) [18]
Esterase from B. subtilis DSM402 (BS2) 1449 119 pNP acetate (C2) [36]
Esterase from Bacillus sp. 4 833.33 0.063 pNP butyrate (C4) [42]
Est700 from Bacillus licheniformis 22.76 1.38 pNP butyrate (C4) [33]
Est19 from Bacillus sp. K91 17.86 0.48 pNP butyrate (C4) [32]
BaCEs04 from Bacillus velezensis SYBC H47 6.87 0.73 pNP butyrate (C4) [47]
LipJ from Bacillus sp. JR3 0.22 1.7 pNP butyrate (C4) [39]
BaCEs04 from Bacillus velezensis SYBC H47 1.88 0.55 pNP hexanoate (C6) [47]

Fermenting B. paralicheniformis T7 on four different media showed that salt medium supplemented with Tween-20 and YEPT with tributyrin as an esterase expression stimulator (and the sole carbon source) was ineffective as a nutrient medium for fermenting the producer strain. Nutrient broth or feather medium supplemented with 0.2% yeast extract were more effective. After four days of fermentation, esterase activity on these media was 163 ± 6 and 150 ± 3 U/mL, respectively. These results suggest that a medium enriched with peptides and amino acids, such as those found in meat peptone or formed through the hydrolysis of feather keratin, would be ideal for esterase synthesis. [21]. The level of esterase expression resulting from the fermentation of B. paralicheniformis T7 is considered adequate. Notably, this activity is 15–16 times higher than that observed in the B. subtilis E9 strain (10 U/mL) [40]. Moreover, lyophilization produced an enzyme preparation with an esterase activity of 17,618 ± 610 U/g. These results confirm the potential of using a feather medium to produce GDSL esterases via fermentation with the B. paralicheniformis strain.

5. Conclusions

Overall, B. paralicheniformis T7 can be used to produce esterase enzymes, and these new GDSL esterases from B. paralicheniformis T7 show promising potential in technologies for the hydrolysis and transesterification of fatty acid esters. Given the specificity of EST-28 for short-chain fatty acids, the enzyme shows great promise in technologies for the biocatalytic synthesis of acetic and butyric acid esters, which are used as flavorings in the perfume and food industries. In contrast, EST-24 appears to show promising potential for use in technologies for the hydrolysis and transesterification of fats and oils, including in the production of biodiesel.

Abbreviations

The following abbreviations are used in this manuscript:

YEPT yeast extract peptone medium
LB Luria–Bertani
Ni-NTA nickel-nitrilotriacetic acid
SDS sodium dodecyl sulfate
PAGE polyacrylamide gel electrophoresis
pNP 4-nitrophenol
DTT dithiothreitol
EDTA ethylenediaminetetraacetic acid
Km Michaelis constant
Vmax maximum velocity
SD standard deviation

Author Contributions

Conceptualization, D.S. and B.K.; Methodology, D.S., A.M. and B.K.; Investigation, A.M., M.A. and D.S.; Writing—original draft preparation, B.K.; Writing—review and editing, B.K.; Visualization, A.M.; Supervision, D.S. and B.K.; Project administration, D.S.; Funding acquisition, D.S. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

Mr. Arman Mussakhmetov, Mr. Magzhan Astrakhanov, Dr. Dmitriy Silayev, and Dr. Bekbolat Khassenov were employed by National Center for Biotechnology Ltd. and GenLab Ltd. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding Statement

This research was funded by the Committee of Science of the Ministry of Science and Higher Education of the Republic of Kazakhstan (Grant No. AP19679339).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Castro F.F., Pinheiro A.B.P., Gerhardt E.C.M., Oliveira M.A.S., Barbosa-Tessmann I.P. Production, purification, and characterization of a novel serine-esterase from Aspergillus westerdijkiae. J. Basic Microbiol. 2018;58:131–143. doi: 10.1002/jobm.201700509. [DOI] [PubMed] [Google Scholar]
  • 2.Mussakhmetov A., Silayev D. Esterases: Mechanisms of action, biological functions, and application prospects. Appl. Microbiol. 2025;5:139. doi: 10.3390/applmicrobiol5040139. [DOI] [Google Scholar]
  • 3.Seok-Jae W., Han Byeol J., Kim H.K. Characterization of novel salt-tolerant esterase isolated from the marine bacterium Alteromonas sp. 39-G1. J. Microbiol. Biotechnol. 2020;30:216–225. doi: 10.4014/jmb.1907.07057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nardini M., Dijkstra B.W. Alpha/beta hydrolase fold enzymes: The family keeps growing. Curr. Opin. Struct. Biol. 1999;9:732–737. doi: 10.1016/S0959-440X(99)00037-8. [DOI] [PubMed] [Google Scholar]
  • 5.Soumya P., Kochupurackal J. An esterase with increased acetone tolerance from Bacillus subtilis E9 over expressed in E. coli BL21 using pTac Bs-est vector. Mol. Biotechnol. 2022;64:814–824. doi: 10.1007/s12033-022-00458-4. [DOI] [PubMed] [Google Scholar]
  • 6.Chahinian H., Sarda L. Distinction between esterases and lipases: Comparative biochemical properties of sequence-related carboxylesterases. Protein Pept. Lett. 2009;16:1149–1161. doi: 10.2174/092986609789071333. [DOI] [PubMed] [Google Scholar]
  • 7.Kumar A., Dhar K., Kanwar S.S., Arora P.K. Lipase catalysis in organic solvents: Advantages and applications. Biol. Proced. Online. 2016;18:2. doi: 10.1186/s12575-016-0033-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ng A.M.J., Zhang H., Nguyen G.K.T. Zymography for picogram detection of lipase and esterase activities. Molecules. 2021;26:1542. doi: 10.3390/molecules26061542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhang M., Lai W., Zhu Y., Chen S., Zhou K., Ao X., He L., Yang Y., Zou L., Liu A., et al. Purification and characterization of a novel cypermethrin-hydrolyzing esterase from Bacillus licheniformis B-1. J. Food Sci. 2021;86:1475–1487. doi: 10.1111/1750-3841.15662. [DOI] [PubMed] [Google Scholar]
  • 10.Yu N., Yang J.-C., Yin G.-T., Li R.-S., Zou W.-T., He C. Identification and characterization of a novel esterase from Thauera sp. Biotechnol. Appl. Biochem. 2018;65:748–755. doi: 10.1002/bab.1659. [DOI] [PubMed] [Google Scholar]
  • 11.Noby N., Hussein A., Saeed H., Embaby A.M. Recombinant cold-adapted halotolerant, organic solvent-stable esterase (estHIJ) from Bacillus halodurans. Anal. Biochem. 2020;591:113554. doi: 10.1016/j.ab.2019.113554. [DOI] [PubMed] [Google Scholar]
  • 12.Gall M.G., Nobili A., Pavlidis I.V., Bornscheuer U.T. Improved thermostability of a Bacillus subtilis esterase by domain exchange. Appl. Microbiol. Biotechnol. 2014;98:1719–1726. doi: 10.1007/s00253-013-5053-0. [DOI] [PubMed] [Google Scholar]
  • 13.Huang J., Zhang Y., Hu Y. Functional characterization of a marine Bacillus esterase and its utilization in the stereo-selective production of D-methyl lactate. Appl. Biochem. Biotechnol. 2016;180:1467–1481. doi: 10.1007/s12010-016-2180-y. [DOI] [PubMed] [Google Scholar]
  • 14.Barzkar N., Sohail M., Tamadoni Jahromi S., Gozari M., Poormozaffar S., Nahavandi R., Hafezieh M. Marine bacterial esterases: Emerging biocatalysts for industrial applications. Appl. Biochem. Biotechnol. 2021;193:1187–1214. doi: 10.1007/s12010-020-03483-8. [DOI] [PubMed] [Google Scholar]
  • 15.Ameri A., Shakibaie M., Faramarzi M.A., Ameri A., Amirpour-Rostami S., Rahimi H.R., Forootanfar H. Thermoalkalophilic lipase from an extremely halophilic bacterial strain Bacillus atrophaeus FSHM2: Purification, biochemical characterization and application. Biocatal. Biotransform. 2017;35:151–160. doi: 10.1080/10242422.2017.1308494. [DOI] [Google Scholar]
  • 16.Akoh C.C., Lee G.-C., Liaw Y.-C., Huang T.-H., Shaw J.-F. GDSL family of serine esterases/lipases. Prog. Lipid Res. 2004;43:534–552. doi: 10.1016/j.plipres.2004.09.002. [DOI] [PubMed] [Google Scholar]
  • 17.Ding J., Yu T., Liang L., Xie Z., Yang Y., Zhou J., Xu B., Li J., Huang Z. Biochemical Characterization of a GDSL-motif esterase from Bacillus sp. K91 with a new putative catalytic mechanism. J. Microbiol. Biotechnol. 2014;24:1551–1558. doi: 10.4014/jmb.1406.06056. [DOI] [PubMed] [Google Scholar]
  • 18.Sánchez-Barrionuevo L., Mateos J., Fernández-Puente P., Begines P., Fernández-Bolaños J.G., Gutiérrez G., Cánovas D., Mellado E. Identification of an acetyl esterase in the supernatant of the environmental strain Bacillus sp. HR21-6. Biochimie. 2022;198:48–59. doi: 10.1016/j.biochi.2022.03.004. [DOI] [PubMed] [Google Scholar]
  • 19.Aktayeva S., Khassenov B. High keratinase and other types of hydrolase activity of the new strain of Bacillus paralicheniformis. PLoS ONE. 2024;19:e0312679. doi: 10.1371/journal.pone.0312679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mussakhmetov A., Aktayeva S., Sarsen A., Daniyarov A., Khassenov B., Kairov U. Whole-Genome Sequence and Assembly of the Sporogenic Bacillus paralicheniformis T7 Strain with High Proteolytic and Amylolytic Activities. Front. Genet. 2026;17:1720096. doi: 10.3389/fgene.2026.1720096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Aktayeva S., Khassenov B. New Bacillus paralicheniformis strain with high proteolytic and keratinolytic activity. Sci. Rep. 2024;14:22621. doi: 10.1038/s41598-024-73468-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sanger F., Nicklen S., Coulson A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 1977;74:5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]
  • 24.Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 25.Zhao J., Ma M., Yan X., Zhang G., Xia J., Zeng G., Tian W., Bao X., Zeng Z., Yu P., et al. Expression and characterization of a novel lipase from Bacillus licheniformis NCU CS-5 for application in enhancing fatty acids flavor release for low-fat cheeses. Food Chem. 2022;368:130868. doi: 10.1016/j.foodchem.2021.130868. [DOI] [PubMed] [Google Scholar]
  • 26.Doran P.M. Chapter 12—Homogeneous Reactions. In: Doran P.M., editor. Bioprocess Engineering Principles. 2nd ed. Academic Press; London, UK: 2013. pp. 599–703. [Google Scholar]
  • 27.Akishev Z., Kiribayeva A., Mussakhmetov A., Baltin K., Ramankulov Y., Khassenov B. Constitutive expression of Camelus bactrianus prochymosin B in Pichia pastoris. Heliyon. 2021;7:e07137. doi: 10.1016/j.heliyon.2021.e07137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Katsimpouras C., Stephanopoulos G. Enzymes in biotechnology: Critical platform technologies for bioprocess development. Curr. Opin. Biotechnol. 2021;69:91–102. doi: 10.1016/j.copbio.2020.12.003. [DOI] [PubMed] [Google Scholar]
  • 29.Chandra P., Enespa, Singh R., Arora P.K. Microbial lipases and their industrial applications: A comprehensive review. Microb. Cell Factories. 2020;19:169. doi: 10.1186/s12934-020-01428-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bornscheuer U.T. Microbial carboxyl esterases: Classification, properties and application in biocatalysis. FEMS Microbiol. Rev. 2002;26:73–81. doi: 10.1111/j.1574-6976.2002.tb00599.x. [DOI] [PubMed] [Google Scholar]
  • 31.Kovacic F., Babic N., Krauss U., Jaeger K.-E. Classification of Lipolytic Enzymes from Bacteria. In: Rojo F., editor. Aerobic Utilization of Hydrocarbons, Oils, and Lipids. Springer International Publishing; Cham, Switzerland: 2019. pp. 255–289. [Google Scholar]
  • 32.Yu T., Ding J., Zheng Q., Han N., Yu J., Yang Y., Li J., Mu Y., Wu Q., Huang Z. Identification and characterization of a new alkaline SGNH hydrolase from a thermophilic bacterium Bacillus sp. K91. J. Microbiol. Biotechnol. 2016;26:730–738. doi: 10.4014/jmb.1507.07101. [DOI] [PubMed] [Google Scholar]
  • 33.Zhang W., Xu H., Wu Y., Zeng J., Guo Z., Wang L., Shen C., Qiao D., Cao Y. A new cold-adapted, alkali-stable and highly salt-tolerant esterase from Bacillus licheniformis. Int. J. Biol. Macromol. 2018;111:1183–1193. doi: 10.1016/j.ijbiomac.2018.01.152. [DOI] [PubMed] [Google Scholar]
  • 34.Zheng J.Y., Wang J., Zhou S.S., Li X.J., Ying X.X., Wang Z. A stereoselective esterase from Bacillus megaterium: Purification, gene cloning, expression and catalytic properties. Protein Expr. Purif. 2017;136:66–72. doi: 10.1016/j.pep.2015.10.001. [DOI] [PubMed] [Google Scholar]
  • 35.Ding J., Wang C., Xie Z., Li J., Yang Y., Mu Y., Tang X., Xu B., Zhou J., Huang Z. Properties of a newly identified esterase from Bacillus sp. K91 and its novel function in diisobutyl phthalate degradation. PLoS ONE. 2015;10:e0119216. doi: 10.1371/journal.pone.0119216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Schmidt M., Henke E., Heinze B., Kourist R., Hidalgo A., Bornscheuer U.T. A versatile esterase from Bacillus subtilis: Cloning, expression, characterization, and its application in biocatalysis. Biotechnol. J. 2007;2:249–253. doi: 10.1002/biot.200600174. [DOI] [PubMed] [Google Scholar]
  • 37.D’Auria S., Herman P., Lakowicz J.R., Tanfani F., Bertoli E., Manco G., Rossi M. The esterase from the thermophilic eubacterium Bacillus acidocaldarius: Structural-functional relationship and comparison with the esterase from the hyperthermophilic archaeon Archaeoglobus fulgidus. Proteins. 2000;40:473–481. doi: 10.1002/1097-0134(20000815)40:3<473::AID-PROT140>3.0.CO;2-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Manco G., Adinolfi E., Pisani F.M., Ottolina G., Carrea G., Rossi M. Overexpression and properties of a new thermophilic and thermostable esterase from Bacillus acidocaldarius with sequence similarity to hormone-sensitive lipase subfamily. Biochem. J. 1998;332:203–212. doi: 10.1042/bj3320203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ribera J., Estupiñán M., Fuentes A., Fillat A., Martínez J., Diaz P. Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past. PLoS ONE. 2017;12:e0181029. doi: 10.1371/journal.pone.0181029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Soumya P., Kochupurackal J. Pineapple peel extract as an effective substrate for esterase production from Bacillus subtilis E9. Curr. Microbiol. 2020;77:3024–3034. doi: 10.1007/s00284-020-02073-5. [DOI] [PubMed] [Google Scholar]
  • 41.Zheng J., Lan X., Huang L., Zhang Y., Wang Z. Kinetic resolution of N-acetyl-DL-alanine methyl ester using immobilized Escherichia coli cells bearing recombinant esterase from Bacillus cereus. Chirality. 2018;30:907–912. doi: 10.1002/chir.22863. [DOI] [PubMed] [Google Scholar]
  • 42.Ateşlier Z.B.B., Metin K. Production and partial characterization of a novel thermostable esterase from a thermophilic Bacillus sp. Enzym. Microb. Technol. 2006;38:628–635. doi: 10.1016/j.enzmictec.2005.07.015. [DOI] [Google Scholar]
  • 43.Charoenpanich J., Soongrung T., Chinnasri S., Suebchuea N., Suppoontong M., Thiemsawait S. A novel broad-temperature active and solvent stable esterase from a newly isolated Bacillus aerophilus. Biocatal. Agric. Biotechnol. 2018;13:116–122. doi: 10.1016/j.bcab.2017.12.004. [DOI] [Google Scholar]
  • 44.Meghji K., Ward O.P., Araujo A. Production, purification, and properties of extracellular carboxyl esterases from Bacillus subtilis NRRL 365. Appl. Environ. Microbiol. 1990;56:3735–3740. doi: 10.1128/aem.56.12.3735-3740.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Liang W., Xiong T., Wang X., Deng H., Bai Y., Fan T.P., Zheng X., Cai Y. A novel feruloyl esterase with high rosmarinic acid hydrolysis activity from Bacillus pumilus W3. Int. J. Biol. Macromol. 2020;161:525–530. doi: 10.1016/j.ijbiomac.2020.06.038. [DOI] [PubMed] [Google Scholar]
  • 46.Asoodeh A., Ghanbari T. Characterization of an extracellular thermophilic alkaline esterase produced by Bacillus subtilis DR8806. J. Mol. Catal. B Enzym. 2013;85–86:49–55. doi: 10.1016/j.molcatb.2012.08.013. [DOI] [Google Scholar]
  • 47.Huang L., Meng D., Tian Q., Yang S., Deng H., Guan Z., Cai Y., Liao X. Characterization of a novel carboxylesterase from Bacillus velezensis SYBC H47 and its application in degradation of phthalate esters. J. Biosci. Bioeng. 2020;129:588–594. doi: 10.1016/j.jbiosc.2019.11.002. [DOI] [PubMed] [Google Scholar]
  • 48.Sharma T., Kanwar S., Sharma A. Purification and characterization of an extracellular high molecular mass esterase from Bacillus pumilus. J. Adv. Biotechnol. Bioeng. 2016;4:9–16. doi: 10.12970/2311-1755.2016.04.01.2. [DOI] [Google Scholar]
  • 49.Liu P., Guo J., Miao L., Liu H. Enhancing the secretion of a feruloyl esterase in Bacillus subtilis by signal peptide screening and rational design. Protein Expr. Purif. 2022;200:106165. doi: 10.1016/j.pep.2022.106165. [DOI] [PubMed] [Google Scholar]
  • 50.Zhu Y., Zheng W., Ni H., Liu H., Xiao A., Cai H. Molecular cloning and characterization of a new and highly thermostable esterase from Geobacillus sp. JM6. J. Basic Microbiol. 2015;55:1219–1231. doi: 10.1002/jobm.201500081. [DOI] [PubMed] [Google Scholar]
  • 51.Jo E., Kim J., Lee A., Moon K., Cha J. Identification and characterization of a novel thermostable GDSL-type lipase from Geobacillus thermocatenulatus. J. Microbiol. Biotechnol. 2021;31:483–491. doi: 10.4014/jmb.2012.12036. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Biology are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES