Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Feb 15;68(2):e70045. doi: 10.1111/dgd.70045

Characterization of Heat Shock Protein Expression and Its Application to Temporal Gene Expression in the Nematode Pristionchus pacificus

Yuuki Ishita 1, Hirokuni Hiraga 2, Takahiro Chihara 2,3, Misako Okumura 2,3,
PMCID: PMC12907538  PMID: 41693093

ABSTRACT

Temporal gene expression systems are widely used to examine gene functions at specific developmental stages. The heat‐inducible gene expression system, which uses a heat shock promoter with evolutionarily conserved heat shock elements, is used in temporal gene expression systems in many organisms. The nematode, Pristionchus pacificus, is a satellite model system comparable to Caenorhabditis elegans, with unique developmental traits but lacking genetic tools for assessing temporal gene expression. To establish a temporal gene expression system in P. pacificus , we investigated the genes that were highly induced by heat shock. RNA‐sequencing analysis revealed many differentially expressed genes after a 2‐h heat shock event. One of the highly induced genes, PPA12242, is an ortholog of C. elegans hsp‐16.41, and transgenic animals harboring a reporter system have shown that the genomic fragment upstream of this gene can induce gene expression in response to heat shock. Using the PPA12242 promoter, gene expression can be induced at all larval stages, and some phenotypes appear to be vulnerable to heat stress. Taken together, we identified a potential heat shock promoter in P. pacificus that is applicable to the temporal gene expression system of this species.

Keywords: heat shock protein, heat‐inducible gene expression, Pristionchus pacificus, temporal gene expression, transcriptome analysis

1. Introduction

Temporal gene expression systems are powerful tools for investigating gene functions at specific developmental stages in genetic model organisms. Over the past several decades, various methods for temporal gene expression and suppression have been developed, including RNA interference, recombinase‐based expression systems, Tet‐ON/OFF systems, and Gal4‐UAS systems (see Driesschaert et al. (2021) for a review). Using these techniques, the developmental roles of numerous genes have been examined not only in model systems but also in non‐model organisms (Abete‐Luzi et al. 2020; Hari et al. 2012; Lee and Luo 1999; Pavlopoulos et al. 2009; Watanabe et al. 2007).

Heat‐inducible gene expression systems are one of the most widely used temporal gene expression systems. This system utilizes a heat shock promoter containing repeats of evolutionarily conserved heat shock elements with the NGAAN and NTTCN motifs (Amin et al. 1988). Upon heat stress, the HSF1 transcription factor binds to tandem repeats of heat shock elements, and stress‐induced genes, such as those encoding molecular chaperones, are transcribed. Since the first report of the Drosophila hsp70 gene (Pelham 1982), heat shock promoters have been identified and utilized for heat‐inducible gene expression in model organisms and some non‐model organisms (Kawaguchi et al. 2015; Schinko et al. 2012; Xing et al. 2017).

The nematode, Pristionchus pacificus, is a satellite model nematode comparable to Caenorhabditis elegans , a classical model for studies on animal genetics (Sommer et al. 1996). With an apparent association with insects in the wild, numerous strains of this species, as well as over 40 new species of the same genus, have been discovered in the past few decades (Kanzaki et al. 2021). Since this species was first described in 1996 (Sommer et al. 1996), various genetic tools have been developed, including forward and reverse genetics, transgenic reporter lines, genetic cell ablation, and inhibition of neuronal transmission (Han et al. 2020; Nakayama et al. 2020, 2024; Okumura et al. 2017; Rödelsperger et al. 2017; Schlager et al. 2009; Witte et al. 2015). Using these tools, the genetic mechanisms underlying various interesting features of this nematode have been characterized, such as the convergent evolution of vulval morphology, developmental plasticity of the mouth, evolution of predatory feeding behavior and associated mouth structure, kin recognition, and chemosensory and photosensory behaviors (Bento et al. 2010; Ishita et al. 2023; Lightfoot et al. 2019; Manabe et al. 2025; Nakayama et al. 2024; Okumura et al. 2017; Ragsdale et al. 2013; Rudel et al. 2008). Although this species can be manipulated genetically as a satellite model, no temporal expression tools have been developed.

In this study, we characterized heat‐inducible genes in P. pacificus . RNA‐sequencing (RNA‐seq) analysis revealed that many genes were induced in response to heat stress. Among these genes, the orthologs of C. elegans heat shock protein‐coding genes, which are highly divergent in P. pacificus , were dramatically upregulated. Using the upstream regulatory region of one of these genes, we developed a heat‐inducible gene expression system.

2. Materials and Methods

2.1. Nematode Strains and Culture Condition

The worm strains were cultured under standard culturing conditions (Stiernagle 2006) at 20°C or 15°C in the dark (Stiernagle 2006). The following strains were used in this study: P. pacificus wild type strain (PS312), MOK235: PS312; Ex[PPA12242p::FLP::T2A::TurboRFP, Ppa‐egl‐20p::GFP] (excbh48), MOK236: PS312; Ex[PPA38778p::FLP::T2A::TurboRFP, Ppa‐egl‐20p::GFP] (excbh49). For convenience, shorter transgene names are used for the transgenic strains PPA12242p::TurboRFP for MOK235 and PPA38778p::TurboRFP for MOK236.

2.2. Heat Shock Conditions

The worms were placed on a 35‐mm NGM plate seeded with Escherichia coli OP50. The plates were then placed in an incubator at desired temperatures. In the experiments not mentioned specifically, the following sequence of heat shock conditions were used: 34°C, 1 h; 20°C, 1 h; 34°C, 1 h. For fluorescence imaging, the worms were placed on agar pads (see Fluorescence Imaging) 2 h after the last heat shock event.

2.3. RNA Sequencing

Three 60‐mm NGM plates with mixed‐stage worms were placed in a 34°C incubator for 2 h. After heat shock, the worms were washed with M9 buffer three times and frozen at −80°C. Worms without heat shock were used as control samples. Total RNA was purified using the RNeasy mini kit (Qiagen, Hilden, Germany, 74,104), and RNA‐sequencing libraries were prepared by BGI (Shenzhen, China) using the protocol for DNBSEQ eukaryotic strand‐specific mRNA library preparation. RNA sequencing was performed using the BGI and DNBSEQ platforms. Adapter sequences and low‐quality reads were trimmed from the raw data. This was performed by BGI using SOAPnuke (Chen et al. 2018), followed by further trimming with Trim‐Galore v0.6.6 (https://github.com/FelixKrueger/TrimGalore). The trimmed reads were then mapped to the El Paco genome assembly (Rödelsperger et al. 2017) using HISAT2 v2.2.1 (Kim et al. 2019) with the ‐dta option. The mapped data were converted to BAM format and indexed using SAMtools v1.16 (Li and Durbin 2009). Read counts were generated using StringTie v2.1.2, with the ‐e and ‐B options (Kovaka et al. 2019) based on a modified version of the El Paco V3 gene annotations, as described below. The resulting CTAB files were converted to a gene count matrix in CSV format using the prepDE.py3 script (https://ccb.jhu.edu/software/stringtie/dl/prepDE.py3). Normalization and identification of differentially expressed genes (DEGs) were performed using TCC‐GUI (Su et al. 2019) with R v4.4.1 using the following parameters: norm.method = “deseq2”, test.method = “edger”, iteration = 3, false discovery rate (FDR) = 0.05, and floorPDEG = 0.05.

2.4. Restoration of Missing 3′ UTRs in a Reference Gene Annotation

The latest P. pacificus gene annotation, El Paco V3, incorporates extensive community‐driven manual curation (Athanasouli et al. 2020; Rödelsperger et al. 2019) and contains 28,896 protein‐coding genes; however, 22,741 (78.7%) of these models lack an annotated 3′ untranslated region (3′ UTR). To restore the missing 3′ UTRs, information from three previously published annotations that share the same El Paco genomic coordinates and include 3′ UTRs were transferred: El Paco V1 (Rödelsperger et al. 2017), a strand‐specific transcriptome assembly (Rödelsperger et al. 2016), and an Iso‐Seq assembly (Werner et al. 2018). For each El Paco V3 transcript lacking a 3′ UTR, the genomic coordinates of its terminal coding sequence (CDS) in the GFF3 file acted as a lookup key. This key was used to query the three source annotations for transcripts with an exactly matching terminal CDS, and their associated 3′ UTRs were retrieved. When multiple candidates were identified for a single gene, the longest candidate was provisionally selected. The provisional 3′ UTR was then examined for overlap with other El Paco V3 gene models on the same chromosome. If no overlap was detected, the 3′ UTR was integrated into the El Paco V3 annotation without modification. If overlap was present, all candidate 3′ UTRs were pooled and each was trimmed exon‐by‐exon to remove segments intersecting another gene. The longest trimmed fragment was integrated into the El Paco V3 annotation. When trimming eliminated all candidates, the minimum necessary intersection was permitted by appending only the first exon of the candidate 3′ UTR with the least overlap. This procedure produced a consolidated set of 3′ UTR annotations while preserving the structural integrity of the existing El Paco V3 gene models.

2.5. Phylogenetic Tree of h sp‐16 Orthologs

Orthologs of hsp‐16 in P. pacificus were identified from the P. pacificus El Paco V3 gene annotation (Athanasouli et al. 2020), and the amino acid sequences were retrieved from Pristionchus.org (http://pristionchus.org). Amino acid sequences were aligned using MAFFT v7.525 (Katoh and Standley 2013), and a maximum likelihood tree was generated using raxmlGUI 2.0 (Edler et al. 2021). The tree was visualized using FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/).

2.6. Transgenic Strain Generation

To generate reporter lines for PPA38778 and PPA12242, the genomic regions upstream of the predicted start codons of these genes (5111 bp for PPA38778 and 1575 bp for PPA12242) were amplified using polymerase chain reaction (PCR) and cloned into a plasmid containing Pristionchus‐optimized FLP, T2A sequence, and Pristionchus‐optimized TurboRFP, which was linearized with FastDigest SmaI (ThermoFisher, Waltham, Massachusetts, United States, FD0663) using NEBuilder (NEB, Ipswich, Massachusetts, United States, E2621). The following primers were used to amplify promoter sequences for plasmid construction: PPA12242p, forward: 5′‐tgcctgcaggtcgacgtcccTAAATGTTCCTAATCTTGTTCTCATG‐3′, reverse: 5′‐actggggcatctgaaaacccTAGAGAGGGTGTACGGTAGTTC‐3′; PPA38778p, forward: 5′‐tgcctgcaggtcgacgtcccCAAATGAAATAGAGAGTCACCATATTTC‐3′, reverse: 5′‐actggggcatctgaaaacccTGTAGACAGCAATCGGTAGC‐3′ (Uppercase, complementary bases to each locus; lowercase, homology arms for the Gibson Assembly reaction). The plasmids linearized with FastDigest HindIII (ThermoFisher, Waltham, Massachusetts, United States, FD0504) (1–2 ng/μL) were injected into young adult hermaphrodites together with genomic DNA (60 ng/μL) and injection marker plasmid pZH008 (5 ng/μL) (Han et al. 2020) digested with the same enzyme. The F1 progeny were screened using a fluorescence stereoscope (Leica, Wetzlar Germany, M165 FC).

2.7. Fluorescence Imaging

The transgenic animals were placed on 2% agar pads. For immobilization, 2–5 μL of 5 mM levamisole hydrochloride (Fujifilm, Tokyo, Japan, 123–04641) was dropped onto the agar pads. Levamisole was used because sodium azide induces the expression of heat shock proteins in nematodes, as previously reported for C. elegans (Massie et al. 2003). Z‐stack images of the worms were acquired using a laser scanning microscope (Carl Zeiss, Oberkochen, Germany, LSM 900) and the Zen software. The mean fluorescence intensity of the whole body was calculated for each Z slice using the Fiji software v2.9.0 (Schneider et al. 2012) for each individual, following which the mean of the fluorescence intensities in all slices for individuals was calculated. The same laser intensity and gain conditions were used for all experiments. Original image data are available upon request.

2.8. Quantitative Reverse Transcription PCR (qRT‐PCR)

Fifty transgenic young adult animals were manually picked under a fluorescence stereoscope (Carl Zeiss, Oberkochen, Germany, SteREO Discovery.V20) and transferred to a 35‐mm NGM plate, where they subsequently underwent heat shock treatment. The worms were then collected in 1.5‐mL tubes, and total RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany, 74104). cDNA was synthesized using a PrimeScriptTM RT reagent kit with gDNA eraser (Perfect Real Time) (Takara Bio, Kusatsu, Japan, RR047A). qRT‐PCR was performed with a Thermal Cycler Dice Real Time System III (Takara Bio, Kusatsu, Japan, TP950) and Luna Universal qPCR master mix (NEB, Ipswich, Massachusetts, United States, M3003) with the following primers: for Ppa‐gpd‐3, 5′‐CTCTTCAACTACGACTCGACC‐3′ and 5′‐GACAACGTACTCGGCTCC‐3′; for TurboRFP, 5′‐CAAGGTGGTGGAGGGAG‐3′ and 5′‐CCTGAGTATGATTGATGAAAGCC‐3′. Three technical and three biological replicates were examined for each gene. Because of the inclusion of three housekeeping genes for qPCR in P. pacificus (Schuster & Sommer, 2012) as DEGs in the RNA‐seq analysis, Ppa‐gpd‐3 (PPA12783), a GAPDH ortholog that was not identified as a DEG, was used as a reference gene.

2.9. Larval Growth Assay

For synchronization of worm developmental stages, twenty 2‐day adult hermaphrodites were placed on the plates and allowed to lay eggs for 2 h at 20°C. After removing the adult animals, the number of eggs on each plate was counted, and the plates were placed at 15°C. In our experiments, the worms grew into comma‐stage embryos and J2, J3, and J4 larvae 20, 75, 98, and 138 h after laying eggs, respectively. Therefore, we treated the worms with the “double heat shock,” as mentioned previously at that time point. Two hundred and twenty hours after egg laying, the developmental stages of the worms were examined using a stereoscope (Carl Zeiss, Oberkochen, Germany, SteREO Discovery.V20). The survival rate was calculated by dividing the number of worms alive at this time point on each plate by the number of eggs at 0 h on the same plate. The number of eggs per plate ranged from 41 to 84.

2.10. Corpse Assay

The corpse assay was performed at 20°C as described previously (Wilecki et al. 2015). C. elegans victims were collected from freshly starved NGM plates and filtered through double 20 μm nylon mesh (Merck Millipore, Burlington, Massachusetts, United States, NY2004700). The worms were washed three times, and 2 μL of the worm pellet was placed on empty 6‐cm NGM plates. Five P. pacificus adult hermaphrodites from day 1 to day 2 were placed on plates containing C. elegans larvae for 2 h. The mouth form of the predators was examined after the assay, and the number of corpses per eurystomatous animal was calculated by dividing the number of corpses per plate by the number of eurystomatous animals in the plate. The experiments were performed for at least two separate days.

2.11. Body Bending Assay

Young adult hermaphrodite animals at day 1 were loaded into a 96‐well plate with 100 μL of M9 buffer. The number of body bends occurring per 10 s was counted. A single body‐bending event was defined as a full wave‐like movement of the worm body such that both the head and tail returned to the same side of the body axis as they were at the initial time point. Body bending was measured three times per individual, and the average of body‐bending events was used for statistical analysis. The experiments were performed at 20°C for at least two separate days.

2.12. Mouth‐Form Ratio

The mouth‐form ratio was determined as described previously (Ragsdale et al. 2013). Briefly, animals on day 2 to day 3 were anesthetized with 0.3% sodium azide and their mouth form was observed at 400× magnification using a DIC microscope (Carl Zeiss, Oberkochen, Germany, Pascal).

2.13. Statistical Analysis

R software and Microsoft Excel were used for statistical analyses. The types of statistical tests, significance symbols, and N numbers are presented in the figure legends.

3. Results

3.1. Heat Induced Changes in Gene Expression

To identify genes highly induced by heat shock in P. pacificus , we performed RNA‐sequencing analysis and compared the global expression levels of genes under normal and heat shock conditions. As heat‐mediated induction of gene expression was successful at 34°C for 1 h or at 33°C for 2 h in C. elegans (Davis et al. 2008; Hubbard 2014; Voutev and Hubbard 2008), we used heat shock conditions similar to the ones used for C. elegans (34°C for 2 h) in our RNA‐seq study. To improve the accuracy of read count quantification using the current version of gene annotation (El Paco V3 annotation) (Athanasouli et al. 2020), in which many genes lack annotated 3′ UTRs, we generated a modified annotation file by extending the 3′ UTRs using three previously published annotation files (see Section 2.4). Comparison of gene expression between control samples and heat‐shocked animals revealed that as many as 7815 genes were differentially expressed between the groups under conditions of 5% FDR (Figure 1A).

FIGURE 1.

FIGURE 1

Twelve orthologs of hsp‐16 were induced upon heat shock. (A) MA plot of the RNA‐seq data showing global gene expression of control and heat‐shocked animals. Genes that were significantly upregulated or downregulated are highlighted in red (FDR‐adjusted p < 0.05). HSP orthologs ranked within the top 10 DEGs are highlighted with gray squares. (B) Heatmap representing the normalized read counts of 12 orthologs of hsp‐16 found in the P. pacificus genome. (C) Unrooted phylogenetic tree of hsp‐16 paralogs found in P. pacificus and C. elegans . The genes in P. pacificus and C. elegans are shown in red and blue, respectively. The bottom tree is a magnified tree of genes enclosed in a dashed rectangle.

3.2. Orthologs of h sp‐16 Were Upregulated in Response to Heat

The top ten DEGs included three genes orthologous to small heat shock protein‐coding genes in C. elegans (Table 1). Two of them (PPA38778 and PPA12242) encode orthologs of hsp‐16.41, the promoter of which is used for ubiquitous gene induction by heat shock in C. elegans (Voutev and Hubbard 2008). In the current version of the gene annotation for P. pacificus (Athanasouli et al. 2020), we found 12 paralogs of hsp‐16 in the P. pacificus genome, all of which were robustly upregulated upon heat shock (Figure 1B). To identify one‐to‐one orthologs of hsp‐16 genes in C. elegans , we constructed a maximum likelihood tree using the protein sequences of hsp‐16 orthologs in P. pacificus and C. elegans (Figure 1C). The C. elegans genome harbors six hsp‐16 paralogs (hsp‐16.1, hsp‐16.2, hsp‐16.11, hsp‐16.41, hsp‐16.48, and hsp‐16.49) encoding four distinct polypeptides (HSP‐16.1, HSP‐16.2, HSP‐16.41, HSP‐16.49); hsp‐16.1 and hsp‐16.11 encode the same polypeptide (HSP‐16.1), while hsp‐16.48 and hsp‐16.49 encode HSP‐16.49. The hsp‐16 genes clustered within the species and one‐to‐one orthologs of hsp‐16 genes between C. elegans and P. pacificus appeared to be missing. All but one of the 12 paralogs in P. pacificus had very short branch lengths, suggesting that these paralogs arose rapidly during evolution.

TABLE 1.

Top ten DEGs upregulated upon heat shock.

Rank Gene name C. elegans ortholog Pfam domains
1 PPA02457 dpy‐5_best Collagen, Col_cuticle_N
2 PPA38778 hsp‐16.41_best HSP20, ArsA_HSP20
3 ppa_stranded_DN24775_c0_g2_i1 cdr‐6_BRH GST_C_2, GST_C_6, GST_N_4
4 ppa_stranded_DN19351_c0_g2_i1 cdr‐2_best GST_C, GST_C_2, GST_C_6, GST_N_4
5 PPA12242 hsp‐16.41_best HSP20
6 ppa_stranded_DN16198_c0_g1_i1 cyp‐33C5_BRH p450
7 PPA42171 col‐3_best Collagen, Col_cuticle_N
8 PPA40518 col‐3_best Collagen, Col_cuticle_N
9 PPA14013 hsp‐25_best HSP20
10 PPA33590 col‐3_best Collagen, Col_cuticle_N

3.3. The PPA12242 Promoter Induced Gene Expression Upon Heat Shock Treatment

RNA‐seq data revealed that PPA38778 and PPA12242 were robustly expressed under heat shock conditions, while they were negligibly expressed at normal culture temperatures; therefore, we generated transgenic lines expressing the TurboRFP reporter under the promoter of PPA38778 or PPA12242. We examined RFP expression in animals carrying transgenes with or without heat shock.

In the PPA12242p::TurboRFP strain, normal culturing temperature (20°C) resulted in the expression of the RFP reporter in some of the head and tail neurons, as well as in nonneuronal cells in the head (Figure S1A). To reduce the leaky expression of transgenes, we cultured the transgenic animals at 15°C, which is lower than the standard culture temperature (Stiernagle 2006). This temperature lowered RFP expression, and only one pair of head neurons expressed RFP (Figure S1B). Therefore, we used this growth temperature for subsequent analyses.

Unexpectedly, the RFP signal was not visible in PPA12242p::TurboRFP animals after 2 h of heat shock at 34°C, which was used for the RNA‐seq analysis (Figure S1C). To examine whether the PPA12242 promoter induced TurboRFP mRNA expression, we performed qPCR on the PPA12242p::TurboRFP strain. This heat shock condition induced mRNA expression by up to 100‐fold compared to that observed in the absence of heat shock, suggesting that this promoter sequence and the heat shock condition can upregulate Turbo RFP at the transcriptional level but are insufficient at the translational level (Figure S1D). Therefore, we attempted to determine the optimal heat shock conditions for the efficient induction of genes using the PPA12242 promoter. We examined the effects of higher temperatures, multiple heat shock events, preheat and heat shock events, and sodium azide treatment, which is known to induce heat shock proteins in C. elegans without heat shock (Massie et al. 2003) (Figure S1E). Among the conditions used, the “double heat shock” condition with two heat shock events at 34°C for 1 h each separated by 1 h of cooling at 20°C worked well (Figure 2A–C); mean RFP fluorescence level was 6.36 times higher than the basal level of fluorescence, which was derived from autofluorescence in the intestine (Figure S1E).

FIGURE 2.

FIGURE 2

Heat shock conditions and expression patterns of RFP under the PPA12242 promoter following heat shock. (A) Schematic representation of the heat shock treatment schedule. (B, C) Maximum projection images of PPA12242p::TurboRFP on day 1 adult. RFP fluorescence was not obvious in the worms cultured at 15°C (B) but was found in the heat‐shocked animals (C). Scale bars, 50 μm. (D) Schematic representation of the heat shock treatment schedule for exploring the minimal heat shock temperature and duration. Note that we used J4 animals for this experiment, as worms at this stage have been demonstrated to show higher RFP expression than young adults. (E) Quantification of fluorescence intensity in PPA12242p::TurboRFP J4 animals at various heat shock temperatures and durations. For the no‐heat‐shock condition, n = 10. For 26°C, 60 min condition, n = 10. For 30°C condition, n = 19, 20, and 10 for 15 min, 30 min, and 60 min, respectively. For 34°C, n = 12, 11, and 30 for 15 min, 30 min, and 60 min, respectively. Two‐way analysis of variance (ANOVA) with Tukey's multiple comparison test. ns p ≥ 0.05. *p < 0.05. ***p < 0.001. (F–K) Single‐plane images of PPA12242p::TurboRFP animals. Images are shown for planes focusing on the left side (F–H) and the center (I–K) of the worms, including whole‐body view (F, I), head regions (G, J), and tail regions (H, K). Magnifications of 200× and 400× were used for (F, I) and (G, H, J, K), respectively. Scale bars: 50 μm and 20 μm for (F, I) and (G, H, J, K), respectively. This animal is the same as that shown in Figure 2C.

We also examined the minimum temperature and duration of double heat shock required for RFP induction in PPA12242p::TurboRFP animals. We tested double heat shock conditions with three heat shock durations (15 min, 30 min, and 60 min) at three different temperatures (26°C, 30°C, and 34°C) (Figure 2D). No RFP induction was observed under the 26°C for 60 min condition (Figure 2E). In contrast, double heat shock at 30°C for more than 15 min induced detectable RFP expression, and the induction level correlated positively with heat shock duration (Figure 2E). Although the induction level did not differ significantly between 30°C and 34°C under the 60 min condition, we observed several individuals showing markedly higher RFP expression at 34°C. Therefore, we used 34°C for subsequent analyses.

Next, we investigated the tissues that could be induced to express the reporter through heat shock‐mediated activation of the PPA12242 promoter. Heat shock events induced RFP expression in most tissues in PPA12242p::TurboRFP young adult hermaphrodites, including vulval tissues, hypodermis, head neurons including amphid neurons, tail neurons, and pharyngeal muscles; however, the germline cells did not express RFP (Figure 2F–K). Taken together, these results indicated that the PPA12242 promoter can be used as a heat shock promoter in P. pacificus .

In the PPA38778p::TurboRFP strain, the RFP fluorescence level increased by approximately twofold under the heat shock condition (34°C, 1 h + 1 h) compared with that observed in the 15°C control group (Figure S2A–C). However, this increase was markedly smaller than that observed in the PPA12242p::TurboRFP strain. Importantly, the LSM images showed fluorescence only in the intestine under both conditions, a pattern similar to that observed in non‐transgenic animals. Consistent with this, TurboRFP mRNA levels did not increase under heat shock conditions (Figure S2D). Taken together, these results indicate that the fluorescence observed in this strain possibly reflects autofluorescence rather than heat shock‐induced TurboRFP expression; therefore, the upstream sequence of PPA38778 does not function sufficiently as a heat shock promoter.

3.4. PPA12242 Was Expressed Intensely in Larval Stages

Next, to validate the use of the PPA12242 promoter at various developmental stages, we examined the expression of RFP in PPA12242p::TurboRFP animals at three larval stages, together with the young adult stage (Figure 3A,B). Compared to the mean fluorescence intensity across animals, RFP expression was strongly induced at all larval stages, whereas adults showed induction at a lower level (Figure 3B). In J3 animals, the RFP signal was obvious in most tissues, except in germline precursor cells, which are generally inactive for transgene expression (Figure 3C). In J4 animals, RFP expression was high in developing tissues, including the vulva, hypodermal tissue, arcade cells, and pharyngeal muscles (Figure 3A). These results indicated that the PPA12242 promoter can be used at larval and adult stages.

FIGURE 3.

FIGURE 3

Expression patterns of RFP under the PPA12242 promoter following heat shock during each developmental stage. (A) Maximum projection images of PPA12242p::TurboRFP animals at different developmental stages before (upper panels) and after (lower panels) heat shock treatment. Scale bars, 20 μm for J2 and J3 animals and 50 μm for J4 and adult animals. (B) Quantification of fluorescence intensity in PPA12242p::TurboRFP animals at different developmental stages before and after heat shock treatment. YA, young adult. For the no‐heat shock condition, n = 20, 15, 19, and 19 for J2, J3, J4, and YA, respectively. For the heat shock condition, n = 21, 19, 16, and 16 for J2, J3, J4, and YA, respectively. Two‐way analysis of variance (ANOVA) with Tukey's multiple comparison test. *p < 0.05. ****p < 0.0001. (C) Single‐plane image of PPA12242p::TurboRFP J3 animal after heat shock treatment, focusing on the central plane. Scale bar, 20 μm.

3.5. A Specific Larval Stage Was Vulnerable to Heat Stress

One major limitation of heat‐inducible gene expression systems is the deleterious effects of heat shock, which are stressful for organisms and can alter their physiological state. To assess whether heat shock affects development and behavior of P. pacificus , we examined several phenotypes after heat shock.

First, we examined the survival rate and developmental delay of the heat‐shocked animals. As the development is delayed by up to a week when P. pacificus is cultured at 15°C, we scheduled the heat shock event at 20, 75, 98, and 138 h after egg laying in the embryo and J2, J3, and J4 stages, respectively (Figure 4A). Among the animals that did not experience heat shock events, 88.9% of the animals survived 196 h after egg laying. The survival rate of the heat‐shocked animals at the J2 and J4 stages did not differ significantly from that of animals without heat shock. In contrast, heat shock events at the embryonic and J3 stages reduced the survival rates significantly. In particular, the survival rate decreased to 0.74% when the worms were heat‐shocked during the embryonic stage. This prevented characterization of the phenotypes in subsequent analyses (Figure 4B). This result differs from that of a previous study on C. elegans , which showed that the embryo of this species is highly tolerant to heat shock events owing to the protective effect of an embryonic heat shock protein (Fleckenstein et al. 2015).

FIGURE 4.

FIGURE 4

Phenotypic characterization of worms that experienced heat shock events during larval stages. (A) Schematic showing heat shock schedule and phenotyping. HS, heat shock. AEL, after egg laying. (B) Survival rates of wild type animals subjected to heat shock at each developmental stage. n = 20, 11, 12, 12, and 10 plates for the control (without heat shock), embryo, J2, J3, and J4 with heat shock, respectively. Kruskal–Wallis test with Steel's multiple comparison test. ns, p ≥ 0.05. ****p < 0.0001. (C) Proportions of developmental stages at 220 h after egg laying. The numbers in each column represent the proportion of each developmental stage (%). The proportions of each stage are shown in gray, light yellow, light orange, and orange for those younger than J3 (~ J3), J4, adults without eggs (adult (− eggs)), and adults with eggs (adult (+ eggs)), respectively. n = 197, 107, 78, and 90 for control (without heat shock), J2 HS, J3 HS, and J4 HS groups, respectively. Chi‐squared tests were used to compare each column with the control group. ****p < 0.0001. (D) Number of body bends per 10 s in the M9 buffer. n = 21, 12, 12, and 13 for control, J2 HS, J3 HS, and J4 HS groups, respectively. One‐way analysis of variance (ANOVA). ns, p ≥ 0.05. (E) Number of corpses per eurystomatous animal after 2 h of the corpse assay. n = 8 for all the heat shock conditions. One‐way ANOVA. ns, p ≥ 0.05. (F) Proportion of eurystomatous animals. n = 8, 6, 8, and 7 for control, J2 HS, J3 HS, and J4 HS groups, respectively. Data were analyzed using One‐way ANOVA with Dunnett's multiple comparison test. ns, p ≥ 0.05. ***p < 0.001.

We also examined whether heat shock delayed the developmental speed. Two hundred and twenty hours after egg laying, 97.5% of the control animals without any heat shock events grew to the adult stage, and 68.5% of them were reproductive adults. However, heat shock events during the larval stages delay development. For example, the proportion of individuals reaching the adult stage was 91.5%, 82.1%, and 84.4% for those who experienced heat shock during the J2, J3, and J4 stages, respectively (Figure 4C).

Next, we performed a body‐bending assay under liquid conditions to observe the locomotor activity of heat‐shocked animals. In C. elegans , locomotor behavior is commonly used to assess nervous system defects (Dimitriadi and Hart 2010; Hornsten et al. 2007; Li et al. 2016; Zhang and Chen 2023). The average number of body bends per 10 s was six in the control animals, which is consistent with the results of a previous report (Ishita et al. 2021). The heat‐shocked animals did not show significant alterations in the number of body bends (Figure 4D).

As mouth‐form dimorphism and predatory feeding behavior are unique and well‐characterized phenotypes of P. pacificus , we examined these traits in larvae subjected to heat shock. P. pacificus develops either a eurystomatous or a stenostomatous mouth form in an environmentally dependent manner during larval development, with predatory feeding behavior restricted to eurystomatous animals (Bento et al. 2010; Ragsdale et al. 2013; Wilecki et al. 2015). We used a corpse assay (Lightfoot et al. 2016; Wilecki et al. 2015) to measure predatory feeding events (See Section 2.10). In wild type animals, predatory killing within 2 h per eurystomatous animal was 18.1 on average (Figure 4E). The number of corpses per eurystomatous animal that were heat shocked during the larval stages did not differ significantly from that of control animals (Figure 4E), suggesting that predatory feeding behavior is refractory to heat shock events during the larval stages. However, in the case of the mouth‐form ratio, the specific larval stage was sensitive to heat shock events. The control PS312 animals exhibited more than 80% eurystomatous animals, consistent with that observed in previous studies (Ragsdale et al. 2013). Compared with the control animals, worms heat‐shocked at the J3 stage showed a decreased proportion of eurystomatous animals (54.5% on average) (Figure 4F). The mouth‐form ratios in animals that were heat‐shocked at stages J2 and J4 were not altered significantly.

Taken together, these data suggest that some developmental traits are vulnerable to heat shock events, especially during the J3 stage, but that other traits, including predatory feeding behavior and locomotor behavior, are refractory to developmental heat stress.

4. Discussion

Precise temporal control of gene expression is essential for understanding gene function at specific time points. This study established a temporal gene expression system induced by heat shock using a heat shock promoter, which is the first temporal expression system in P. pacificus . First, we identified genes that were upregulated in response to heat stress. In particular, we found that some heat shock protein orthologs are highly expressed upon heat shock, suggesting their functional conservation even after diversification. With a typical heat shock promoter structure, PPA12242 was induced by an artificial heat shock event, indicating the utility of this promoter as a heat‐inducible gene expression system. Phenotypic characterization of heat‐shocked animals revealed that some developmental traits were vulnerable to heat stress at specific developmental stages, whereas most of the tested traits did not show significant differences after short‐term heat shock events.

Heat shock proteins are encoded by a highly conserved gene family; however, some of them are duplicated in certain species (Gong and Golic 2004; Hu et al. 2022; Nikolaidis and Nei 2003; Obuchowski et al. 2019). In this study, we found that hsp‐16.41 paralogs were highly divergent in P. pacificus . RNA‐seq analysis indicated that all 12 paralogs were induced by heat treatment, suggesting the conservation of the heat‐protective function of these molecules. Transcriptional reporter analysis of the PPA12242 promoter suggested that the expression levels of this gene differed among cell types, whereas the heat shock response itself is required for all cell types. Other diverse orthologs may compensate for the expression of PPA12242 in other cell types, as explained for C. elegans hsp‐16.2 and hsp‐16.41 paralogs (Stringham et al. 1992).

Interestingly, some of the hsp‐16.41 paralogs did not have typical heat shock factor motifs with a TATA box upstream of their CDSs, although they were robustly induced by heat. The PPA38778 reporter showed no activation after heat shock treatment, suggesting that its expression may be regulated by elements other than the upstream promoter. In mammalian cells, most heat shock response genes are induced independently of heat shock factors and many are acutely induced by heat shock (Mahat et al. 2016). Although the exact mechanism underlying PPA38778's transcriptional activation was not clarified in this study, the heat induction mechanism characterized for other genes, such as that encoding the serum response factor transcription factor (Mahat et al. 2016), in combination with more distal elements or genome‐wide epigenetic changes, might be responsible for the induction of this gene.

Compared to that observed in other larval and young adult stages, heat stress at J3 stage increased lethality, suggesting that the J3 stage might be vulnerable to heat stress. This is comparable to the observations of a previous study in C. elegans , which showed that knockdown of heat shock factors induced developmental arrest in the L2/L3 stage when the worms were cultured at high temperatures (Walker et al. 2003). In P. pacificus , a heat shock event at the J3 stage also altered the mouth‐form ratio during the adult stage. This result is consistent with those of a previous report indicating that the critical period of mouth‐form determination is around J3–J4 molt in this species (Werner et al. 2023). Comparing transcriptomic changes induced by heat shock at the J3 stage with those observed under other heat shock conditions may help elucidate the molecular basis of these stage‐specific phenotypic effects.

Taken together, this study demonstrates heat‐inducible gene expression using an endogenous heat shock promoter in P. pacificus . Although this is one of the first examples of a conditional gene expression system in this species, it is not without limitations. First, leaky expression of genes with the heat shock promoter is inevitable in some cells, even at temperatures lower than standard culture conditions. Similar problems are often observed in other organisms; however, these can be improved by using additional gene regulatory elements, such as polycomb response elements (Akmammedov et al. 2017). Second, because heat stress disturbs many biological processes and affects the phenotypes of interest, including mouth‐form determination, alternative gene or protein expression strategies such as the Q system, Tet‐On/Off system, and GeneSwitch should also be developed for this species (Bello et al. 1998; Osterwalder et al. 2001; Potter et al. 2010). Third, the heat shock promoter used in this study did not induce gene expression in certain cell types. Expression in these cell types can be improved by using other heat shock promoters in combination with the PPA12242 promoter. However, for germline cells, alternative transgenic approaches, such as gene bombardment (Namai and Sugimoto 2018), and other regulatory strategies, including the use of PATC repeats found in C. elegans (Aljohani et al. 2020), are required. In addition, spatiotemporal control of gene expression can be achieved using spatial gene expression methods, including the FLP/FRT system in combination with promoters of specific cell types, or laser‐evoked gene expression methods such as IR‐LEGO, both of which are utilized in C. elegans (Davis et al. 2008; Kamei et al. 2009; Suzuki et al. 2022). Using these new genetic tools, the developmental stage‐specific functions of genes in this species can be unraveled, accelerating comparative genetic studies of model nematode systems.

Author Contributions

Conceptualization: Y.I. and M.O.; methodology: Y.I. and M.O.; investigation: Y.I., H.H., and M.O.; writing – original draft: Y.I.; writing – review and editing: H.H., T.C., and M.O.; supervision: T.C. and M.O.; funding acquisition: Y.I., H.H., and M.O. All authors have approved the final version of the manuscript.

Funding

This work was supported by Japan Science and Technology Agency (JPMJFR214M, JPMJSP2132), Mitsubishi Foundation, Narishige Zoological Science Award, Yamada Science Foundation, and Japan Society for the Promotion of Science (JP25K02318, 22J13816).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Optimization of culture and heat shock conditions.

Figure S2: RFP expression in the PPA38778p::TurboRFP strain.

DGD-68-0-s001.pdf (1MB, pdf)

Acknowledgments

We thank Dr. Ziduan Han and Dr. Ralf J Sommer (Max Planck Institute for Biology Tübingen) for providing the optimized fluorescent plasmids. We thank all members of the Chihara Laboratory (Hiroshima University) and Dr. Kohta Yoshida (Niigata University) for their support in this study. We would like to thank Editage (www.editage.jp) for English language editing. This work was supported by the JST FOREST Program (Grant Number JPMJFR214M); Research Grants in the Natural Sciences (The Mitsubishi Foundation), Narishige Zoological Science Award, Yamada Science Foundation, and JSPS KAKENHI (Grant Number JP 25K02318) to M.O.; JST SPRING (Grant Number JPMJSP2132) to H.H.; and JSPS Research Fellows (Grant Number 22J13816) to Y.I.

Ishita, Y. , Hiraga H., Chihara T., and Okumura M.. 2026. “Characterization of Heat Shock Protein Expression and Its Application to Temporal Gene Expression in the Nematode Pristionchus pacificus .” Development, Growth & Differentiation 68, no. 2: e70045. 10.1111/dgd.70045.

Data Availability Statement

All materials generated in this study, including plasmids, worm strains, and data relevant for this article, are available upon request from the corresponding author (okumuram@hiroshima-u.ac.jp). RNA‐sequencing data are available at https://www.ddbj.nig.ac.jp/index‐e.html and can be accessed using PRJDB35585.

References

  1. Abete‐Luzi, P. , Fukushige T., Yun S., Krause M. W., and Eisenmann D. M.. 2020. “New Roles for the Heterochronic Transcription Factor Lin‐29 in Cuticle Maintenance and Lipid Metabolism at the Larval‐To‐Adult Transition in Caenorhabditis elegans .” Genetics 214, no. 3: 669–690. 10.1534/genetics.119.302860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akmammedov, A. , Geigges M., and Paro R.. 2017. “Single Vector Non‐Leaky Gene Expression System for Drosophila melanogaster .” Scientific Reports 7, no. 1: 6899. 10.1038/s41598-017-07282-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aljohani, M. D. , El Mouridi S., Priyadarshini M., Vargas‐Velazquez A. M., and Frøkjær‐Jensen C.. 2020. “Engineering Rules That Minimize Germline Silencing of Transgenes in Simple Extrachromosomal Arrays in C. elegans .” Nature Communications 11, no. 1: 6300. 10.1038/s41467-020-19898-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Amin, J. , Ananthan J., and Voellmy R.. 1988. “Key Features of Heat Shock Regulatory Elements.” Molecular and Cellular Biology 8, no. 9: 3761–3769. 10.1128/mcb.8.9.3761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Athanasouli, M. , Witte H., Weiler C., et al. 2020. “Comparative Genomics and Community Curation Further Improve Gene Annotations in the Nematode Pristionchus pacificus .” BMC Genomics 21, no. 1: 708. 10.1186/s12864-020-07100-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bello, B. , Resendez‐Perez D., and Gehring W. J.. 1998. “Spatial and Temporal Targeting of Gene Expression in Drosophila by Means of a Tetracycline‐Dependent Transactivator System.” Development 125, no. 12: 2193–2202. 10.1242/dev.125.12.2193. [DOI] [PubMed] [Google Scholar]
  7. Bento, G. , Ogawa A., and Sommer R. J.. 2010. “Co‐Option of the Hormone‐Signalling Module Dafachronic Acid – DAF‐12 in Nematode Evolution.” Nature 466, no. 7305: 494–497. 10.1038/nature09164. [DOI] [PubMed] [Google Scholar]
  8. Chen, Y. , Chen Y., Shi C., et al. 2018. “SOAPnuke: A MapReduce Acceleration‐Supported Software for Integrated Quality Control and Preprocessing of High‐Throughput Sequencing Data.” GigaScience 7, no. 1: gix120. 10.1093/gigascience/gix120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Davis, M. W. , Morton J. J., Carroll D., and Jorgensen E. M.. 2008. “Gene Activation Using FLP Recombinase in C. elegans .” PLoS Genetics 4, no. 3: e1000028. 10.1371/journal.pgen.1000028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dimitriadi, M. , and Hart A. C.. 2010. “Neurodegenerative Disorders: Insights From the Nematode Caenorhabditis elegans .” Neurobiology of Disease 40, no. 1: 4–11. 10.1016/j.nbd.2010.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Driesschaert, B. , Mergan L., and Temmerman L.. 2021. “Conditional Gene Expression in Invertebrate Animal Models.” Journal of Genetics and Genomics 48, no. 1: 14–31. 10.1016/j.jgg.2021.01.005. [DOI] [PubMed] [Google Scholar]
  12. Edler, D. , Klein J., Antonelli A., and Silvestro D.. 2021. “raxmlGUI 2.0: A Graphical Interface and Toolkit for Phylogenetic Analyses Using RAxML.” Methods in Ecology and Evolution 12, no. 2: 373–377. 10.1111/2041-210X.13512. [DOI] [Google Scholar]
  13. Fleckenstein, T. , Kastenmüller A., Stein M. L., et al. 2015. “The Chaperone Activity of the Developmental Small Heat Shock Protein Sip1 Is Regulated by pH‐Dependent Conformational Changes.” Molecular Cell 58, no. 6: 1067–1078. 10.1016/j.molcel.2015.04.019. [DOI] [PubMed] [Google Scholar]
  14. Gong, W. J. , and Golic K. G.. 2004. “Genomic Deletions of the Drosophila melanogaster Hsp70 Genes.” Genetics 168, no. 3: 1467–1476. 10.1534/genetics.104.030874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Han, Z. , Lo W.‐S., Lightfoot J. W., Witte H., Sun S., and Sommer R. J.. 2020. “Improving Transgenesis Efficiency and CRISPR‐Associated Tools Through Codon Optimization and Native Intron Addition in Pristionchus Nematodes.” Genetics 216: 947–956. 10.1534/genetics.120.303785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hari, L. , Miescher I., Shakhova O., et al. 2012. “Temporal Control of Neural Crest Lineage Generation by Wnt/β‐Catenin Signaling.” Development (Cambridge) 139, no. 12: 2107–2117. 10.1242/dev.073064. [DOI] [PubMed] [Google Scholar]
  17. Hornsten, A. , Lieberthal J., Fadia S., et al. 2007. “APL‐1, a Caenorhabditis elegans Protein Related to the Human β‐Amyloid Precursor Protein, Is Essential for Viability.” Proceedings of the National Academy of Sciences of the United States of America 104, no. 6: 1971–1976. 10.1073/pnas.0603997104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hu, Z. , Song H., Feng J., and Zhou C.. 2022. “Massive Heat Shock Protein 70 Genes Expansion and Transcriptional Signatures Uncover Hard Clam Adaptations to Heat and Hypoxia.” Frontiers in Marine Science 9: 898669. 10.3389/fmars.2022.898669. [DOI] [Google Scholar]
  19. Hubbard, E. J. A. 2014. “FLP/FRT and Cre/Lox Recombination Technology in C. elegans .” Methods 68, no. 3: 417–424. 10.1016/j.ymeth.2014.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ishita, Y. , Chihara T., and Okumura M.. 2021. “Different Combinations of Serotonin Receptors Regulate Predatory and Bacterial Feeding Behaviors in the Nematode Pristionchus pacificus .” G3: Genes, Genomes, Genetics 11, no. 2: jkab011. 10.1093/g3journal/jkab011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ishita, Y. , Onodera A., Ekino T., Chihara T., and Okumura M.. 2023. “Co‐Option of an Astacin Metalloprotease Is Associated With an Evolutionarily Novel Feeding Morphology in a Predatory Nematode.” Molecular Biology and Evolution 40, no. 12: msad266. 10.1093/molbev/msad266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kamei, Y. , Suzuki M., Watanabe K., et al. 2009. “Infrared Laser – Mediated Gene Induction in Targeted Single Cells in Vivo.” Nature Methods 6, no. 1: 79–81. 10.1038/nmeth.1278. [DOI] [PubMed] [Google Scholar]
  23. Kanzaki, N. , Herrmann M., Weiler C., et al. 2021. “Nine New Pristionchus (Nematoda: Diplogastridae) Species From China.” Zootaxa 4943, no. 1: 1–66. 10.11646/zootaxa.4943.1.1. [DOI] [PubMed] [Google Scholar]
  24. Katoh, K. , and Standley D. M.. 2013. “MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability.” Molecular Biology and Evolution 30, no. 4: 772–780. 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kawaguchi, A. , Utsumi N., Morita M., Ohya A., and Wada S.. 2015. “Application of the Cis‐Regulatory Region of a Heat‐Shock Protein 70 Gene to Heat‐Inducible Gene Expression in the Ascidian Ciona intestinalis .” Genesis 53, no. 1: 170–182. 10.1002/dvg.22834. [DOI] [PubMed] [Google Scholar]
  26. Kim, D. , Paggi J. M., Park C., Bennett C., and Salzberg S. L.. 2019. “Graph‐Based Genome Alignment and Genotyping With HISAT2 and HISAT‐Genotype.” Nature Biotechnology 37, no. 8: 907–915. 10.1038/s41587-019-0201-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kovaka, S. , Zimin A. V., Pertea G. M., Razaghi R., Salzberg S. L., and Pertea M.. 2019. “Transcriptome Assembly From Long‐Read RNA‐Seq Alignments With StringTie2.” Genome Biology 20, no. 1: 278. 10.1186/s13059-019-1910-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee, T. , and Luo L.. 1999. “Mosaic Analysis With a Repressible Neurotechnique Cell Marker for Studies of Gene Function in Neuronal Morphogenesis.” Neuron 22, no. 3: 451–461. 10.1016/S0896-6273(00)80701-1. [DOI] [PubMed] [Google Scholar]
  29. Li, H. , and Durbin R.. 2009. “Fast and Accurate Short Read Alignment With Burrows‐Wheeler Transform.” Bioinformatics 25, no. 14: 1754–1760. 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li, J. , Li D., Yang Y., Xu T., Li P., and He D.. 2016. “Acrylamide Induces Locomotor Defects and Degeneration of Dopamine Neurons in Caenorhabditis elegans .” Journal of Applied Toxicology 36, no. 1: 60–67. 10.1002/jat.3144. [DOI] [PubMed] [Google Scholar]
  31. Lightfoot, J. W. , Wilecki M., Okumura M., and Sommer R. J.. 2016. “Assaying Predatory Feeding Behaviors in Pristionchus and Other Nematodes.” Journal of Visualized Experiments 115, no. 115: e54404. 10.3791/54404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lightfoot, J. W. , Wilecki M., Rödelsperger C., et al. 2019. “Small Peptide–Mediated Self‐Recognition Prevents Cannibalism in Predatory Nematodes.” Science 364, no. 6435: 86–89. 10.1126/science.aav9856. [DOI] [PubMed] [Google Scholar]
  33. Mahat, D. B. , Salamanca H. H., Duarte F. M., Danko C. G., and Lis J. T.. 2016. “Mammalian Heat Shock Response and Mechanisms Underlying Its Genome‐Wide Transcriptional Regulation.” Molecular Cell 62, no. 1: 63–78. 10.1016/j.molcel.2016.02.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Manabe, A. , Ko K., Nakayama K., Chihara T., and Okumura M.. 2025. “The Nematode Pristionchus pacificus Requires the Gβ and Gγ Proteins for Light Adaptation but Not for Light Avoidance.” Zoological Science 42, no. 1: 60–67. 10.2108/zs240073. [DOI] [PubMed] [Google Scholar]
  35. Massie, M. R. , Lapoczka E. M., Boggs K. D., Stine K. E., and White G. E.. 2003. “Exposure to the Metabolic Inhibitor Sodium Azide Induces Stress Protein Expression and Thermotolerance in the Nematode Caenorhabditis elegans .” Cell Stress and Chaperones 8, no. 1: 1–7. 10.1379/1466-1268(2003)8<1:ETTMIS>2.0.CO;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nakayama, K. , Hiraga H., Manabe A., Chihara T., and Okumura M.. 2024. “cGMP‐Dependent Pathway and a GPCR Kinase Are Required for Photoresponse in the Nematode Pristionchus pacificus .” PLoS Genetics 20, no. 11: e1011320. 10.1371/journal.pgen.1011320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nakayama, K. , Ishita Y., Chihara T., and Okumura M.. 2020. “Screening for CRISPR/Cas9‐Induced Mutations Using a Co‐Injection Marker in the Nematode Pristionchus pacificus .” Development Genes and Evolution 230, no. 3: 257–264. 10.1007/s00427-020-00651-y. [DOI] [PubMed] [Google Scholar]
  38. Namai, S. , and Sugimoto A.. 2018. “Transgenesis by Microparticle Bombardment for Live Imaging of Fluorescent Proteins in Pristionchus pacificus Germline and Early Embryos.” Development Genes and Evolution 228, no. 1: 75–82. 10.1007/s00427-018-0605-z. [DOI] [PubMed] [Google Scholar]
  39. Nikolaidis, N. , and Nei M.. 2003. “Concerted and Nonconcerted Evolution of the Hsp70 Gene Superfamily in Two Sibling Species of Nematodes.” Molecular Biology and Evolution 21, no. 3: 498–505. 10.1093/molbev/msh041. [DOI] [PubMed] [Google Scholar]
  40. Obuchowski, I. , Piróg A., Stolarska M., Tomiczek B., and Liberek K.. 2019. “Duplicate Divergence of Two Bacterial Small Heat Shock Proteins Reduces the Demand for Hsp70 in Refolding of Substrates.” PLoS Genetics 15, no. 10: e1008479. 10.1371/journal.pgen.1008479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Okumura, M. , Wilecki M., and Sommer R. J.. 2017. “Serotonin Drives Predatory Feeding Behavior via Synchronous Feeding Rhythms in the Nematode Pristionchus pacificus .” G3: Genes, Genomes, Genetics 7, no. 11: 3745–3755. 10.1534/g3.117.300263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Osterwalder, T. , Yoon K. S., White B. H., and Keshishian H.. 2001. “A Conditional Tissue‐Specific Transgene Expression System Using Inducible GAL4.” Proceedings of the National Academy of Sciences of the United States of America 98, no. 22: 12596–12601. 10.1073/pnas.221303298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Pavlopoulos, A. , Kontarakis Z., Liubicich D. M., et al. 2009. “Probing the Evolution of Appendage Specialization by Hox Gene Misexpression in an Emerging Model Crustacean.” Proceedings of the National Academy of Sciences of the United States of America 106, no. 33: 13897–13902. 10.1073/pnas.0902804106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Pelham, H. R. B. 1982. “A Regulatory Upstream Promoter Element.” Cell 30, no. 2: 517–528. 10.1016/0092-8674(82)90249-5. [DOI] [PubMed] [Google Scholar]
  45. Potter, C. J. , Tasic B., Russler E. V., Liang L., and Luo L.. 2010. “The Q System: A Repressible Binary System for Transgene Expression, Lineage Tracing, and Mosaic Analysis.” Cell 141, no. 3: 536–548. 10.1016/j.cell.2010.02.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ragsdale, E. J. , Müller M. R., Rödelsperger C., and Sommer R. J.. 2013. “A Developmental Switch Coupled to the Evolution of Plasticity Acts Through a Sulfatase.” Cell 155: 922–933. 10.1016/j.cell.2013.09.054. [DOI] [PubMed] [Google Scholar]
  47. Rödelsperger, C. , Athanasouli M., Lenuzzi M., et al. 2019. “Crowdsourcing and the Feasibility of Manual Gene Annotation: A Pilot Study in the Nematode Pristionchus pacificus .” Scientific Reports 9, no. 1: 18789. 10.1038/s41598-019-55359-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rödelsperger, C. , Menden K., Serobyan V., Witte H., and Baskaran P.. 2016. “First Insights Into the Nature and Evolution of Antisense Transcription in Nematodes.” BMC Evolutionary Biology 16, no. 1: 165. 10.1186/s12862-016-0740-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Rödelsperger, C. , Meyer J. M., Prabh N., Lanz C., Bemm F., and Sommer R. J.. 2017. “Single‐Molecule Sequencing Reveals the Chromosome‐Scale Genomic Architecture of the Nematode Model Organism Pristionchus pacificus .” Cell Reports 21: 834–844. 10.1016/j.celrep.2017.09.077. [DOI] [PubMed] [Google Scholar]
  50. Rudel, D. , Tian H., and Sommer R. J.. 2008. “Wnt Signaling in Pristionchus Pacificus Gonadal Arm Extension and the Evolution of Organ Shape.” Proceedings of the National Academy of Sciences of the United States of America 105, no. 31: 10826–10831. 10.1073/pnas.0800597105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Schinko, J. B. , Hillebrand K., and Bucher G.. 2012. “Heat Shock‐Mediated Misexpression of Genes in the Beetle Tribolium castaneum .” Development Genes and Evolution 222, no. 5: 287–298. 10.1007/s00427-012-0412-x. [DOI] [PubMed] [Google Scholar]
  52. Schlager, B. , Wang X., Braach G., and Sommer R. J.. 2009. “Molecular Cloning of a Dominant Roller Mutant and Establishment of DNA‐Mediated Transformation in the Nematode Pristionchus pacificus .” Genesis 47, no. 5: 300–304. 10.1002/dvg.20499. [DOI] [PubMed] [Google Scholar]
  53. Schneider, C. A. , Rasband W. S., and Eliceiri K. W.. 2012. “NIH Image to ImageJ: 25 Years of Image Analysis Caroline.” Nature Methods 9, no. 7: 671–675. 10.1007/978-1-84882-087-6_9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sommer, R. J. , Carta L. K., Kim S., and Sternberg P. W.. 1996. “Morphological, Genetic and Molecular Description of Pristionchus Pacificus sp. n. (Nematoda: Neodiplogastridae).” Fundamental and Applied Nematology 19, no. 6: 511–521. [Google Scholar]
  55. Stiernagle, T. 2006. “Maintenance of C. elegans .” WormBook: 1–11. 10.1895/wormbook.1.101.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Stringham, E. G. , Dixon D. K., Jones D., and Candido E. P. M.. 1992. “Temporal and Spatial Expression Patterns of the Small Heat Shock (hsp16) Genes in Transgenic Caenorhabditis elegans .” Molecular Biology of the Cell 3, no. 2: 221–233. 10.1091/mbc.3.2.221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Su, W. , Sun J., Shimizu K., and Kadota K.. 2019. “TCC‐GUI: A Shiny‐Based Application for Differential Expression Analysis of RNA‐Seq Count Data.” BMC Research Notes 12, no. 1: 133. 10.1186/s13104-019-4179-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Suzuki, M. , Nukazuka A., Kamei Y., and Yuba S.. 2022. “Mosaic Gene Expression Analysis of Semaphorin – Plexin Interactions in Caenorhabditis elegans Using the IR‐LEGO Single‐Cell Gene Induction System.” Development, Growth & Differentiation 64, no. 5: 230–242. 10.1111/dgd.12793. [DOI] [PubMed] [Google Scholar]
  59. Voutev, R. , and Hubbard E. J. A.. 2008. “A “FLP‐Out” System for Controlled Gene Expression in Caenorhabditis elegans .” Genetics 180, no. 1: 103–119. 10.1534/genetics.108.090274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Walker, G. A. , Thompson F. J., Brawley A., Scanlon T., and Devaney E.. 2003. “Heat Shock Factor Functions at the Convergence of the Stress Response and Developmental Pathways in Caenorhabditis elegans .” FASEB Journal 17, no. 13: 1–19. 10.1096/fj.03-0164fje. [DOI] [PubMed] [Google Scholar]
  61. Watanabe, T. , Saito D., Tanabe K., et al. 2007. “Tet‐On Inducible System Combined With in Ovo Electroporation Dissects Multiple Roles of Genes in Somitogenesis of Chicken Embryos.” Developmental Biology 305, no. 2: 625–636. 10.1016/j.ydbio.2007.01.042. [DOI] [PubMed] [Google Scholar]
  62. Werner, M. S. , Loschko T., King T., et al. 2023. “Histone 4 Lysine 5/12 Acetylation Enables Developmental Plasticity of Pristionchus Mouth Form.” Nature Communications 14, no. 1: 2095. 10.1038/s41467-023-37734-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Werner, M. S. , Sieriebriennikov B., Prabh N., Loschko T., Lanz C., and Sommer R. J.. 2018. “Young Genes Have Distinct Gene Structure, Epigenetic Profiles, and Transcriptional Regulation.” Genome Research 28, no. 11: 1675–1687. 10.1101/gr.234872.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wilecki, M. , Lightfoot J. W., Susoy V., and Sommer R. J.. 2015. “Predatory Feeding Behaviour in Pristionchus Nematodes Is Dependent on Phenotypic Plasticity and Induced by Serotonin.” Journal of Experimental Biology 218: 1306–1313. 10.1242/jeb.118620. [DOI] [PubMed] [Google Scholar]
  65. Witte, H. , Moreno E., Rödelsperger C., et al. 2015. “Gene Inactivation Using the CRISPR/Cas9 System in the Nematode Pristionchus pacificus .” Development Genes and Evolution 225, no. 1: 55–62. 10.1007/s00427-014-0486-8. [DOI] [PubMed] [Google Scholar]
  66. Xing, C. , Li G., Liu X., Deng X. I., and Wang Y.. 2017. “Characterization of an Amphioxus Heat‐Shock Protein Gene Promoter and Its Application in Vivo.” International Journal of Developmental Biology 61, no. 10–12: 785–792. 10.1387/ijdb.170210yw. [DOI] [PubMed] [Google Scholar]
  67. Zhang, H. , and Chen W.. 2023. “Automated Recognition and Analysis of Body Bending Behavior in C. elegans .” BMC Bioinformatics 24, no. 1: 175. 10.1186/s12859-023-05307-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: Optimization of culture and heat shock conditions.

Figure S2: RFP expression in the PPA38778p::TurboRFP strain.

DGD-68-0-s001.pdf (1MB, pdf)

Data Availability Statement

All materials generated in this study, including plasmids, worm strains, and data relevant for this article, are available upon request from the corresponding author (okumuram@hiroshima-u.ac.jp). RNA‐sequencing data are available at https://www.ddbj.nig.ac.jp/index‐e.html and can be accessed using PRJDB35585.


Articles from Development, Growth & Differentiation are provided here courtesy of Wiley

RESOURCES