KCTD15 Enhances Stem Cell‐Like Properties and Promotes Triple‐Negative Breast Cancer Progression Through KLF4/β‐Catenin Signaling

ABSTRACT

Triple‐negative breast cancer (TNBC) remains an aggressive malignancy with limited therapeutic options and poor prognosis, underscoring the critical need for novel therapeutic targets. This investigation elucidates the functional role of the potassium channel tetramerization domain 15 (KCTD15) in TNBC progression, providing mechanistic insights into its potential as a therapeutic target for this challenging disease. KCTD15 exhibited high expression in TNBC tissues, correlating with advanced grade and unfavorable prognosis. Functionally, KCTD15 knockdown in TNBC cell lines (BT‐549/MDA‐MB‐231) markedly suppressed cellular proliferation, migration, and cancer stem cell properties, while concomitantly enhancing apoptosis. Mechanistically, KCTD15 directly interacted with KLF4, facilitating its nuclear translocation and subsequent activation of the β‐catenin signaling cascade. Notably, KLF4 knockdown abrogated KCTD15‐mediated stemness maintenance and β‐catenin pathway activation. In vivo, KCTD15 silencing reduced xenograft tumor growth and downregulated Ki67, KLF4, and β‐catenin protein expression in tumor tissues, confirming its oncogenic role through the KLF4/β‐catenin axis. Our findings establish KCTD15 as a pivotal regulator of TNBC stemness through modulation of the KLF4/β‐catenin signaling axis. These results provide a robust preclinical rationale for developing therapeutic strategies targeting this molecular axis in TNBC management.

KCTD15 is upregulated in TNBC tissues and cells. It enhances TNBC stemness via KLF4/β‐catenin signaling, promotes proliferation, migration, and stemness while inhibiting apoptosis, and drives tumorigenesis in vivo. Collectively, Feng et al.' study reveals that KCTD15 acts as a key oncogenic driver in TNBC via the KLF4/β‐catenin axis, highlighting its potential as a therapeutic target.

1. Introduction

Breast cancer (BC) remains a leading cause of cancer‐related morbidity and mortality among women globally, with persistently elevated incidence and mortality rates posing significant threats to public health. Among BC subtypes, triple‐negative breast cancer (TNBC) is defined by the absence of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression. This subtype accounts for approximately 15%–20% of all BC cases [1], distinguishing itself through aggressive biological behavior characterized by poorer prognosis, higher recurrence rates, and increased mortality compared to other BC subtypes [2, 3]. Current therapeutic limitations include resistance to endocrine therapies and HER2‐targeted agents, coupled with a lack of standardized treatment protocols in clinical practice [4, 5]. These challenges underscore the urgent need for novel therapeutic strategies to address TNBC management.

The potassium channel tetramerization domain (KCTD) protein family constitutes a group of evolutionarily conserved proteins, with 25 members hallmarked by a common bric‐à‐brac, tramtrack, broad complex (BTB) domain that interacts with various proteins [6]. As a member of this family, KCTD15 has emerged as a multifunctional regulator implicated in various pathophysiological processes, including neurodegenerative diseases and malignancies [7, 8, 9, 10]. Emerging evidence reveals context‐dependent roles for KCTD15 in cancer biology: while its reduced expression exhibits tumor‐suppressive activity in colorectal cancer [10, 11], paradoxically, it acts as an oncogenic driver in HER2‐positive breast cancer through chemoresistance mechanisms. Notwithstanding these advances, the biological significance of KCTD15 in TNBC pathogenesis remains completely uncharacterized, representing a critical knowledge gap in BC research.

In this study, we seek to elucidate the biological functions and molecular mechanisms of KCTD15 in TNBC progression. Specifically, we will analyze and validate the expression of KCTD15 in TNBC tissues and cell lines. Subsequently, we will employ KCTD15 knockdown strategies in TNBC models to systematically evaluate its functional contributions to cellular proliferation, motility, invasiveness, and cancer stem cell properties. By integrating molecular characterization with phenotypic analyses, this investigation aims to define KCTD15's oncogenic role while elucidating its regulatory pathways in TNBC, thereby providing mechanistic insights to inform the development of precision therapeutics for this aggressive BC subtype.

2. Materials and Methods

2.1. Immunohistochemistry (IHC)

Tissue sections were deparaffinized in xylene and rehydrated through a graded ethanol series. Antigen retrieval was performed by heating sections in citrate buffer (pH 6.0) at 95°C for 20 min. After blocking endogenous peroxidase activity with 3% hydrogen peroxide for 15 min, sections were incubated overnight at 4°C with rabbit polyclonal anti‐Ki‐67 or rabbit polyclonal anti‐KTCD15 (1:100, #20128‐1‐AP, Proteintech, USA) primary antibodies. Following three washes with Tris‐buffered saline containing 0.1% Tween‐20 (TBST), sections were incubated with HRP‐conjugated goat anti‐mouse secondary antibodies for 1 h at room temperature. After three additional TBST washes, signals were visualized using a 3,3′‐diaminobenzidine (DAB) substrate kit. Sections were counterstained with hematoxylin, dehydrated, and mounted. Images were captured using a light microscope (Leica Microsystems, Germany).

2.2. Cell Culture

Human mammary epithelial cells MCF‐10A and human breast cancer cell lines MDA‐MB‐468, MCF‐7, BT‐549 and MDA‐MB‐231 were obtained from the Cell Bank of the Chinese Academy of Medical Sciences (Shanghai, China). Cells were maintained in Dulbecco's Modified Eagle Medium (DMEM; Gibco Laboratories, USA) supplemented with 10% fetal bovine serum (FBS; Gibco Laboratories, USA) and 1% penicillin–streptomycin (Gibco Laboratories, USA) at 37°C in a humidified incubator with 5% CO₂.

2.3. qRT‐PCR

Total RNA was extracted using TRIzol reagent (Sigma‐Aldrich, USA), and cDNA was synthesized with a SuperScript III Reverse Transcriptase kit (Vazyme, China). qRT‐PCR was performed on an ABI Prism 7500 system (Applied Biosystems, USA) using SYBR Green qPCR Master Mix (Vazyme, China). The thermal cycling conditions were as follows: initial denaturation at 94°C for 30 s, followed by 40 cycles of 94°C for 5 s and 60°C for 30 s. Relative mRNA expression levels of KCTD15 were calculated using the $2^{-\mathrm{\Delta \Delta }{\mathrm{C}}_{\mathrm{t}}}$ method, with GAPDH as the internal reference. All experiments were conducted in triplicate. The primer sequences (5′‐3′) were listed as follows: GAPDH, forward primer: TGACTTCAACAGCGACACCCA, reverse primer: CACCCTGTTGCTGTAGCCAAA. KCTD15, forward primer: TCCTCGCTTCACACACACG, reverse primer: GCACAGGTGCATTGGACTTG.

2.4. Western Blotting and co‐Immunoprecipitation (Co‐IP)

The experimental procedure was conducted as follows: Cells were lysed in RIPA buffer containing protease inhibitors. Proteins were resolved on 15% SDS‐PAGE gels and transferred to PVDF membranes (Beyotime, China). Membranes were blocked and subsequently probed overnight at 4°C with the following primary antibodies: anti‐KCTD15 (1:1000; #20128‐1‐AP; Proteintech, USA), anti‐GS3Kα/β (1:3000; #A22665; ABclonal, China), anti‐p‐GS3Kα/β (1:2000; #BM4836; BOSTER, USA), anti‐β‐Catenin (1:3000; #51067‐2‐AP; Proteintech, USA), anti‐c‐MYC (1:8000; #67447‐1‐Ig; Proteintech, USA), anti‐KLF4 (1:1000; #ab215036; Abcam, USA), anti‐Histone H3 (1:2000; #4499S; Cell Signaling Technology, USA), anti‐CD44 (1:2000; #A00052; BOSTER, USA), anti‐CD133 (1:4000; #18470‐1‐AP; Proteintech, USA), anti‐SOX2 (1:2000; #BM4147; BOSTER, USA), anti‐GAPDH (1:30000; #60004‐1‐lg; Proteintech, USA), and anti‐β‐actin (1:4000; #66009‐1‐Ig; Proteintech, USA). After incubation with appropriate HRP‐conjugated secondary antibodies for 1 h at room temperature, protein bands were visualized using an ECL detection system (Amersham Biosciences Inc., UK). Band intensities were quantified using Quantity One software (Bio‐Rad Laboratories, USA).

2.5. Cell Counting Kit‐8 (CCK‐8) Assay

Human breast cancer cell lines BT‐549 and MDA‐MB‐231 were seeded into 96‐well plates at a density of 2000 cells per well. Cell viability was assessed using a commercial CCK‐8 kit (#96992; Sigma‐Aldrich, USA). Briefly, 10 μL of CCK‐8 reagent was added to each well, followed by incubation at 37°C for 1.5 h. Absorbance was measured at 450 nm using a microplate reader (BioTek Instruments, USA).

2.6. Colony Formation Assay

Stably transfected cells were seeded into 6‐well plates at a density of 1.5 × 10³ cells per well (Corning, USA) and cultured in DMEM supplemented with 10% FBS at 37°C under 5% CO₂ for 7 days. Subsequently, colonies were washed twice with PBS, fixed with absolute methanol (Sigma‐Aldrich, USA) for 15 min, and stained with 0.1% crystal violet (#C0775; Sigma‐Aldrich, USA) for 20 min. Colonies containing ≥ 50 cells were manually counted under a stereomicroscope (Leica MZ10, Germany). Data are presented as the mean colony formation rate (%) from three independent experiments.

2.7. Apoptosis Detection by Flow Cytometry

Cells were harvested by collecting the culture medium and adherent cells, washed twice with ice‐cold PBS, and centrifuged at 300 × g for 5 min. The cell pellet was resuspended in 500 μL of 1× Annexin V binding buffer (BD Biosciences, USA). Subsequently, 10 μL of 7‐aminoactinomycin D (7‐AAD; #559925; BD Biosciences, USA) and 5 μL of Annexin V‐allophycocyanin (APC; #550474; BD Biosciences, USA) were added to the cell suspension. After gentle vortexing, samples were incubated in the dark at 25°C for 10 min. Apoptosis analysis was immediately performed using a FACScan flow cytometer (BD Biosciences, USA) equipped with CellQuest Pro software (v5.2.1). Cells were classified into four populations: viable cells, early apoptotic cells, late apoptotic cells, and necrotic cells. The combined percentage of early and late apoptotic cells was normalized to the untreated control group. All experiments were independently repeated three times.

2.8. Wound Healing Assay

Cell migration was assessed using a scratch wound healing assay. Briefly, human breast cancer cell lines BT‐549 and MDA‐MB‐231 were seeded into 6‐well plates at a density of 5 × 10⁵ cells per well and cultured until reaching 100% confluency. A uniform scratch wound was created in the monolayer using a sterile 10 mL pipette tip (Corning, USA). Cells were then washed twice with PBS and incubated in serum‐free Dulbecco's Modified Eagle Medium (DMEM; Gibco Laboratories, USA) at 37°C under 5% CO₂ for 48 h. Migration progression was monitored at 0 h and 48 h, with images captured using an inverted phase‐contrast microscope (Olympus IX73, Japan) at 100× magnification. Wound closure percentage was quantified using ImageJ software (NIH, USA).

2.9. Transwell Invasion Assay

Human breast cancer cell lines BT‐549 and MDA‐MB‐231 were seeded into Transwell inserts (8 μm pore size; Corning, USA) pre‐coated with Matrigel (BD Biosciences, USA) at a density of 1 × 10⁵ cells per well in serum‐free medium. The lower chamber was filled with medium containing 10% FBS (Gibco Laboratories, USA) as a chemoattractant. After 24 h of incubation at 37°C, cells remaining on the upper membrane were gently removed with a cotton swab. Invaded cells were fixed with 4% paraformaldehyde (PFA; Sigma‐Aldrich, USA) for 15 min, stained with 0.1% crystal violet (#C0775; Sigma‐Aldrich, USA) for 10 min, and rinsed with phosphate‐buffered saline (PBS; Gibco Laboratories, USA). Cells were quantified by counting five randomly selected fields per insert under an inverted light microscope (Olympus IX73, Japan) at 200× magnification.

2.10. Chromatin Immunoprecipitation (ChIP) Assay

BT‐549 and MDA‐MB‐23 cells were cross‐linked with 1% formaldehyde for 10 min at room temperature. Nuclear proteins were extracted using the EZ‐Magna ChIP A/G Kit (Millipore, USA) according to the manufacturer's protocol. Chromatin was sonicated to generate DNA fragments ranging from 200 to 500 bp. Immunoprecipitation was performed overnight at 4°C with specific antibodies or control IgG. Protein‐DNA complexes were captured using magnetic beads, followed by sequential washes and elution. Cross‐links were reversed by incubation at 65°C overnight, and DNA was purified using spin columns. Enriched DNA fragments were quantified by real‐time PCR or analyzed via agarose gel electrophoresis. Data were normalized to input controls and quantified using ImageJ software (National Institutes of Health, USA).

2.11. Mouse Xenograft Experiments

All animal procedures and experimental protocols were approved by the Institutional Animal Care and Use Committee of Shanxi Provincial Cancer Hospital and carried out in accordance with the Guide for the Care and Use of Laboratory Animals. NU nude mice (4–6 weeks old, weighing 14–18 g, n = 12) were purchased from Shanghai Southern Model Organism Biotechnology Co. Ltd. and randomly assigned to two groups (empty vector group and shKCTD15 group), with 6 mice in each group. Lentivirus‐mediated MDA‐MB‐231 cells (200 μL, 1 × 10⁷ cells/mL) were subcutaneously injected into the flank regions of the mice, which were housed in a specific pathogen‐free facility. Starting from the 7th day after injection, tumor size and mouse body weight were measured every 3 days until the 20th day. Tumor volume (mm³) was computed using the formula:

$$\mathrm{\pi }/6\times L\times W^2,$$

where L represents the long axis and W denotes the short axis of the tumor. On the final day of the experiment, all mice were euthanized via cervical dislocation, and the tumor tissues were surgically removed. The formalin‐fixed and paraffin‐embedded samples from the xenograft models were sectioned into 4‐μm slices for immunohistochemical (IHC) staining analysis.

2.12. Statistical Analysis

Data are the mean ± standard deviation (SD). Experimental data were analyzed using SPSS 22.0 statistical and GraphPad Prism 8.0 software. Multigroup comparisons were performed using a Student's t‐test or one‐way analysis of variance (ANOVA). Assays were repeated on a minimum of three occasions. p < 0.05 was deemed statistically significant.

3. Results

3.1. KCTD15 Demonstrates Elevated Expression in TNBC and Correlates With Poor Prognosis

Bioinformatics analysis of GEO datasets revealed significantly higher KCTD15 expression in TNBC tissues compared to normal counterparts (Figure 1A). Applying median expression‐based stratification, we observed a stark survival disparity through Kaplan–Meier analysis: patients with high KCTD15 expression exhibited markedly reduced overall survival versus low‐expression cohorts (p = 0.0141, HR = 1.47 (1.08–1.99), Figure 1B). Multivariate Cox regression analysis confirmed KCTD15 as an independent prognostic biomarker (p = 0.0149, HR = 1.47 (1.08–2.02)), maintaining prognostic significance after adjusting for standard clinical parameters (Figure 1C). Histopathological validation using tissue microarrays (TMAs) and IHC corroborated these findings. KCTD15 protein levels showed dramatic elevation in TNBC specimens versus adjacent normal tissues (Figure 1D), with Mann–Whitney U testing confirming statistical significance (p < 0.001). We further investigated the association of KCTD15 with TNBC progression through clinicopathological correlation analyses. Mann–Whitney U testing demonstrated significant positive correlations between KCTD15 expression and tumor grade (p < 0.001, Table 1). Spearman's rank correlation analysis corroborated these findings, showing progressive KCTD15 upregulation with advancing tumor malignancy (p < 0.001, Table 2). Collectively, these multimodal analyses establish KCTD15 as a promising prognostic indicator in TNBC, with its elevated expression strongly associated with aggressive tumor phenotypes and adverse clinical outcomes.

FIGURE 1.

KCTD15 is upregulated in Triple‐Negative Breast Cancer and associated with poor prognosis. (A) Box plot showing the expression levels of KCTD15 in normal and tumor tissues. (B) Kaplan–Meier plot of overall survival in patients stratified by KCTD15 expression levels (low vs. high). High KCTD15 expression is associated with a worse prognosis (HR = 1.47, Logrank p = 0.0141). (C) Forest plot of multifactor Cox regression analysis. KCTD15 is an independent prognostic factor (p = 0.0149). (D) Quantitative results of IHC staining (left) and representative IHC images (right) of KCTD15 in normal (n = 4) and tumor (n = 97) tissues. KCTD15 staining is significantly stronger in tumors. *p < 0.05, **p < 0.01, ***p < 0.001.

TABLE 1.

Relationship between KCTD15 expression and tumor characteristics in patients with BC.

FeaturesA2: E20	No. of patients	KCTD15 expression		p
		Low	High
All patients	97	46	51
Age (years)
≤ 51	53	29	24	0.116
> 51	44	17	27
Grade
I	1	1	0	< 0.001
II	47	33	14
III	49	12	37
T infiltrate
T1	2	1	1	0.371
T2	75	37	38
T3	13	7	6
T4	7	1	6
Lymphatic metastasis (N)
N0	57	27	30	0.803
N1	24	13	11
N2	8	3	5

TABLE 2.

T Spearman correlation analysis of KCTD15 expression with tumor grade in BC patients.

Tumor characteristics	Index	KCTD15
Grade	Spearman correlation	0.468
	Significance (two tailed)	< 0.001
	N	97

3.2. Knockdown of KCTD15 Suppresses Proliferation and Migration in TBNC Cells

To investigate the role of KCTD15 in TBNC progression, we first used qPCR to assess its expression in normal mammary epithelial cells (MCF‐10A) and TNBC cells (MDA‐MB‐468 and MCF‐7, BT‐549 and MDA‐MB‐231 cells). Results revealed significant upregulation of KCTD15 in TNBC cell lines, with BT‐549 and MDA‐MB‐231 exhibiting the highest expression levels (Figure 2A). Based on these findings, we selected BT‐549 and MDA‐MB‐231 for subsequent loss‐of‐function studies. Two short hairpin RNAs (shKCTD15‐2 and shKCTD15‐3) with optimal knockdown efficiency were stably transfected into BT‐549 and MDA‐MB‐231 cells (Figure S1A). Successful establishment of stable KCTD15‐knockdown models was confirmed by evaluating infection efficiency (Figure S1B) and quantifying KCTD15 mRNA and protein levels (Figure 2B,C).

FIGURE 2.

Knockdown of KCTD15 inhibits breast cancer cell proliferation, colony formation, and migration, and promotes apoptosis. (A) qPCR analysis of KCTD15 expression in normal breast epithelial cell line (MCF‐10A) and different breast cancer cell lines (MDA‐MB‐231, MDA‐MB‐468, BT‐549, and MCF‐7). (B) qPCR verification of KCTD15 knockdown efficiency in BT‐549 and MDA‐MB‐231 cells. (C) Western blot analysis confirming the knockdown of KCTD15 in BT‐549 and MDA‐MB‐231 cells. (D) CCK‐8 assays showing reduced proliferation of BT‐549 and MDA‐MB‐231 cells after KCTD15 knockdown. (E) Colony formation assays. Fewer and smaller colonies are formed in shKCTD15 groups. (F) Flow cytometry analysis of apoptosis. Increased apoptosis is observed in shKCTD15‐transfected cells. (G) Wound healing assays. Decreased migration ability is seen in shKCTD15 groups at 24 h. (H) Transwell migration assays. Fewer migrated cells are observed in shKCTD15 groups. *p < 0.05, **p < 0.01, ***p < 0.001.

Functional assays were performed to determine the impact of KCTD15 depletion on TNBC cell behavior. CCK‐8 proliferation assays demonstrated that KCTD15 knockdown significantly inhibited the growth of both BT‐549 and MDA‐MB‐231 cells compared to control groups (Figure 2D). Colony formation assays further supported these findings, showing a marked reduction in colony number and size following KCTD15 depletion (Figure 2E). The flow cytometry apoptosis assay revealed that knockdown of KCTD15 enhanced apoptosis in TNBC cells (Figure 2F). Wound healing assays (Figure 2G) and Transwell invasion assays (Figure 2H) demonstrated that loss of KCTD15 significantly impaired cell migration and invasion capabilities. Collectively, the aforementioned data indicate that KCTD15 plays a critical role in promoting the malignant phenotype of TNBC cells. Targeting KCTD15 may represent a potential therapeutic strategy for suppressing tumor progression in TNBC.

3.3. KCTD15 Promotes TNBC Cells CSC‐Like Properties by Enhancing KLF4 Transcriptional Expression

Breast cancer is recognized as a stem cell disease characterized by the presence of cancer cells with stem‐like properties and tumor‐initiating potential, which are considered the root cause of tumor spread and metastasis [12, 13]. To explore the relationship between KCTD15 and breast cancer CSC‐like properties, we performed a spheroid formation assay. The results showed that the sphere‐forming ability was significantly reduced in cells with KCTD15 knockdown (Figure 3A). Western blot analysis further revealed that the expression of stemness‐related proteins CD44, CD133, and SOX2 was decreased in the KCTD15 knockdown group (Figure 3B), indicating that KCTD15 knockdown can suppress the expression of stemness‐related proteins, thereby inhibiting CSC‐like properties. To elucidate the molecular mechanisms underlying the effect of KCTD15 on the stemness of TBNC, we conducted Spearman correlation analysis of KCTD15 expression with stemness marker proteins (OCT4, SOX2, NANOG, KLF4, and c‐MYC) [14] in TNBC samples from The Cancer Genome Atlas (TCGA) database. Notably, we observed significant positive correlations between KCTD15 and both KLF4 and ITGA6 (CD49f). The correlation between KCTD15 and the transcription factor KLF4 was stronger, prompting us to further investigate the impact of KCTD15 on KLF4 (Figure 3C). Co‐immunoprecipitation (CO‐IP) experiments were carried out in BT‐549 and MDA‐MB‐231 cells, and the results demonstrated that the KLF4 antibody could specifically immunoprecipitate the KCTD15 protein, confirming that KCTD15 and KLF4 can bind to each other within the cells (Figure 3D).

FIGURE 3.

KCTD15 interacts with KLF4 and regulates cancer stem cell‐like properties. (A) Sphere‐forming assays. shKCTD15‐transfected BT‐549 and MDA‐MB 231 cells form smaller and fewer spheres compared to shCtrl. The graph shows the quantification of sphere diameter. (B) Western blot analysis of cancer stem cell markers (CD44, CD133, and SOX2) in shCtrl and shKCTD15 groups. (C) Correlation analysis between KCTD15 and KLF4 expression in breast cancer samples (R = 0.23, p = 0.01). (D) Co‐immunoprecipitation (Co‐IP) assays showing the interaction between KCTD15 and KLF4 in BT‐549 and MDA‐MB‐231 cells. (E) Subcellular fractionation and Western blot analysis of KLF4 in cytoplasm and nucleus of shCtrl and shKCTD15‐transfected cells. (F) Sphere‐forming assays after KCTD15 overexpression, KLF4 knockdown, and combined treatment. The graph shows the quantification of sphere diameter. *p < 0.05, **p < 0.01, ***p < 0.001.

Subsequently, we isolated KCTD15 and KLF4 proteins from the nucleus and cytoplasm and performed Western blot analysis. The results showed that knockdown of KCTD15 significantly reduced the levels of KLF4 in the nucleus (Figure 3E), indicating that the interaction between KCTD15 and KLF4 promotes the translocation of KLF4 from the cytoplasm to the nucleus. To validate that KCTD15 enhances TBNC stem cell (CSC)‐like properties by promoting KLF4 transcriptional expression, we performed sphere formation assays. We observed that overexpression of KCTD15 promoted TBNC CSC‐like properties, while knockdown of KLF4 had the opposite effect. Additionally, knockdown of KLF4 significantly inhibited the enhancement of TBNC cell stemness induced by KCTD15 overexpression (Figure 3F).

In conclusion, our findings demonstrate that KCTD15 promotes the transcriptional expression of the stemness marker protein KLF4, thereby enhancing TBNC CSC‐like properties.

3.4. KCTD15 Drives Tumorigenesis via Activation of the β‐Catenin Signaling Cascade Through Transcriptional Modulation of KLF4

Genome‐scale Enrichment Analysis (GSEA) revealed that high expression of KCTD15 exhibited statistically significant enrichment of the β‐Catenin signaling pathway (Figure 4A). Further Western blot analysis demonstrated that genetic silencing of KCTD15 attenuated phosphorylation of p‐GSK3α/β and reduced β‐Catenin, c‐MYC expression (Figure 4B). These correlative findings provide preliminary evidence for KCTD15‐mediated regulation of the β‐Catenin signaling axis.

FIGURE 4.

KCTD15 regulates the Wnt/β‐catenin pathway in breast cancer cells. (A) GSEA (Gene Set Enrichment Analysis) showing enrichment of the β‐catenin pathway in KCTD15‐high expressing samples (NES = 2.039, p = 0.0209, FDR = 0.0209). (B) Western blot analysis of β‐catenin pathway‐related proteins (GS3Kβ, p‐GS3Kβ, c‐MYC, and β‐Catenin) in shCtrl and shKCTD15‐transfected BT‐549 and MDA‐MB‐231 cells. (C) CCK‐8 assays of BT‐549 and MDA‐MB‐231 cells treated with XAV‐939 (a β‐catenin pathway inhibitor) or DMSO, and transfected with shCtrl or shKCTD15. (D) Sphere‐forming assays of cells treated as in (C). The graph shows the quantification of sphere diameter. (E) Wound healing assays of cells treated as in (C). The graph shows the quantification of wound closure. (F) Western blot analysis of β‐catenin pathway‐related proteins and KLF4 in cells treated with DMSO or XAV‐939, and stably transfected with NC or KCTD15. (G) Western blot analysis of the same proteins in cells with different KCTD15 expression levels and KLF4 knockdown. *p < 0.05, **p < 0.01, ***p < 0.001.

Subsequent functional validation experiments demonstrated that overexpression of KCTD15 significantly promotes cell proliferation, acquisition of CSC‐like properties, and motility of cancer cells. Notably, these pro‐tumorigenic effects were potently abrogated by XAV‐939, an inhibitor of the β‐catenin signaling pathway (Figure 4C–E). Consistent with these phenotypic observations, Western blot (WB) analysis confirmed that, compared to the KCTD15 overexpression group, the XAV‐939 treatment group significantly suppressed the expression of p‐GSK3α/β, β‐Catenin, and c‐MYC (Figure 4F). Therefore, these results confirm that KCTD15 promotes cancer progression through the β‐Catenin signaling pathway.

Furthermore, we performed Western blot experiments in cellular models featuring stable KCTD15 overexpression alongside genetic silencing of KLF4. Consistent with our mechanistic hypothesis, the results showed that KCTD15 overexpression upregulated the expression of β‐Catenin signaling pathway components, whereas KLF4 knockdown elicited downregulation of these proteins. Strikingly, KLF4 knockdown inhibited the activation of the β‐Catenin signaling pathway induced by KCTD15 overexpression, as demonstrated by the reduction in the protein levels of p‐GSK3α/β, β‐Catenin, and c‐MYC (Figure 4G). Collectively, these results indicate that KCTD15 activates the β‐Catenin signaling pathway through KLF4.

3.5. KCTD15 Promotes Tumorigenesis in TNBC Cells by Enhancing CSC‐Like Properties

To further validate the role of KCTD15 in tumorigenesis within TNBC cells, we established subcutaneous xenografts using MDA‐MB‐231 cells with stable KCTD15 knockdown and control cells in BALB/c nude mice. By observing and monitoring the changes in tumor growth and volume, the results showed that KCTD15 knockdown significantly impaired tumor expansion (Figure 5A,B). Consistent with above observations, post‐sacrifice tumor excision measurements corroborated diminished volumetric growth in KCTD15‐knockdown xenografts compared to controls (Figure 5C), indicating that KCTD15 knockdown potently suppresses tumorigenic potential in vivo. IHC staining of tumor tissue sections from each group revealed that the expression of KCTD15, β‐Catenin, KLF4, and the proliferation marker Ki67 was lower in the KCTD15 knockdown xenografts compared to the controls. This validated that KCTD15 promotes tumorigenesis in TNBC cells through the KLF4 and β‐Catenin pathways (Figure 5D). Complementarily, Western blot analysis of tumor lysates confirmed decreased protein levels of KCTD15, p‐GSK3α/β, β‐Catenin, and KLF4 in the KCTD15‐knockdown group (Figure 5E). In summary, we have validated at the animal level that KCTD15 promotes tumorigenesis in TNBC cells through the KLF4 and β‐Catenin pathways.

FIGURE 5.

Knockdown of KCTD15 inhibits tumor growth in vivo. (A) Mouse body weight changes over 25 days postinoculation. No significant difference in body weight is observed between shCtrl and shKCTD15 groups. (B) Tumor volume changes over 25 days post‐inoculation. Tumors in the shKCTD15 group grow more slowly. (C) Representative images of tumors (up) from shCtrl and shKCTD15 groups and tumor weight quantification (down). (D) IHC staining of tumor sections (targets: KCTD15, proliferation marker Ki67, KLF4, β‐Catenin) and corresponding IHC score quantification. (E) Western blot analysis of KCTD15, GS3Kαβ, p‐GS3Kαβ, KLF4, and β‐Catenin in tumor tissues, with GAPDH as a loading control. *p < 0.05, **p < 0.01, ***p < 0.001.

4. Discussion

Our study identifies KCTD15 as a critical oncogenic driver in TNBC. We demonstrate that KCTD15 exhibits significant upregulation in TNBC tissues and demonstrates statistical correlation with advanced tumor grade and poor prognosis. Functionally, KCTD15 knockdown suppresses TNBC cell proliferation, migration, invasion, and stemness. Mechanistically, KCTD15 interacts with KLF4 to facilitate its nuclear translocation, thereby activating β‐catenin signaling and enhancing CSC‐like properties. Collectively, these findings unveil a novel KCTD15‐KLF4‐β‐catenin axis that drives TNBC progression, highlighting KCTD15 as a potential therapeutic target.

Emerging evidence suggests that KCTD15 exhibits tissue‐specific roles in tumorigenesis. In colorectal cancer, KCTD15 functions as a putative tumor suppressor, with its downregulation linked to unfavorable survival outcomes [10]. Conversely, KCTD15 is overexpressed in human childhood B‐cell acute lymphoid leukemia [15]. In HER2+ breast cancer, KCTD15 overexpression contributes to chemoresistance by interfering with doxorubicin sensitivity [11]. Our findings extend this functional dichotomy to TNBC, where KCTD15 operates as a potent oncogene. The tissue‐specific roles of KCTD15 may stem from its differential interactions with substrates or variations in posttranslational modifications. In TNBC, KCTD15 directly interacted with KLF4. In colorectal cancer, KCTD15 RNA expression and stabilization are regulated by FTO/YTHDF2‐mediated m6A modification [10]. Further mechanistic dissection is required to dissect the molecular determinants underlying KCTD15's context‐dependent functional plasticity.

KLF4, a member of the KLF‐like factor subfamily of zinc finger proteins and a pluripotency‐associated transcription factor, plays an essential role in cell‐fate decisions—including DNA damage response, inflammation, apoptosis, and stem cell reprogramming—and exhibits paradoxical roles in cancer [16, 17, 18]. Functionally, KLF4 suppresses tumorigenesis in esophageal and ovarian cancers [19, 20], notably, Zhou et al.'s [21] study further expands its context‐dependent roles in ovarian cancer by showing that KLF4 expression is upregulated in cisplatin‐resistant ovarian cancer cell lines and tissues, and knocking down KLF4 impairs the cisplatin resistance of ovarian cancer. In contrast, KLF4 promotes stemness and metastasis progression in pancreatic and breast cancers [22, 23, 24]. Our work aligns with the latter paradigm, showing that KCTD15 stabilizes nuclear KLF4 to activate β‐catenin signaling—a pathway critically implicated in TNBC cells' stemness. Notably, ATXN3 was recently reported to potentiate breast cancer metastasis via KLF4 deubiquitylation [23]. Contrasting this mechanism, our study reveals KCTD15 enhances KLF4 transcriptional activity through physical interaction rather than ubiquitination‐based regulation. This mechanistic divergence underscores the regulatory complexity of KLF4 and suggests that combinatorial therapeutic targeting of KCTD15‐KLF4 interactions axis may achieve synergistic efficacy.

Our study positions KCTD15 as a dual‐function biomarker with clinical and therapeutic significance in TNBC. Clinically, KCTD15 expression levels hold potential to stratify patients for KLF4/β‐catenin‐targeted therapeutic interventions. Preclinically, therapeutic strategies targeting the KCTD15‐KLF4 protein–protein interaction through small molecules or Proteolysis‐Targeting Chimeras (PROTACs) [25, 26] mediated degradation represent a precision medicine approach. Notable limitations remain in this study. Specifically, findings require validation using patient‐derived xenograft (PDX) models, and the potential role of KCTD15 in mediating therapy resistance warrants systematic exploration. Furthermore, the molecular mechanism underlying KCTD15‐facilitated KLF4 nuclear translocation remains incompletely elucidated and requires further investigation. Addressing these knowledge gaps will be critical for accelerating the clinical translation of KCTD15‐targeted therapeutic strategies.

Author Contributions

Jun Xing and Jing Feng designed this program. Liang Yao and Wei Sun operated the cell and animal experiments. Wei Sun conducted the data collection and analysis. Liang Yao produced the manuscript, which was checked by Jun Xing and Jing Feng. All the authors have confirmed the submission of this manuscript.

Funding

The authors have nothing to report.

Ethics Statement

The Ethics Committee of Shanxi Provincial Cancer Hospital (SDL2024061).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1A: Relative KCTD15 mRNA levels normalized to GAPDH in different groups (CON, shCtrl, shKCTD15‐1, shKCTD15‐2, shKCTD15‐3). Data are presented as mean ± SD. ***p < 0.001 versus shCtrl group.

Figure S1B: Fluorescence microscopy images (×200 magnification) showing BT‐549 and MDA‐MB‐231 cells transduced with shCtrl, shKCTD15‐2, or shKCTD15‐3. Green fluorescence indicates successful viral transduction.

Yao L., Sun W., Xing J., and Feng J., “ KCTD15 Enhances Stem Cell‐Like Properties and Promotes Triple‐Negative Breast Cancer Progression Through KLF4/β‐Catenin Signaling,” The FASEB Journal 40, no. 4 (2026): e71563, 10.1096/fj.202503381R.

Data Availability Statement

The data used and/or analyzed during this study are available from the corresponding author on reasonable request.