Protocol to enhance pre-sexual and sexual differentiation of Toxoplasma gondii using retinal cells and intestinal organoid-derived monolayers

Summary

Toxoplasma gondii undergoes pre-sexual and sexual differentiation primarily in feline hosts, limiting experimental study. Here, we present a protocol for enhancing T. gondii stage differentiation using non-feline in vitro systems. We describe culturing human retinal pigment epithelial cells and murine intestinal organoid-derived monolayers in felid-environment-like with linoleic acid excess (FELIX) medium to mimic feline intestinal lipid biochemistry, combined with conditional MORC depletion to promote stage conversion. We detail procedures for host cell preparation, parasite culture, infection, and assessment of stage-specific gene and protein expression.

For complete details on the use and execution of this protocol, please refer to Cancela et al.¹

Graphical abstract

Highlights

• •Prepare hRPE cells and intestinal organoid-derived monolayers for infection
• •Culture host cells in FELIX medium to mimic feline intestinal lipid biochemistry
• •Induce MORC depletion to drive pre-sexual and sexual stage conversion
• •Assess parasite differentiation by gene- and protein-level stage-specific markers

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Toxoplasma gondii undergoes pre-sexual and sexual differentiation primarily in feline hosts, limiting experimental study. Here, we present a protocol for enhancing T. gondii stage differentiation using non-feline in vitro systems. We describe culturing human retinal pigment epithelial cells and murine intestinal organoid-derived monolayers in felid-environment-like with linoleic acid excess (FELIX) medium to mimic feline intestinal lipid biochemistry, combined with conditional MORC depletion to promote stage conversion. We detail procedures for host cell preparation, parasite culture, infection, and assessment of stage-specific gene and protein expression.

Before you begin

Innovation

This protocol establishes a reproducible, ethical, and scalable in vitro system that induces Toxoplasma gondii’s pre-sexual and sexual differentiation without reliance on feline hosts, overcoming the accessibility and throughput limitations of cat-based or partially effective culture approaches. Its innovation lies in the synergistic integration of three elements: (1) physiologically relevant host cells, (2) environmental metabolic modulation, and (3) targeted parasite genetic control.

First, human retinal pigment epithelial (hRPE) cells and murine intestinal organoid-derived monolayers (ODMs) are employed as non-feline epithelial models that naturally promote bradyzoite differentiation and support progression toward sexual stage. Second, FELIX medium (Felid-Environment Like with linoleic acid eXcess) recreates key feline intestinal biochemistry features by providing high linoleic and retinoic acid levels, essential for pre-sexual and sexual stage conversion. Third, conditional depletion of the chromatin regulator MORC, a master repressor of T. gondii’s sexual commitment, activates the transcriptional program that drives pre-sexual and sexual differentiation of the parasite.

By integrating these components, the protocol achieves robust and reproducible up-regulation of pre-sexual and sexual markers—including GRA81, GRA11b, PF16, and AO2—and enables direct visualization of their corresponding phenotypes within physiologically relevant epithelial environments. It merges host-derived metabolic cues with parasite epigenetic, providing the first fully defined, ethical system capable of generating sexual-stage signatures previously to feline hosts. This platform supports quantitative transcriptional profiling, high-resolution imaging, and controlled perturbation of developmental pathways. It advances the study of apicomplexan differentiation, enabling controlled interrogation of host specificity, metabolic triggers, and the regulatory circuitry governing T. gondii’s sexual commitment, while expanding experimental accessibility for the broader research community.

Institutional permissions

All animal-derived experiments were approved by the institutional committee Comisión de Ética en el Uso de Animales (CEUA) (protocol N° 002-21) and performed in accordance with Uruguayan national law (No.18.611) and international laboratory animal welfare guidelines. Researchers intending to reproduce this protocol must obtain equivalent institutional approvals and experimental animal handling credentials.

Media preparation

Timing: 30–60 min

For all the media described below see materials and equipment.

• 1.
  hRPE and Vero expansion media:

  • a.
    Supplement commercial Dulbecco’s Modified Eagle Medium (DMEM) with 10% (v/v) heat inactivated fetal bovine serum (FBS), 4 mM L-glutamine, 1% (w/v) penicillin/streptomycin under sterile conditions.

    Note: To heat-inactivate FBS, thaw the serum completely and incubate it in a water bath at 56°C for 30 min, gently swirling every 5–10 min to ensure even heating. Immediately cool the serum on ice, then aliquot it under aseptic conditions, and store at −20°C. Care should be taken not to exceed the indicated temperature or incubation time, as this may result in protein denaturation or excessive precipitation.

  • b.
    Mix the solution well and store at 4°C up to one month.
• 2.
  hRPE-FELIX media:

  • a.
    Supplement Roswell Park Memorial Institute 1640 medium (RPMI) with 1% (v/v) heat inactivated fetal bovine serum, 1% (w/v) penicillin/streptomycin, 50 mM HEPES, 10 μM trans-retinoic acid, and 200 μM linoleic acid.
  • b.
    Adjust the pH to 8.2 with 10 M NaOH.
  • c.
    Sterilize the solution using a 0.2 μm cellulose membrane filter.
  • d.
    Store at 4°C for up to one month protected from light exposure.

Note: Prepare small working volumes of medium instead of supplementing the entire RPMI bottle. Aliquot the required volume of base medium into sterile falcon tubes, add the supplements, adjust the pH, and sterilize the mixture by filtering it through a 0.2 μm syringe filter directly into a sterile recipient tube. Perform all steps inside a biosafety cabinet to maintain sterility and prepare fresh aliquots for each experiment whenever possible.

• 3.
  Organoid expansion media.

  • a.
    Prepare organoid base medium by supplementing Advanced DMEM/F12 with 1% (w/v) L-glutamine, 1% (w/v) penicillin/streptomycin, and 20% (v/v) fetal bovine serum under sterile conditions.
    To generate an organoid expansion medium, supplement the organoid base medium with 50% (v/v) L-WRN conditioned medium, under sterile conditions.

    Note: L-WRN conditioned medium can be produced in-house using the L-WRN cell line (ATCC CRL-3276), following the protocol described by Miyoshi and Stappenbeck, 2013²).

  • b.
    For initiation of cultures and after every passage, use the organoid expansion medium supplemented with 10 μM Y-27632 (ROCK inhibitor) and 10 μM SB431542 (TGF-β inhibitor).
  • c.
    For routine maintenance, replace the medium every 2–3 days using the organoid expansion medium without inhibitors.
  • d.
    Store all supplemented organoid media at 4°C and use within 7 days.
• 4.
  Organoid monolayer media (ODM media).

  • a.
    To prepare the ODM medium, supplement organoid expansion media with 10 μM Y-27632, 10 μM SB431542, 2.5 μM CHIR99021 (GSK-3 inhibitor), 10 μM SB202190 (p38 MAPK inhibitor), 1 mM N-acetyl cysteine and 10 mM nicotinamide.
  • b.
    Mix thoroughly and warm the complete ODM medium up to 37°C before use.
  • c.
    Store at 4°C for up to 7 days.
• 5.
  Organoid-FELIX media.

  • a.
    Prepare fresh ODM media and under sterile conditions supplement it with 200 μM free linoleic acid to mimic the high-linoleic-acid environment of the feline intestine.
  • b.
    Under sterile conditions add the delta-6-desaturase inhibitor SC-26196 (D6D) (20 μM) to prevent host lipid desaturation.
  • c.
    Mix gently to ensure complete dissolution of linoleic acid and warm the medium up to 37°C before use.
  • d.
    Store at 4°C protected from light exposure; prepare fresh every week due to the oxidation of linoleic acid.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit anti-Sag1 (dilution 1:500)	Dr. Dominique Soldati, Université de Genève	NA
Rat anti-Cc2 (dilution 1:20)	Dr. Dominique Soldati, Université de Genève	NA
Mouse anti-GRA11b (dilution 1:200)	Dr. Chandra Ramakrishnan, University of Zurich	NA
Rabbit anti-H2Bz (dilution 1:500)	Dr. Laura Vanagas, INTECH-Chascomus	NA
Mouse anti-AO2 (dilution 1:200)	Dr. Chandra Ramakrishnan, University of Zurich	NA
Goat anti-rat IgG Alexa Fluor 488 (dilution 1:2000)	Invitrogen	A11006; RRID: AB_2534074
Goat anti-mouse IgG Alexa Fluor 488 (dilution 1:2000)	Invitrogen	A28175; RRID: AB_2536161
Goat anti-rabbit IgG Alexa Fluor 488 (dilution 1:2000)	Invitrogen	A11008; RRID: AB_143165
Goat anti-rabbit IgG Alexa Fluor 594 (dilution 1:2000)	Invitrogen	A11012; RRID: AB_2534079
Biological samples
C57BL/6J mouse intestinal tissue (6–8 weeks old, male and female)	Laboratory Animal Biotechnology Unit, Institut Pasteur Montevideo	NA
Chemicals, peptides, and recombinant proteins
DMEM	Gibco	10569–010
Advanced DMEM/F12	Gibco	12634–010
RPMI-1640	Gibco	61870–036
Pen Strep	Gibco	15140–122
Glutamine	Gibco	25030–081
Glutamax 100x	Gibco	35050038
Fetal bovine serum	Capricorn	FBS-11A
DPBS 1X, calcium and magnesium free	Sigma	D1408
EDTA	Sigma	ED255
TrypLE Express	Gibco	12605028
trans-retinoic acid	Abcam	120728
Linoleic acid	Sigma	62240
HEPES	Sigma	H3375
Indoleacetic acid (IAA)	Sigma	I2886
Paraformaldehyde	Sigma	158127
SC-26196 (D6D)	Sigma	218136-59-5
Bovine Serum Albumin (BSA)	Sigma	A2153
Matrigel (Growth Factor Reduced, phenol red-free)	Corning	356231
Y-27632	Tocris	1254
SB431542	Tocris	1614
CHIR99021	Tocris	4423
SB202190	Tocris	1264
Nicotinamide	Sigma	N0636
N-Acetyl-L-cysteine	Sigma	A9165
L-WRN conditioned medium	prepared in-house	NA
ProLong Gold Antifade Reagent	Invitrogen	P36930
DAPI	Thermo Fisher Scientific	62248
DNAse I	Zymo Research	E1011
Methanol	Sigma	200-659-6
Critical commercial assays
Direct-zol RNA Miniprep Kit	Zymo Research	R2052
Monarch Total RNA Miniprep Kit	New England Biolabs	T2010S
SuperScript II Reverse Transcriptase	Invitrogen	18064014
M-MLV Reverse Transcriptase	Thermo Fisher Scientific	28025013
FastStart Universal SYBR Green Master Mix	Roche	04 913 850 001
Experimental models: Cell lines
Vero (african green monkey kidney epithelial cells)	ATCC	CCL-81
hRPE (human retinal pigmented epithelial)	ATCC	CRL-4000
L-WRN (murine fibroblast line producing Wnt-3A, R-spondin 3, and noggin-conditioned medium)	ATCC	CRL-3276
C57BL/6J murine intestinal organoids	Cell Biology Unit, Institut Pasteur Montevideo	NA
Experimental models: Organisms/strains
Toxoplasma gondii, PruΔku80 MORC-mAID-Tir-HA	Farhat et al.3	NA
Oligonucleotides
TUBA1 (TGME49_116400)	Martorelli et al.4 Synthesized by IDT	F: GACGACGCCTTCAACACCTTCTTT R: AGTTGTTCGCAGCATCCTCTTTC
GRA11b (TGME49_237800)	Martorelli et al.4 Synthesized by IDT	F: ATCAAGTCGCACGAGACGCC R: AGCGAATTGCGTTCCCTGCT
SAG1 (TGME49_233460)	Designed by NCBI primer tool. Synthesized by IDT	F: AGCATTTCCAGCCGAGTCAA R: TGCACGGTACAGTGATGCTT
BAG1 (TGME49_259020)	Designed by NCBI primer tool. Synthesized by IDT	F: GATGACGTAACCATAGAAGTCGACAAC R:GCAAAATAACCGGACACTCGCTCAGTC
GRA81 (TGME49_243940)	Designed by Quantprime. Synthesized by IDT	F: CTCGAAAACCCGAACATCGC R: CCCTTCCAAGCTGGACAAGT
PF16 (TGME49_297820)	Designed by Quantprime. Synthesized by IDT	F: CACACCTAGCTGCCTTGGAA R: GGCAAAACCTTGGCGTACTG
IFT122 (TGME49_218290)	Designed by Quantprime. Synthesized by IDT	F: GCAAAAGCGTTCACACGACT R: TGCGCTGTCGAAGAAGAGTT
AO2 (TGME49_286778)	Designed by Quantprime. Synthesized by IDT	F: GACCGTTATATCCGTGACAACGAG R:TATGCCAAACAGAGGACGCAAC
Software and algorithms
ImageJ	Schneider et al.5	https://imagej.nih.gov/ij/
Graphpad/Prism	GraphPad Software, Boston, Massachusetts USA	version 10.0.0 for Mac
Biorender		https://BioRender.com/8qv8zcg
Other
Biosafety level 2 cabinet (BSL2)	Haier medical	HR30- IIA2
0.2 μm cellulose membrane filter	Sartorius	16534
Cell counting chamber/hemocytometer	Biosigma	BVS100
Vented and sealed cap T25- flask	Corning	430639 and 430168 respectively
Sterile cell scrapers	Corning	3010
27-gauge syringe needle	BD emerald	305109
3 μm pore size polycarbonate filter	Sigma	TSTP14250
CO2 c ell culture incubator	Esco life sciences	CCL- 170B-8
6 and 24-well plates	Corning	3516 and 3524, respectively
Bright-field inverted microscope (20× 0.3 NA and 40× 0.8 NA objectives)	Zeiss	Primovert
70 μm cell strainer	Corning	431751
Spectrophotometer (e.g., Nanodrop)	DeNovix Inc	DS-11
Freezers −80°C	Thermo Fisher Scientific	Forma 88000 serie
Real-time PCR machine	Thermo Fisher Scientific	QuantStudio 3 System
Confocal microscope (oil 25× 0.8 NA and 63× 1.4 NA objectives)	Zeiss	LSM 800

Materials and equipment

Vero expansion media

Reagent	Final concentration
Dulbecco’s Modified Eagle Medium (DMEM)	N/A
Fetal bovine serum (FBS)	10% (v/v)
L- glutamine	4mM
penicillin/streptomycin	1% (w/v)

Store at 4°C for up to one month.

hRPE-FELIX media

Reagent	Final concentration
Roswell Park Memorial Institute 1640 medium (RPMI)	N/A
Fetal bovine serum (FBS)	1% (v/v)
penicillin/streptomycin	1% (w/v)
HEPES	50 mM
Trans-retinoic acid	10 μM
Linoleic acid	200 μM

Store at 4°C for up to one month protected from light exposure.

Organoid expansion media

Reagent	Final concentration
DMEM/F12	N/A
L-glutamine	1% (w/v)
penicillin/streptomycin	1% (w/v)
Fetal bovine serum (FBS)	20% (v/v)
L-WRN conditioned medium	50% (v/v)
Y-27632	10 μM
SB431542	10 μM

Store all supplemented organoid media at 4°C and use within 7 days.

Organoid monolayer media

Reagent	Final concentration
Organoid expansion media	N/A
CHIR99021	2.5 μM
SB202190	10 μM
N-acetyl cysteine	1 mM
Nicotinamide	10 mM

Store at 4°C for up to 7 days.

Organoid-FELIX media

Reagent	Final concentration
Organoid monolayer media	N/A
Linoleic acid	200 μM
SC-26196	20 μM

Store at 4°C protected from light exposure; prepare fresh every week due to the oxidation of linoleic acid.

Step-by-step method details

Maintenance of Toxoplasma gondii

Timing: 5–7 days

This section describes the culture and passage of the T. gondii PruΔku80 MORC-mAID-Tir-HA strain (Farhat., 2020),³ which can be maintained in Vero cells prior to experimental infections.

• 1.
  Obtaining extracellular T. gondii from tissue culture.

  • a.
    When Vero cells reach 80%–90% confluence, infect them with extracellular tachyzoites at a multiplicity of infection (MOI) of 1:3 under sterile conditions using a biosafety level 2 cabinet.

    Note: To adjust the MOI, determine the number of parasites and host cells using a standard cell counting chamber.

  • b.
    Allow parasites to infect and proliferate for 2–3 days. Host cell lysis will start to become apparent at this time.
  • c.
    Collect the infected host cells from the surface of the culture dish or flask using a cell scraper.
  • d.
    Pass it through a 27-gauge syringe needle at least five times to physically disrupt host cells and release intracellular parasites.

    CRITICAL: Insufficient mechanical disruption with a syringe or using an incorrect size syringe can significantly reduce parasite recovery.

  • e.
    Pass the syringe-lysed suspension through a 3 μm pore size polycarbonate filter to remove host cell debris.
  • f.
    Centrifuge at 400 g for 10 min at 25°C to pellet the extracellular parasites.
  • g.
    Discard the supernatant and wash the pellet with PBS 1 X. Centrifuge again at 400 g for 10 min at 25°C to recover extracellular parasites.
  • h.
    Resuspend parasites in fresh DMEM media and use them to infect new Vero cells for T. gondii maintenance or for downstream assays.

    Note: Ensure Vero cell monolayers remain 80%–90% confluent before parasite passage to prevent host cell detachment. Use low-passage cells (passage ≤ 30) and confirm that cultures are free of Mycoplasma contamination before infection.

Preparation of host cell cultures

Timing: 3–7 days

This section describes cell line culture and the establishment of murine intestinal organoid-derived monolayers (ODMs). ODMs provide a confluent, two-dimensional epithelial surface compatible with T. gondii’s apical invasion and are used in this protocol as an alternative to 3D organoid structures which require “flipping” in order to provide akin conditions.

• 2.
  hRPE cell culture.

  • a.
    Completely thaw a vial of frozen hRPE cells by immersing it in a water bath at 37°C for 2–3 min.
  • b.
    Transfer the thawed cell suspension into a 5 ml cell culture T-25 flask containing 5 ml of pre-warmed hRPE-expansion medium, under sterile conditions. Replace the medium after 24 h to remove DMSO present in the freezing medium.

    Note: Alternatively, transfer the thawed cell suspension into a 15 ml Falcon tube containing 5 mL pre-warmed hRPE-expansion medium, centrifuge the tube at 300 g for 5 min at 25°C. Resuspend cells in 5 mL hRPE-expansion medium and transfer to a T-25 culture flask.

  • c.
    Place the culture plate in a 37°C, 5% CO₂ incubator and allow cells to reach confluency.

    Note: Ensure even distribution of cells by gently rocking the plate in a cross pattern immediately after seeding.

  • d.
    Monitor cells regularly under a bright-field microscope until they reach approximately 80%–90% confluency.

    Note: hRPE cells should exhibit a cobblestone-like monolayer morphology. Deviations may indicate stress, contamination, or differentiation drift.

• 3.
  Intestinal organoid culture.

  CRITICAL: Work on ice during crypt isolation to preserve the viability of the cells.

  • a.
    Euthanize C57BL/6J mice (6–8 weeks, male or female) following institutional guidelines and dissect the small intestine.
  • b.
    Cut the intestine into sections of approximately 5 cm using sterile surgical scissors and wash quickly in a 50 mL conical tube containing 70% ethanol. Transfer to a 50 mL conical tube with ice-cold sterile PBS containing 1% penicillin/streptomycin (PBS0) and keep on ice.
  • c.
    Flush the lumen with PBS0 to remove contents, using a 10 mL syringe with a 20–200 μL tip as a needle.
  • d.
    Inside the hood, using a sterile petri dish, open each segment longitudinally, spread the tissue with forceps, and cut into 0.5 cm fragments.
  • e.
    Transfer the fragments to a 50 mL conical tube containing 10–15 mL of ice-cold PBS0 and invert the tube several times, let the fragments settle by gravity and carefully remove the supernatant. Wash fragments repeatedly until the supernatant becomes clear.
  • f.
    Incubate tissue fragments in 20 mL of ice-cold 10 mM EDTA in PBS (prepare fresh by diluting 1/50 stock 0.5 M pH 8 in PBS0; pH should be around 7) for 20 min at 4°C with gentle agitation.

    Note: Meanwhile, transfer the matrix tube(s) from the freezer to the refrigerator (4°C). Also, refrigerate the centrifuge at 4°C and place the 6-multiwell plate in the incubator.

  • g.
    Let the fragments settle by gravity and remove EDTA.
  • h.
    Resuspend fragments in 10 mL of 0.1% BSA in PBS.
  • i.
    Pipette the suspension up and down five times using a 10 mL pipette to release intestinal crypts.
  • j.
    Transfer the supernatant into a 15 mL tube (Fraction 1).
  • k.
    Repeat steps h-i at least two more times to obtain Fractions 2 and 3.
  • l.
    Place 10–20 μL of each fraction on a glass slide and check under a microscope for the presence of villi and/or crypts.

    Note: It is expected that the number of villi will decrease and the number of crypts will increase progressively in subsequent fractions.

    Note: If crypt-enriched fractions are not obtained, repeat the EDTA incubation, reducing the time up to 10 min (see troubleshooting 1).

  • m.
    Collect crypt-enriched fractions and pass the suspension through a 70 μm cell strainer.
  • n.
    Centrifuge the flow-through at 200 g for 5min at 4°C.
  • o.
    Discard the supernatant and resuspend the crypt pellet in Advanced DMEM/F12 (2–3 mL).
  • p.
    Count the number of crypts present in 20 μL and calculate the total number of crypts by multiplying by the total volume.

    Note: A typical mouse small intestine yields approximately 8,000–12,000 viable crypts, depending on the intestinal segment and isolation efficiency.

  • q.
    Centrifuge the flow-through at 200 g for 5 min at 4°C.
  • r.
    Remove the supernatant as much as possible to avoid diluting the matrix in the next step.
  • s.
    Flick the tube to resuspend cells. Place the tube on ice to prevent Matrigel polymerization in the next step.
  • t.
    Resuspend counted crypts in phenol red-free, growth factor–reduced ice-cold Matrigel at a density of 300 crypts per 20 μL.
  • u.
    Seed 20 μL Matrigel domes into each well of a 6-well plate and incubate upside down for 10 min at 37°C to allow polymerization.
  • v.
    Add 2 mL per well of organoid expansion medium composed of Advanced DMEM/F12 supplemented with 1% L-glutamine, 1% (w/v) penicillin/streptomycin, and 50% L-WRN–conditioned medium.
  • w.
    Supplement the medium with 10 μM Y-27632 and 10 μM SB431542 during initial establishment.
  • x.
    Incubate cultures at 37°C in a humidified 5% CO₂ incubator.
  • y.
    Replace organoid medium every 2–3 days using organoid expansion medium without inhibitors after initial establishment. See Figure 1A for a schematic representation of the crypt isolation protocol.
  • z.
    Passage organoids every 4–5 days at a 1:2 or 1:3 ratio (see troubleshooting 2, 3, and 4).

    • i.
      Warm organoid expansion medium supplemented with Y-27632 and SB431542.
    • ii.
      Mechanically disrupt Matrigel domes and transfer organoids into cold PBS.
    • iii.
      Centrifuge at 200 g for 5 min at 4°C and resuspend the pellet in fresh Matrigel.
    • iv.
      Seed new Matrigel domes and continue culture as described above. Figure 1C shows a representative image of organoids seeded in Matrigel domes.
• 4.
  Intestinal organoid-derived monolayer culture (ODM):

  CRITICAL: Use organoids between passages 3 and 8 for monolayer cultures to ensure reproducibility.

  • a.
    Prepare a 1:10 Matrigel:PBS solution on ice.
  • b.
    Add 120 μL of the diluted Matrigel solution to each well of a 24-well plate.
  • c.
    Incubate plates for ≥1 h at 37°C to allow proper coating (see troubleshooting 5).
  • d.
    Use organoids at day 3 of culture, when they display a healthy morphology—well-defined borders, clear luminal structures, and minimal cellular debris—as these conditions indicate an appropriate stage for dissociation into monolayers (Figures 1D and 1E).

    Note: To achieve an optimal seeding density for generating organoid-derived monolayers, use approximately six high-density organoid domes from a single well of a 6-well plate (6 × 10⁵ cells) and seed three wells of a 24-well plate (2 × 10⁵ cells/each). This proportion provides enough epithelial material to promote efficient attachment and uniform monolayer formation.

  • e.
    Dislodge Matrigel domes by gently pipetting with ice-cold PBS.
  • f.
    Transfer the suspension into a pre-chilled 15 mL conical tube.
  • g.
    Centrifuge at 200 g for 5 min at 4°C.
  • h.
    Discard supernatant and wash organoids twice with ice-cold PBS using the same centrifugation conditions.
  • i.
    Resuspend organoids in TrypLE Express (1×) supplemented with 10 mM Y-27632.

    Note: ROCK inhibitor (Y-27632) is essential during dissociation and early plating to enhance cell survival (see troubleshooting 6).

  • j.
    Incubate for 4 min at 37°C.

    CRITICAL: Enzymatic digestion time must be strictly respected to prevent over-digestion and loss of viable cells (see troubleshooting 7).

  • k.
    Gently shake or flick the tube every 2 min to facilitate dissociation.
  • l.
    After incubation, inactivate TrypLE by adding an equal volume of complete organoid medium.
  • m.
    Mechanically dissociate further by pipetting up and down until obtaining a single-cell suspension.

    CRITICAL: Mechanical dissociation must be gentle to avoid damaging the epithelial layer–forming population (see troubleshooting 7).

  • n.
    Count viable cells using Trypan Blue exclusion method.
  • o.
    Prepare ODM medium.
  • p.
    Seed 2 × 10⁵ cells per well onto Matrigel-coated wells, prepared as indicated above.
  • q.
    Gently rock the plate to distribute cells evenly.
  • r.
    Incubate at 37°C in 5% CO₂.
  • s.
    Replace by ODM medium every 2 days.
  • t.
    Maintain cultures until a uniform, confluent monolayer forms. Typically 3–4 days after seeding (see troubleshooting 8 and 9).
    See Figure 1B for a schematic representation of the organoid-derived monolayer culture protocol.

    Note: Confirm epithelial monolayer integrity under the microscope before infection by ensuring it is continuous, free of gaps or lifted areas, and that cells exhibit uniform morphology with intact cell–cell junctions.

    Note: ODMs provide reliable apical access for parasite infection, overcoming the limited apical exposure typically observed in 3D organoid systems.

Figure 1.

Workflow for intestinal organoid generation and monolayer preparation

(A) Schematic representation of tissue processing, crypt isolation, and embedding in BME domes to establish 3D intestinal organoids.

(B) Overview of organoid dissociation and seeding onto wells to generate organoid-derived monolayers (ODMs).

(C) BME domes containing organoids; (D) Bright field image of organoids ready for ODM seeding; (E) Bright field image of organoids not suitable for ODM seeding. They have overgrown and there are too many dead cells in the lumen. Scale bar: 100 μm. Created with Biorender.com.

Cell culture infections and induction of parasite (sexual) differentiation

Timing: 7 days

This step details the infection of hRPE (Figure 2A) and ODMs (Figure 3A) under FELIX treatment combined with conditional MORC depletion to drive T. gondii toward pre-sexual and sexual differentiation.

• 5.
  hRPE infection with T. gondii.

  • a.
    One day before infection, seed hRPE cells in sealed cap T25 flasks) to reach 80%–90% confluence at the time of infection following cell culture description in section 2 (Figure 2B).

    Note: Only for cell culture infections to induce parasite differentiation experiments, T25 flasks with sealed caps are used in order to avoid gas exchange. All other experiments are performed using vented T25- flasks.

  • b.
    Proceed to infect cell cultures with the parasite strain at a 1:3 MOI. The culture flask caps should not be fully tightened (Figure 2C).
  • c.
    After 24 h of infection, change the culture medium to initiate parasite differentiation using FELIX-hRPE media.

    • i.
      Incubate the cultures in FELIX-hRPE media at 37°C and under low CO₂ conditions by closing the flasks’ lids shut for a total of 7 days, replacing the media every other day.

      Note: Handle the plates gently to avoid detachment of adherent cells.

  • d.
    Five days after parasite infection (day 6 of the protocol), induce MORC depletion by adding 500 μM indoleacetic acid (IAA) directly to the culture medium, and continue incubation for 2 additional days, completing a total of 7 days of culture.
• 6.
  Infection of ODMs.

  • a.
    On day −4, seed ODMs on 10% BME coated 13 mm coverslips or wells in ODM medium until 80% confluence. Change the media every other day (Figure 3B).
  • b.
    On day −2 replace ODM medium with ODM-FELIX medium for treated wells and with standard ODM medium for controls. Prepare ODM-FELIX medium fresh by supplementing prewarmed medium with linoleic acid (final 200 μM) and delta-6-desaturase inhibitor, D6D (final 20 μM).

    Note: Protect ODM-FELIX media from light and mix gently before use.

  • c.
    Incubate monolayers in ODM-FELIX for 24 h at 37°C and 5% CO₂.
  • d.
    On day 0 harvest freshly egressed tachyzoites from Vero cell lysates by syringe passage and filter/clarify as described in the parasite maintenance section.
  • e.
    Count parasites using a hemocytometer and adjust concentration to obtain MOI 1:6.

    Note: Keep parasite suspensions on ice and use them within 1 h to preserve viability.

  • f.
    Infect FELIX-treated and control ODMs with PruΔku80 MORC–mAID–Tir-HA tachyzoites at MOI 1:6 and incubate for 2 h at 37°C in a CO₂ incubator to allow invasion (see troubleshooting 10) (Figure 3C).
  • g.
    After incubation, remove inoculum and wash monolayers twice with prewarmed 1× PBS.
  • h.
    Replace medium with FELIX (for treated wells) or with ODM medium (for controls). Immediately add indole-3-acetic acid (IAA) at a final concentration of 500 μM to trigger MORC degradation. Maintain parallel −IAA controls.
  • i.
    Replace FELIX + IAA (or appropriate control medium) every 48 h if incubations are extended.

    Note: Avoid prolonged continuous IAA exposure beyond the endpoint (see limitations section).

  • j.
    Incubate cultures for 48 h post-infection and then process for RNA extraction and/or immunofluorescence assay (IFA).

    Note: Include biological replicates (minimum n=3).

Figure 2.

Experimental workflow for T. gondii infection and stage conversion using hRPE cells

(A) Schematic workflow and timeline for infecting hRPE cultures with T. gondii and the inducing stage conversion.

(B) Confluent hRPE monolayer before and (C). after T. gondii infection under controlled culture conditions. White dashed circles indicate intracellular parasites. Scale bar: 50 μm. Created with Biorender.com.

Figure 3.

Experimental workflow for T. gondii infection and stage conversion using ODM

(A) Schematic workflow and timeline of the infection of ODM with T. gondii and the induction of stage conversion.

(B) Confluent ODM before and C. after T. gondii infection.Scale bar: 50 μm.

Created with Biorender.com.

Gene expression detection

Timing: 1–3 days

This major step describes the RNA isolation, cDNA synthesis, and gene expression detection of Toxoplasma gondii–infected hRPE monolayers and intestinal ODMs to visualize pre-sexual and sexual stage markers under FELIX and IAA conditions.

• 7.
  Isolate total RNA from infected hRPE or ODMs.

  • a.
    Collect the infected cultures hRPE by complete media removal and addition of 500 μl of Trizol directly to the T25-flasks.
  • b.
    Collect the infected cultures ODMs by complete media removal and addition of 350 μl of the commercial Monarch StabiLyse DNA/RNA Buffer directly to the well.
  • c.
    Proceed immediately to RNA extraction to prevent RNA degradation. Extract RNA using Direct-zol™ RNA Miniprep Kit for hRPE infected cultures or Monarch Total RNA Miniprep Kit for ODMs infections according to the manufacturer’s protocols (https://files.zymoresearch.com/protocols/_r2050_r2051_r2052_r2053_direct-zol_rna_miniprep.pdf and https://www.neb.com/en/protocols/quick-protocol-for-monarch-total-rna-miniprep-kit-neb-t2010).
  • d.
    Elute RNAs in nuclease-free water.
  • e.
    Quantify RNA concentration using a spectrophotometer (e.g., Nanodrop) and assess purity by the A260/A280 ratio (see troubleshooting 11).

CRITICAL: Handle all reagents and samples using RNase-free plasticware and reagents to prevent RNA degradation.

Pause point: Total RNA can be stored at −80°C prior to cDNA synthesis. However, proceeding directly to cDNA synthesis generally minimizes the risk of RNA degradation, but short pauses at this stage are acceptable when needed.

• 8.
  Synthesize first-strand cDNA.

  • a.
    Use 0.5–1 μg of total RNA as the template for cDNA synthesis.
  • b.
    Prepare the DNase I treatment by pipetting 30 U DNase I, 75 μl DNA digestion buffer, and 0.5–1 μg of total RNA and proceed to incubate the reactions at 30°C for 30–60 min.
  • c.
    Prepare reverse transcription reactions using either SuperScript™ II Reverse Transcriptase or M-MLV Reverse Transcriptase, following the manufacturer’s instructions (https://documents.thermofisher.com/TFS-Assets/LSG/manuals/superscriptII_pps.pdf and https://documents.thermofisher.com/TFS-Assets/LSG/manuals/mmlv_rt_man.pdf).
  • d.
    Include oligo(dT)₁₈ primers in the reaction as recommended by the supplier.
  • e.
    Incubate reactions according to kit specifications (typically 42°C for 50 min, followed by 70°C for 15 min to inactivate the enzyme).
  • f.
    Dilute the synthesized cDNA with ultrapure water RNAase free to 1/50 to proceed with qPCRs.

Pause point: The synthesized cDNA can either be used immediately for qPCR analysis or kept at −20°C for long term storage.

• 9.
  Prepare and run qPCR reactions.

  • a.
    Prepare at least two technical replicates for each sample under the different treatments (see table below).

    Treatments	FELIX	IAA	Replicates
    1	–	–	≥2
    2	–	+	≥2
    3	+	–	≥2
    4	+	+	≥2

  • b.
    Set the FastStart Universal SYBR Green Master mix following the manufacturer’s instructions with 30 μM of the appropriate primer mix (forward and reverse mixed to a final concentration of 30 μM each). Use 2.5 μl of 1/50 cDNA dilution as a template (see table below).
    PCR reaction master mix

    Reagent	Amount
    cDNA template	2.5 μl
    SYBR Green Master mix	6,25 μl
    Primer F (30 μM)	0,25 μl
    Primer R (30 μM)	0,25 μl
    ddH2O	15,75 μl

    Note: See KRT for primers names and sequences.

  • c.
    Set up reactions in a QuantStudio 3 System real-time PCR machine using the following program: initial denaturation: 95°C for 10 min, amplification: 40 cycles of 95°C for 10 s and 60°C for 60 s (see table below).

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	95°C	10 min	1
Denaturation	95°C	10 s	40 cycles
Annealing	60°C	30 s
Extension	60°C	30 s

Note: Include no-template controls to monitor contamination.

• 10.
  Analyze qPCR data.

  • a.
    Normalize gene expression of genes of interest (GOI) to the alpha tubulin 1 reference gene (TGME49_116400) to obtain ΔCt values.
  • b.
    Calculate the relative expression (fold change) using the formula: 2^−ΔΔCt, where ΔΔCt(GOI) = ΔCt(GOI)_treatment–ΔCt(GOI)_control.
  • c.
    Compare each condition against the control (-FELIX -IAA).

Note: Pursue analysis of a minimum of three biological replicates to validate gene expression changes.

IFA

Timing: 2 days

This major step describes the fixation, staining, and imaging of T. gondii–infected hRPE monolayers and intestinal ODMs to visualize pre-sexual and sexual stage markers under FELIX and IAA conditions.

• 11.
  Fixation.

  • a.
    Fix hRPE monolayers by incubating coverslips in cold methanol at −20°C for 5 min.
  • b.
    Fix ODMs by incubating coverslips in 4% PFA at 25°C for 20 min.
  • c.
    Wash all coverslips twice with cold 1× PBS to remove residual fixative.
• 12.
  Blocking and Permeabilization.

  • a.
    Block hRPE monolayers in 1× PBS containing 3% (w/v) BSA for 10 min at 25°C or block ODMs in 1× PBS containing 3% (w/v) BSA for 1 h at 25°C.
  • b.
    Permeabilize ODMs (only when PFA-fixed) in 1× PBS containing 3% (w/v) BSA and 0.3% Triton X-100 for 20 min at 25°C.

Note: Specified blocking times should not be exceeded, as prolonged incubation can lead to detachment of ODM monolayers.

• 13.
  Primary and secondary antibody incubations.

  • a.
    Prepare primary antibodies dilutions in 1× PBS supplemented with 3% (w/v) BSA.
  • b.
    Incubate coverslips with 50 μl of the primary antibody solution for 1 h at 25°C in a humid chamber.
  • c.
    Use the following primary antibodies as required:

    • i.
      Rabbit anti-CC2 (bradyzoite cyst wall marker) at 1/20 dilution.
    • ii.
      Rabbit anti-GRA11b (merozoite marker) at 1/200 dilution.
    • iii.
      Rabbit anti-AO2 (macrogamete marker) at 1/200 dilution.
    • iv.
      Mouse anti-H2Bz (parasite nuclear marker) at 1/500 dilution.

      Note: IFIs are typically performed using a combination of each stage-dependent marker with the nuclear marker H2Bz to identify total parasites.

  • d.
    Wash coverslips 3 times in 1× PBS for 10 min each to remove unbound antibodies.
  • e.
    Incubate coverslips with Alexa Fluor–conjugated secondary antibodies (488 or 568), diluted at 1/2000 in PBS + 3% BSA, for 1 h at 25°C in the dark.
  • f.
    Wash coverslips 3 additional times in 1× PBS for 10 min each to remove excess secondary antibody. DAPI staining can be performed in the second PBS wash (see troubleshooting 12).

    Note: Antibody incubations can be performed on Parafilm by placing a small drop of antibody solution on the surface and gently laying the coverslip (cell-coated side down) onto the drop to ensure even contact and minimize reagent use.

• 14.
  Mounting.

  • a.
    Counterstain with DAPI (1 μg/mL added to the last PBS wash) for 10 min, rinse briefly with 1× PBS.
  • b.
    Mount coverslips onto glass slides using ProLong™ Glass Antifade Mountant.

    CRITICAL: Carefully manipulate each coverslip using a fine needle and watchmaker’s forceps to invert them so that the cell-coated side directly contacts the ProLong Glass Antifade Mountant. Handle gently to avoid breaking the coverslip and to ensure correct orientation of the monolayer.

  • c.
    Allow slides to dry 12 h at 25°C in the dark before imaging.
  • d.
    Mount slides immediately after staining to prevent signal loss.

    CRITICAL: Protect samples from light during and after secondary antibody incubation to preserve fluorophore stability.

• 15.
  Imaging acquisition and processing.

  • a.
    Acquire fluorescence images using a fluorescence microscope equipped with oil 25× (0.8 NA) and 63× (1.4 NA) objectives.

    Note: Maintain identical exposure times, gain settings, and acquisition parameters across experimental conditions to ensure comparability.

  • b.
    Use Fiji (ImageJ) to quantify the percentage of parasites in each developmental stage. Merozoites are quantified by measuring the mean of GRA11b-positive signals relative to the total parasite population identified by H2Bz or DAPI.

    • i.
      Launch Fiji and open the acquired fluorescence images.
    • ii.
      Separate the different channels and work on them separately.
    • iii.
      Select the H2Bz or DAPI channel to quantify total parasite nuclei. Adjust the threshold (Image → Adjust → Threshold) to segment all parasite nuclei. Convert the thresholded image to a mask (Process → Binary → Make Binary). Count nuclei using Analyze → Analyze Particles.

      Note: Ensure that nuclei are fully segmented without merging.

    • iv.
      Select the GRA11b channel to quantify the GRA11b signal. Apply a threshold to segment positive signals (Image → Adjust → Threshold). Convert to a binary mask (Process → Binary → Make Binary). Use Analyze → Analyze Particles to identify and quantify GRA11b-positive objects.

      CRITICAL: GRA11b signal intensity may vary. Select a threshold that detects true signal while minimizing background. Use the same threshold for all sample images.

    • v.
      Determine the percentage of merozoites within the total parasite population using the equation:

      $$\%Merozoites=((n°GRA11bpositiveparasite\times 100)/n°totalparasitesDAPIorH2bzpositive))$$

      Note: GRA11b-positive vacuoles (merozoites) and CC2-positive vacuoles (bradizoites) are abundant in FELIX + IAA-treated samples (∼50–60% of total parasites. AO2-positive structures (macrogamete-like) are rare but detectable.

Expected outcomes

When performed as described, this protocol yields reproducible induction of pre-sexual and early sexual differentiation of Toxoplasma gondii in non-feline epithelial systems. Researchers can expect to observe clear morphological transitions of intracellular parasites, including modified vacuole organization and altered parasite shape consistent with progression through differentiation stages. At the molecular level, FELIX medium combined with conditional MORC depletion produces strong transcriptional response: GRA11b expression typically increases by two orders of magnitude relative to standard media both on hRPE cell culture (Figure 4A) and in ODMs (Figure 5A), while sexual and gamete-associated markers such as AO2 and PF16 show marked upregulation under dual treatment (see Cancela & Sena., 2025 for details).¹ These transcriptional signatures can be quantified by qPCR, providing a robust readout of differentiation efficiency.

Figure 4.

Detection of sexual commitment of T. gondii infection in hRPE cultures

(A) Relative expression (2^–ΔΔCt) of the pre-sexual marker GRA11b with (+) or without (−) FELIX media and/or IAA induction. Data represent mean ± SEM; statistical significance was assessed by ANOVA (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n = 3).

(B) Immunofluorescence assay (IFA) to detect GRA11b (green) and DAPI-stained host nuclei in hRPE cell cultures under FELIX media and IAA treatment.

(C) Quantification of merozoites from IFA. The percentage of merozoite is represented as the mean of GRA11b-positive signal in relation to the total parasite marked with DAPI.

Figure 5.

GRA11b induction and visualization of pre-sexual differentiation in FELIX + IAA–treated ODMs

(A) Relative expression of GRA11b (2^–ΔΔCt) in PruΔku80 MORC–mAID–Tir-HA parasites cultured in ODMs with or without FELIX and/or IAA. Data represent mean ± SEM; statistical significance was assessed by ANOVA (∗p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n = 3).

(B) Immunofluorescence of merozoite marker GRA11b (green), parasite nuclei (H2Bz, magenta), and DAPI-stained host nuclei. Scale bar: 10 μm.

(C) Quantification of GRA11b⁺ parasites relative to total H2Bz⁺ parasites, shown as mean ± SEM with ANOVA significance (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n = 50).

Immunofluorescence assays further validate the induction of the differentiation process. Under FELIX + IAA conditions, parasitophorous vacuoles frequently exhibit strong GRA11b labeling in both hRPE cells and intestinal ODMs (Figures 4A and 5B), reflecting activation of pre-sexual programs. Quantification of immunofluorescence images showed a marked increase in GRA11b-positive vacuoles (≈60%) in hRPE and ODM exposed to combined FELIX and IAA treatment compared with either condition alone (Figures 4C and 5C). Researchers may also detect rare but distinct AO2-positive structures, consistent with early macrogamete-like differentiation, as well as CC2 staining, indicating bradyzoite-like intermediate states. These phenotypes are robustly reproducible across biological replicates and across the two models presented herein.

Together, these outcomes demonstrate that the system reliably recapitulates in vitro activation of differentiation pathways and provides both qualitative (microscopy-based) and quantitative (gene-expression–based) evidence of developmental progression. While full gametogenesis is not achieved, the protocol enables detailed analysis of the molecular and cellular mechanisms that govern commitment to the sexual cycle, and it provides a controlled, ethical, and accessible in vitro platform for studying host, metabolic, and epigenetic determinants of T. gondii sexual development.

Limitations

This protocol reliably induces pre-sexual and early sexual differentiation of Toxoplasma gondii, but several limitations should be considered. Although FELIX treatment combined with MORC depletion activates robust expression of sexual and pre-sexual markers, the system does not support full gamete maturation or oocyst wall formation and therefore cannot recapitulate the complete feline-dependent sexual cycle. The efficiency of induction is also highly dependent on the host epithelial model; while hRPE cells and intestinal organoid-derived monolayers (ODMs) are permissive, many other epithelial cell lines fail to sustain comparable levels of sexual differentiation, limiting generalizability across host systems. Prolonged exposure to FELIX medium and IAA may compromise both host cell viability and parasite fitness, reducing the reproducibility of late-stage phenotypes. In addition, key FELIX components, particularly linoleic acid and retinoic acid, are susceptible to oxidation and light degradation, introducing batch-to-batch variability that may affect the magnitude of marker induction. Finally, the protocol relies on microscopy-based readouts, such as immunofluorescence of rare AO2-positive structures, which may restrict scalability and high-throughput applications when macrogamete observation is required.

Troubleshooting

Problem 1

Low number of released crypts after EDTA treatment (Step 3l).

Possible cause: Insufficient EDTA incubation time or incomplete tissue opening prevents crypt detachment.

Potential solution

Ensure the intestine is fully opened longitudinally and increase EDTA incubation up to 5–10 additional minutes while maintaining gentle agitation. Avoid over-incubation to prevent epithelial damage.

Problem 2

Poor organoid formation or low viability after crypts plating (Step 3z).

Possible cause: Crypts were damaged during isolation protocol.

Potential solution

Pipette gently and strictly adhere to recommended incubation times. Keep crypts cold during isolation procedures to enhance survival.

Problem 3

Organoids fail to expand or remain small (Step 3z).

Possible cause: Suboptimal L-WRN conditioned medium or loss of growth factor activity.

Potential solution

Prepare fresh L-WRN batches following validated protocols, avoid repeated freeze–thaw cycles, and verify Wnt3a/R-spondin/Noggin activity of new batches by comparing culture growth with an ongoing batch before use.

Problem 4

High cell death after passaging (Step 3z).

Possible cause: Lack of ROCK inhibitor (Y-27632) or overly harsh mechanical dissociation.

Potential solution

Always supplement medium with 10 μM Y-27632 on the first day of passaging, and reduce pipetting frequency or force during organoid partial dissociation to preserve viable epithelial fragments.

Problem 5

Poor attachment of organoid-derived cells after seeding (Step 4c).

Possible cause: Incomplete Matrigel coating or insufficient time for polymerization.

Potential solution

Ensure wells are coated with a 1:10 Matrigel–PBS solution and incubated for at least 1 h at 37°C. Use pre-warmed medium during seeding to promote adhesion.

Problem 6

Low survival or extensive cell death after organoid-derived monolayer plating (Step 4i).

Possible cause: Lack of ROCK inhibitor (Y-27632) during dissociation and early culture stages.

Potential solution

Supplement ODM-specific medium with 10 μM Y-27632 during dissociation and at seeding, and maintain supplementation at each medium change to enhance cell survival.

Problem 7

Incomplete or uneven monolayer formation (Step 4j).

Possible cause: Suboptimal cell density or overly harsh mechanical dissociation.

Potential solution

ensure gentle pipetting during dissociation and avoid over-digestion by adhering to the recommended enzymatic incubation time. Additionally, check the passage number of the organoids and optimize the seeding density for your specific culture conditions.

Problem 8

Excessive monolayer detachment and poor expansion during culture (Step 4t).

Possible cause: Strong pipetting force during media changes, insufficient cell–matrix adhesion, incomplete supplementation and/or degradation of ODM-specific medium components or invasion can induce disruption in fragile monolayers.

Potential solution

Add medium gently along the wall of the well, avoiding direct flow onto the monolayer, and verify that residual matrix remains intact during early culture. Confirm that Y-27632, SB431542, CHIR99021, SB202190, N-acetyl cysteine, and nicotinamide are added at correct concentrations, prepare fresh medium weekly, and protect inhibitors from light.

Problem 9

High variability of monolayers between wells or replicates (Step 4t).

Possible cause: Inconsistent seeding density or uneven distribution of cells during plating.

Potential solution

Mix the cell suspension thoroughly before seeding and plate wells sequentially without delay. Use matched batches of organoid domes to standardize input material.

Problem 10

Poor invasion efficiency of T. gondii in ODMs (Step 6f).

Possible cause: ODMs not fully confluent (≤70%).

Potential solution

Infect ODMs at 80% or 90% confluence and within 48 h of plating. Avoid extended culture times that lead to loss of cell viability.

Problem 11

Low RNA yield or poor RNA quality from T. gondii (Step 7e).

Possible cause: RNA degradation may have occurred before or during extraction. Handling delays, exposure to RNases, or using consumables that are not RNase-free can compromise RNA integrity. Additionally, low RNA yield may occur if the proportion of parasite material in the infected cultures is low at the time of collection.

Potential solution

Confirm that samples are processed promptly and that all materials are RNase-free. Check RNA purity values (A260/A280) to identify contamination that may interfere with downstream steps. When biologically appropriate, combining material from multiple equivalent samples can conceptually increase the total input available for extraction and thereby improve overall yield. Finally, if RNA yield is consistently low, consider using a commercial RNA amplification kit prior to downstream applications. Kits designed for whole-transcriptome amplification (WTA) or pre-amplification during cDNA synthesis can substantially increase the amount of template available without compromising transcript representation. These kits are particularly useful when working with limited biological material, such as small parasite stages or low-input samples. For example, RNAesy micro kit (Qiagen # 74004) can purify RNA (maximum 45 μg) from small amounts of tissues or cells or QuantiTect Whole Transcriptome Kit (Qiagen #207045) enables the preamplification and reverse transcription of limited amounts of RNA to high yields of cDNA.

Problem 12

Parasite nuclei are difficult to visualize or distinguish from host cell nuclei in indirect immunofluorescence assays using DAPI (Step 13f).

Possible reason: DAPI staining alone is not sufficient to reliably identify parasite nuclei, as the strong DAPI signal from the host cell nucleus often masks or overwhelms the signal from parasite nuclei.

Potential solution

In indirect immunofluorescence assays, a parasite-specific nuclear marker antibody like the histone H2bz is used in addition to DAPI staining. While DAPI is included to label all nuclei and allow identification of the host cell nucleus, parasite nuclear identification should rely primarily on the parasite-specific nuclear marker, since host cell DAPI staining is typically much stronger and can prevent the observation of parasite nuclei.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, María E. Francia (mfrancia@pasteur.edu.uy).

Technical contact

For technical specifics on executing the protocol, Dr. Saira Cancela (scancela@pasteur.edu.uy), Dr. Florencia Sena (fsena@pasteur.edu.uy), and Dr. Romina Pagotto (pagotto@pasteur.edu.uy) will provide support to ensure its correct implementation.

Materials availability

This study did not generate new unique reagents and materials.

Data and code availability

This study did not generate or analyze datasets or codes.

Acknowledgments

We are deeply grateful to Dr. Mohamed-Ali Hakimi (University Grenoble Alpes) for providing the T. gondii strain and antibodies that supported this work. We acknowledge the core facilities at Institut Pasteur Montevideo for technical support and assistance, the Advanced Bioimaging Unit, and the Laboratory Animal Biotechnology Unit (UBAL). This work was supported by the following funding sources: a G4 grant awarded to M.E.F. by the Institut Pasteur; ANII_FMV_1_2019_1_156213 awarded to M.B.-F.; and FOCEM (MERCOSUR Structural Convergence Fund) and COF 03/1 grants awarded to the Institut Pasteur Montevideo. S.C. received fellowships from the Sistema Nacional de Becas (ANII) and the Comisión Académica de Posgrado (CAP). F.S., M.E.F., M.B.-F., and R.P. are members of the Sistema Nacional de Investigadores (SNI, Uruguay) and researchers of PEDECIBA (Uruguay).

Author contributions

M.E.F., R.P., and M.B.-F. conceptualized the study. S.C. and F.S. performed the experiments and analyzed and interpreted the data. R.P., F.S., and S.C. generated the figures. All authors contributed to the writing of the original draft and participated in manuscript review and editing. M.E.F. and M.B.-F. acquired the funding for the project. R.P., M.E.F., and M.B.-F. supervised the work and provided strategic guidance throughout the study.

Declaration of interests

The authors declare no competing interests.