Skip to main content
NCBI home page
Springer logoLink to Springer
. 2026 Feb 24;50(3):168. doi: 10.1007/s11259-026-11105-7

Cannabidiol-rich extract suppresses the activation of proinflammatory genes IL-1β and IL-6 in equine mesenchymal stem cells stimulated with lipopolysaccharide

Beatriz da Costa Kamura 1,2, Lucas Vinícius de Oliveira Ferreira 1,2, Natielly Dias Chimenes 1,2, João Pedro Marmol de Oliveira 1,2, Diego Noe Rodriguez-Sanchez 3, Márcio de Carvalho 1, Rogério Martins Amorim 1,2,✉
PMCID: PMC12932370  PMID: 41733607

Abstract

Peripheral nerve injuries (PNI) often lead to long-term functional impairment. Mesenchymal stem cells (MSCs) and cannabidiol (CBD) have shown anti-inflammatory and neuroprotective effects in vitro, which may be relevant for PNI research. The aim of this study was to evaluate CBD-rich cannabis extract’s potential to induce anti-inflammatory and neurotrophic gene expression in equine adipose tissue-derived MSCs (EqAT-MSCs) in an inflammatory in vitro environment. The morphology and metabolic activity of EqAT-MSCs (n = 4) were assessed after CBD-rich extract priming at concentrations of 3, 5, 7, and 9 µM for 24 and 48 h. Cytokine and neurotrophic gene expression was evaluated under these conditions: DMEM (unprimed), DMEM + LPS (lipopolysaccharide) (10 ng/ml), and LPS (10 ng/ml) + DMEM + CBD at 3, 5, and 7 µM for 24 and 48 h. No morphological changes were observed in primed EqAT-MSCs versus unprimed cells. EqAT-MSCs showed a reduction in metabolic activity at 9 µM after 24 h. CBD priming following LPS stimulation led to statistically significant changes in EqAT-MSC gene expression. BDNF expression increased after 48 h (3 and 5 µM), while NGF expression decreased at both 24 and 48 h (3, 5, and 7 µM). IL-1β expression decreased after 24 h (3 and 7 µM), and IL-6 levels decreased at both 24 (5 and 7 µM) and 48 h (3, 5, and 7 µM). No significant changes were observed in GDNF, TNF-ɑ, IFN-ɣ, or IL-10. These results indicate that CBD-rich extract selectively modulates inflammatory and neurotrophic gene expression in EqAT-MSCs while maintaining metabolic integrity.

Keywords: CBD-rich cannabis extract, Immunomodulation, Inflammatory environment, Neurotrophic factors, Priming

Introduction

In equines, peripheral nerve injuries (PNI) are among the most frequently reported lesions of the peripheral nervous system (Boorman et al. 2020). Given this clinical relevance, cell therapy research in equines, relevant both for the species and as a translational model, holds promise for advancing therapeutic approaches (Cequier et al. 2021).

MSCs have shown promise in treating PNI due to their capacity for proliferation, differentiation, immunomodulation, and secretion of neurotrophic factors (Sánchez et al. 2017; Li et al. 2022). Despite their therapeutic potential, the survival and differentiation capacity of transplanted MSCs can be hindered by the harsh conditions of the injured tissue microenvironment (Mante et al. 2025). These adverse conditions often result in low engraftment rates, increased cell death, and reduced therapeutic efficacy (Saparov et al. 2016; Haider 2024).

To enhance the biological performance of MSCs, various priming strategies have been proposed. Priming involves preconditioning cells with specific stimuli, such as inflammatory cytokines (e.g., tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ), hypoxia, or pharmacological agents to enhance their immunoregulatory profile, paracrine secretion, and regenerative properties (Saparov et al. 2016; Noronha et al. 2019; Mante et al. 2025).

Among the pharmacological agents investigated, cannabidiol (CBD), a non-psychoactive phytocannabinoid derived from Cannabis sativa, has recently gained attention. Studies have shown that the use of CBD-rich extract can stimulate the immunomodulatory activity of canine and equine MSCs (Battistin et al. 2025; Perino et al. 2025). Although the precise mechanisms of CBD-rich extract remain to be fully elucidated, studies on phytocannabinoids, including CBD and Δ⁹-tetrahydrocannabinol (THC), indicate that these compounds can influence the immunomodulatory functions of MSCs through several pathways. These mechanisms may involve activation of cannabinoid receptor type 2 (CB2) and extracellular signal-regulated kinase (ERK) signaling, as well as inhibition of NALP3 inflammasome activation (Libro et al. 2016; Xie et al. 2016).

This makes CBD-rich extract a promising candidate for MSC priming strategies aimed at enhancing therapeutic outcomes. However, to the best of our knowledge, no studies have investigated the use of CBD-rich extract to prime equine MSCs under an inflammatory environment.

Following PNI, early inflammatory responses involve the upregulation of cytokines such as IL-1β, IL-6, TNF-α, and IFN-γ by Schwann cells (SCs), macrophages, and resident immune cells to orchestrate debris clearance (Li et al. 2022). As inflammation resolves, macrophages polarize toward an anti-inflammatory M2 phenotype, increasing IL-6 and IL-10 secretion to support regeneration (Yu et al. 2022; Zhang et al. 2025). Concurrently, SCs begin producing neurotrophic factors, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and glial cell line-derived neurotrophic factor (GDNF), which play essential roles in axonal regrowth (Tomita et al. 2013; Caillaud et al. 2019; Pandey and Mudgal, 2022).

To experimentally reproduce the inflammatory milieu, lipopolysaccharide (LPS) is widely used as a reliable inducer of an in vitro pro-inflammatory environment. This stimulus is frequently employed in studies investigating the immunomodulatory effects of phytocannabinoid-based priming of MSCs (Xie et al. 2016; Ruhl et al. 2018).

The hypothesis of this study is that equine adipose tissue-derived MSCs (EqAT-MSCs), when cultured with a CBD-rich extract of Cannabis sativa, modulate cytokine and neurotrophic gene expression under inflammatory conditions. Thus, the aim of this study was to investigate the anti-inflammatory and neurotrophic potential in vitro of the CBD-rich extract in EqAT-MSCs stimulated with lipopolysaccharide (LPS).

Materials and methods

Experimental design

EqAT-MSCs (P3; n = 4) were thawed and cultured in complete medium composed of 90% Dulbecco’s Modified Eagle’s Medium (DMEM/F12), 10% fetal bovine serum (FBS) (both from Nova Biotecnologia, Cotia, São Paulo, Brazil), and 1% penicillin-streptomycin (Gibco®, Grand Island, New York, USA).

Cell morphology and metabolic activity were assessed using inverted microscopy and the MTT assay (3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyltetrazolium bromide), respectively, after priming with CBD-rich cannabis extract at concentrations of 3 µM, 5 µM, 7 µM, and 9 µM for 24 and 48 h. Based on the MTT analysis and supported by previous studies, the concentrations of 3, 5, and 7 µM were selected for gene expression evaluation (Libro et al. 2016; Battistin et al. 2025).

Additionally, the gene expression of cytokines IFN-ɣ, TNF-ɑ, IL-1β, IL-6, and IL-10, and neurotrophic factors BDNF, GDNF, NGF was evaluated in EqAT-MSCs by RT-qPCR under the following conditions: with complete medium (unprimed group), complete medium + lipopolysaccharide from Escherichia coli serotype 055:B5 (Sigma-Aldrich®. Saint Louis, Missouri, USA) (LPS, 10 ng/ml), and LPS (10 ng/ml) + complete medium + 3 µM, 5 µM, and 7 µM CBD-rich extract, after priming for 24 and 48 h (Fig. 1). The LPS concentration (10 ng/mL) was selected based on a previous study (Pezzanite et al. 2021) to induce an inflammatory environment.

Fig. 1.

Fig. 1

Open in a new tab

Equine adipose tissue-derived mesenchymal stem cells (EqAT-MSCs; P3; n = 4) were cultured in complete medium and primed with cannabidiol (CBD)-rich cannabis extract at concentrations of 3 µM, 5 µM, 7 µM and 9 µM for 24 and 48 h. Cell morphology and metabolic activity were evaluated using inverted microscopy and the MTT assay, respectively. Gene expression of cytokines (IFN-ɣ, TNF-ɑ, IL-1β, IL-6, IL-10) and neurotrophic factors (BDNF, GDNF, NGF) was analyzed by RT-qPCR after 24 and 48 h of priming in the following groups: complete medium (unprimed), complete medium + LPS (10 ng/ml), and complete medium + LPS + 3 µM, 5 µM and 7 µM. CBD-rich extract. IFN-ɣ: Interferon-gamma. TNF-ɑ: Tumor necrosis factor-alpha. IL-1β: Interleukin-1 beta. IL-6: Interleukin-6. IL-10: Interleukin-10. BDNF: Brain-derived neurotrophic factor. GDNF: Glial cell line-derived neurotrophic factor. NGF: Nerve growth factor. LPS: Lipopolysaccharide. Created in BioRender. Amorim, R. (2026) https://BioRender.com/rxhnk1k

Equine adipose-derived mesenchymal stem cells

EqAT-MSCs derived from healthy horses were sourced from the MSC bank at the Center for Translational Research in Regenerative Medicine, Institute of Biotechnology, São Paulo State University (UNESP). These cells had been previously characterized, exhibiting adherence to plastic, fibroblast-like morphology, and differentiation potential into osteogenic, adipogenic, and chondrogenic lineages. Additionally, they expressed surface markers CD44, CD90, and CD105, while lacking expression of CD34 and MHC-II (Barberini et al. 2014).

The cells were thawed and cultured in a medium consisting of 90% DMEM/F12, 10% FBS (both from Nova Biotecnologia, Cotia, São Paulo, Brazil), and 1% penicillin-streptomycin (Gibco®, Grand Island, New York, USA) until they reached 80% confluence.

Cannabidiol-rich cannabis extract

The full-spectrum Cannabis sativa extract, predominantly enriched with CBD, used in this study was provided by the Maria Flor Cannabis Association (Marília, São Paulo, Brazil). Its composition was analyzed using High-Performance Liquid Chromatography (HPLC) by DALL Soluções Analíticas (Curitiba, Paraná, Brazil), confirming 28.12% CBD and 0.80% tetrahydrocannabinol (THC). The extract was initially diluted in dimethyl sulfoxide (DMSO) at a 1:1 ratio, filtered, and further diluted in DMEM to prepare concentrations of 3 µM, 5 µM, 7 µM, and 9 µM, which were used in the experiments (final DMSO concentration of 0.05%).

Morphological evaluation

The morphology of EqAT-MSCs was assessed using an inverted microscope (LEICA DMIRB, Germany). Photomicrographs were captured at 24 and 48 h for both the control group (unprimed cells) and EqAT-MSCs primed with 3 µM, 5 µM, 7 µM, and 9 µM CBD-rich extract.

MTT

For the analysis of cellular metabolic activity, EqAT-MSCs were seeded into a 96-well plate (Sarstedt, Nümbrecht, Germany) at a density of 1 × 10⁴ cells/well in complete medium. After 24 h, the supernatant was discarded and replaced with complete medium (unprimed group), and complete medium with CBD-rich cannabis extract at concentrations of 3 µM, 5 µM, 7 µM, and 9 µM for the primed groups. The cells were incubated for 24 and 48 h.

Following priming, the medium was removed, and the MSCs were incubated with MTT (3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyl tetrazolium bromide) (Thermo Fisher Scientific, Waltham, MA, USA, catalog number M6494) for 4 h at 37 °C and 5% CO2. After removing the MTT solution, the cells were homogenized with 200 µL of DMSO and analyzed at an absorbance of 570 nm using an Asys Expert Plus® microplate reader (Biochrom Asys Expert Plus Microplate Reader; Biochrom Ltd., Harvard Bioscience, Holliston, MA).

Gene expression of cytokines and neurotrophic factors

The gene expression of cytokines (IFN-ɣ, TNF-ɑ, IL-1β, IL-6, and IL-10) and neurotrophic factors (NGF, BDNF, and GDNF) in unprimed and primed EqAT-MSCs was quantified using the RT-qPCR technique. For this, equine MSCs were seeded in duplicates to 24-well plates (Sarstedt, Nümbrecht, Germany) at a density of 5 × 104 cells/well.

After 24 h, the supernatant was discarded and replaced with the medium for each experimental group: Unprimed group (complete culture medium); Stimulated group (complete culture medium + 10 ng/ml LPS); Stimulated group + 3 µM CBD-rich extract (complete culture medium + 10 ng/ml LPS + 3 µM CBD-rich cannabis extract); Stimulated group + 5 µM CBD-rich extract (complete culture medium + 10 ng/ml LPS + 5 µM CBD-rich cannabis extract); and Stimulated group + 7 µM CBD-rich extract (complete culture medium + 10 ng/ml LPS + 7 µM CBD-rich cannabis extract). Cells were maintained under priming conditions for 24 and 48 h.

Then, the cells were lysed using 1 mL of TRIzol™ (Invitrogen™, USA), and the samples were stored at −80 °C for subsequent analysis. RNA extraction was performed using the same reagent, following the manufacturer’s instructions. The RNA was eluted with RNA-free water, quantified, and analyzed by spectrophotometry with the Thermo Scientific NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, USA) to determine the absorbance ratios at 260/280 nm and 260/230 nm. cDNA synthesis was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, Life Technologies Corporation, Carlsbad, USA), according to the manufacturer’s instructions. Reverse transcription was performed to obtain cDNA using the Veriti 96-Well Thermal Cycler (Applied Biosystems™, Thermo Fisher Scientific) under the following thermal cycling conditions: 10 min at 25 °C, 12 min at 37 °C, and 5 min at 85 °C. The cDNA samples were cryopreserved at −80 °C and used as templates for PCR reactions.

Reactions were performed in duplicates using cDNA previously synthesized, PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™, Life Technologies, Carlsbad, CA, USA), RNA-free water, and equine primers (Thermo Fisher Scientific, São Paulo, Brazil), based on a previous study (Battistin et al. 2025) (Table 1).

Table 1.

Primers used for analyzing gene expression by RT-qPCR

Gene Forward (5´−3´) Reverse (5´−3´)
IL-1β GCAGCCATGGCAGCAGTA ATTGCCGCTGCAGTAAGTCA
IL-6 AACAACTCACCTCATCCTTCGAA CGAACAGCTCTCAGGCTGAAC
IL-10 CGGCCCAGACATCAAGGA TCGGAGGGTCTTCAGCTTTTC
IFN-ɣ CTGTCGCCCAAAGCTAACCT GGCCTCGAAATGGATTCTGA
TNF-ɑ TTGGATGGGCTGTACCTCATC GGGCAGCCTTGGCCTTT
BDNF TTGGATGAGGGCCAGAAAGT CAAGTCCGCGTCCTTACTGTT
GDNF CAGGGACTCTTCCTCCATCCT TGGGCACGAGCATGTTTCT
NGF CCAACGGAGCAGCTTTCTGT AACAACATGGACATTACGCTATGC
ACTB CGGCGGCTCCATTCTG CTGCTTGCTGATCCACATCTG
GAPDH GGCAAGTTCCATGGCACAGT GGGCTTTCCGTTGATGACAA
Open in a new tab

IL-1β interleukin 1 beta, IL-6 interleukin-6, IL-10 interleukin-10, IFN-γ interferon gamma, TNF-α tumor necrosis factor-alpha, BDNF brain-derived neurotrophic factor, GDNF glial cell-derived neurotrophic factor, NGF nerve growth factor, ACTB beta-actin, GAPDH glyceraldehyde-3-phosphate dehydrogenase

Samples were tested with two reference genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta-actin (ACTB). The real-time polymerase chain reaction (qPCR) method was performed using the QuantStudio™ 12 K Flex Real-Time PCR System thermocycler (Applied Biosystems™, Thermo Fisher Scientific) with the following parameters: 50 °C for 2 min, 95 °C for 2 min, and 40 cycles of 95 °C for 1 s and 60 °C for 30 s, followed by a dissociation curve. The relative quantification of gene expression was performed using the ΔΔCt method (Livak and Schmittgen 2001).

Statistical analysis

Data were evaluated for normality using statistical tests (Shapiro–Wilk), descriptive statistics, and graphical analysis. The results obtained from the RT-qPCR and cell metabolic activity analyses were subjected to the non-parametric Kruskal-Wallis test at each evaluation time point (24 and 48 h) to compare the treatments (p < 0.05). When a statistically significant difference was found, Dunn’s test was applied. Analyses were performed using SigmaStat 3.5 software.

Results

Morphology

No differences in morphology were observed between the groups primed with CBD-rich cannabis extract and the unprimed group after 24 and 48 h (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Morphological characterization of equine adipose tissue-derived mesenchymal stem cells (EqAT-MSCs) under different experimental conditions. Representative phase-contrast micrographs of EqAT-MSCs cultured for 24 and 48 h. (A, F) Unprimed group (control); (B, G) EqAT-MSCs primed with 3 µM cannabidiol (CBD)-rich cannabis extract; (C, H) 5 µM CBD-rich extract; (D, I) 7 µM CBD-rich extract; (E, J) 9 µM CBD-rich extract. Magnification: 200×. Scale bar: 100 μm

Cellular metabolic activity

Only the group primed with 9 µM CBD-rich extract for 24 h (median = 79.6%) showed a significant reduction in the metabolic activity of EqAT-MSCs compared to the control group (median = 100%) (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Cellular metabolic activity of equine adipose tissue-derived mesenchymal stem cells (EqAT-MSCs) following priming with cannabidiol (CBD)-rich cannabis extract. Metabolic activity was assessed by MTT assay after 24 and 48 h of exposure to CBD-rich extract at different concentrations. Data are presented as medians, interquartile ranges, and minimum and maximum values (p < 0.01**)

Gene expression of neurotrophic factors

The relative expression of neurotrophic factors is shown in Fig. 4. The expression of BDNF showed a significant increase in the EqAT-MSCs groups primed with 3 µM and 5 µM CBD-rich extract (median = 1.45; 1.33) compared to the unprimed group and EqAT-MSCs stimulated with LPS (median = 1.01; 1.09) after 48 h.

Fig. 4.

Fig. 4

Open in a new tab

Relative expression of neurotrophic factors and cytokines in equine adipose tissue-derived mesenchymal stem cells (EqAT-MSCs) after 24 and 48 h of priming with 3 µM, 5 µM and 7 µM. cannabidiol (CBD)-rich extract. (A) BDNF, (B) GDNF, (C) NGF, (D) IL-1β, (E) IL-6, (F) TNF-ɑ, (G) IFN-ɣ (H) IL-10. Data are presented as medians, interquartile ranges, and minimum and maximum values. p values: p < 0.05*, p < 0.01**, p < 0.001***. BDNF: brain-derived neurotrophic factor; GDNF: glial cell-derived neurotrophic factor; NGF: nerve growth factor; IL-1β: interleukin 1 beta; IL-6: interleukin-6; IL-10: interleukin-10; IFN-γ: interferon gamma; TNF-α: tumor necrosis factor-alpha

Although no significant differences were observed compared to the unprimed and stimulated groups, GDNF expression was reduced in the group primed with 7 µM CBD-rich extract after 48 h (median = 0.73) compared to the 3 µM CBD-rich extract group (median = 1.22) at the same time.

Regarding NGF, at both 24 and 48 h, primed with 3 µM CBD-rich extract (medians = 0.81; 0.74), 5 µM CBD-rich extract (medians = 0.80; 0.79), and 7 µM CBD-rich extract (medians = 0.74; 0.71) significantly reduced its expression compared to the LPS-stimulated group (medians = 1.08; 0.96).

Gene expression of cytokines

LPS affected the expression of IL-1β after 24 h of culture, showing an increase in its expression in the stimulated group (median = 1.58) compared to the unprimed group. (median = 0.97). At the same time, a significant reduction in IL-1β expression was observed when comparing the LPS-stimulated group with the groups primed with 3 µM CBD-rich extract (median = 1.24) and 7 µM (median = 0.72) (Fig. 4).

The expression of IL-6 showed significant differences between the groups. After 24 h, its expression was reduced in the groups primed with 5 µM CBD-rich extract (median = 0.42) and 7 µM CBD-rich extract (median = 0.23) compared to the LPS-stimulated group (median = 1.31). After 48 h, significant reductions were observed in the groups primed with 3 µM CBD-rich extract (median = 0.4), 5 µM CBD-rich extract (median = 0.28), and 7 µM CBD-rich extract (median = 0.16) compared to the LPS-stimulated group (median = 1.8).

No significant differences were observed between groups for the cytokines IL-10, IFN-ɣ and TNF-ɑ.

Discussion

The present study aimed to evaluate whether priming EqAT-MSCs with a CBD-rich cannabis extract could modulate their gene expression profile in response to LPS-induced inflammation. The expression of inflammatory and anti-inflammatory cytokines and neurotrophic factors was investigated to determine whether CBD-rich extract priming could prepare the cells for a more favorable immunoregulatory and neuroprotective role under inflammatory conditions.

The use of 10 ng/mL LPS to create an inflammatory environment in EqAT-MSCs was based on a previous equine study showing that this concentration is used to activate TLR-4 in equine MSCs in vitro (Pezzanite et al. 2021). With the exception of IL-1β, which responded robustly to LPS after 24 h, the other immunomodulatory factors did not show significant changes. This could indicate that 10 ng/mL LPS may be suboptimal to fully activate EqAT-MSCs. Differences in TLR-4 structure and signaling between species have been described in humans, rodents, and primates, which can influence the intensity of response to LPS (Smirnova et al. 2000; Vézina et al. 2013).

In human MSCs, CBD has been shown to reduce the expression of genes related to cytokines and pro-inflammatory pathways, including IL-1β, TLR, IFN-γ receptors, NF-κB-dependent pathways, transcription factors (STAT), and MAPK (Libro et al. 2016). Therefore, the ability of CBD to interfere with NF-κB- and STAT-dependent signaling could partially explain its anti-inflammatory effects under LPS stimulation (Clark et al. 2013; Libro et al. 2016).

Still, when analyzing the response of EqAT-MSCs to different doses of CBD-rich cannabis extract, a tendency toward reduced cellular metabolic activity was observed with increasing CBD-rich extract concentrations. However, this reduction became statistically significant only at a concentration of 9 µM. Therefore, this dose was not used in the gene expression analyses of cytokines and neurotrophic factors. These findings are consistent with previously reported cannabidiol-associated cytotoxicity in human MSC cultures at concentrations of 10 µM and 25 µM (Soundara et al. 2017). Additionally, a previous study using EqAT-MSCs demonstrated that at concentrations of 5 and 7 µM, the CBD-rich cannabis extract did not alter metabolic or β-galactosidase activity, indicating its safety (Battistin et al. 2025).

Morphological evaluation showed that priming with CBD-rich extract did not induce structural alterations in the cells, consistent with previous results in equine MSCs (Battistin et al. 2025). These findings indicate that priming with CBD-rich extract does not compromise cellular integrity up to 48 h.

The reduction in NGF expression observed in the experimental groups at both time points aligns with findings from others in vivo and in vitro studies (Santos et al. 2015; Perez et al. 2021). A previous study suggests that cannabidiol may activate tropomyosin kinase receptor A (TrkA), the primary receptor for NGF (Santos et al. 2015). Although the exact mechanisms underlying NGF downregulation remain unclear, this effect may be linked to modulation of TrkA-associated signaling pathways. (Santos et al. 2015).

Differences in BDNF expression were observed in the groups primed with 3 µM and 5 µM CBD-rich extract compared to the EqAT-MSCs stimulated with LPS after 48 h. The expression of the tropomyosin receptor kinase B (TrkB) has been observed in MSCs, and its activation plays a significant role in BDNF production by these cells (Heo et al. 2013). Previous in vivo studies have shown that CBD can modulate BDNF levels in a time-dependent manner, with transient increases shortly after administration followed by a return to baseline (Heo et al. 2013; Sales et al. 2019). Consistent with these observations, other studies evaluating later time points after CBD treatment did not detect sustained changes in BDNF expression or secretion (Ceprián et al. 2019; Perez et al. 2021). This can be attributed to the activation of pathways associated with anti-inflammatory activity and tissue repair during later stages of injury, which are characterized by reduced secretion of inflammatory cytokines and neurotrophic factors (Ceprián et al. 2019; Sales et al. 2019; Perez et al. 2021).

No differences in GDNF expression were observed between the LPS-stimulated group and any experimental group at both time points. Consistent with findings from other studies, CBD does not appear to influence GDNF levels in vivo or in vitro (Santos et al. 2015; Ceprián et al. 2019; Perez et al. 2021). The neurotrophic potential of CBD is primarily related to its immunomodulatory, anti-apoptotic, and antioxidant properties, as well as its influence on other cell types, such as SCs, rather than directly stimulating the production of these neurotrophins (Ceprián et al. 2019). Studies that analyze the influence of CBD and MSCs when inserted in an inflammatory environment, and their interaction with other cell types, are important for a better understanding of their exact mechanism of action.

In the literature, findings regarding IL-10 expression following CBD priming are inconsistent. A downregulation of this cytokine has been reported in human adipose-derived MSCs following CBD exposure (Kowalczuk et al. 2022), whereas an upregulation of IL-10 gene expression was observed in EqAT-MSCs after 24 h of priming with 5 µM of a CBD-rich extract (Battistin et al. 2025). In contrast, in the present study, no significant differences in IL-10 expression were observed among the analyzed groups. Notably, although the same cellular source and CBD-rich extract were used as in the study by Battistin et al. (2025), the present experimental model included LPS stimulation to establish an inflammatory environment. Under these conditions, CBD-rich extract priming did not modulate IL-10 expression in EqAT-MSCs, indicating that IL-10 regulation by CBD may be influenced by the inflammatory context.

In the present study, LPS stimulation increased IL-1β expression, while priming with CBD-rich extract at 3 and 7 µM reduced the expression of both IL-6 and IL-1β in EqAT-MSCs. A previous study in human gingival MSCs reported that CBD treatment was associated with reduced NF-κB expression, a factor involved in inflammatory gene regulation (Libro et al. 2016). Similarly, a reduction in IL-6 and IL-1β expression was previously observed in EqAT-MSCs primed with 7 µM CBD-rich extract (Battistin et al. 2025).

Both cytokines, IL-1β and IL-6, play an important role in the early inflammatory phases associated with PNI, primarily involved in immune cell recruitment (Li et al. 2022). MSCs can adopt a pro-inflammatory phenotype under inflammatory conditions (Waterman et al. 2010; Betancourt, 2012). The reduced gene expression of IL-1β and IL-6 observed following CBD-rich extract priming suggests a modulatory effect of CBD on the inflammatory profile of EqAT-MSCs under LPS-induced conditions. This effect may be relevant for strategies aiming to modulate inflammatory responses; however, further studies are required to determine whether these transcriptional changes translate into functional or therapeutic outcomes.

In vitro, CBD has been shown to reduce the expression of TNF-α and IFN-γ in equine peripheral blood mononuclear cells (Turner et al. 2021). In another study using EqAT-MSCs, priming with a 5 µM concentration of CBD-rich extract resulted in increased TNF-α and IFN-γ gene expression, whereas no significant changes were observed at 7 µM (Battistin et al. 2025). Additionally, in vivo studies have reported decreased levels of IFN-γ in senior horses following CBD treatment (Turner et al. 2023). However, in the present study, no significant differences were observed in TNF-α or IFN-γ expression following priming with CBD-rich extract, regardless of concentration or exposure time, suggesting that the modulatory effect of CBD on these cytokines may depend on the specific cell type, inflammatory context, or duration of stimulation.

The limitations of this study include the lack of protein analysis for cytokines and neurotrophic factors, as well as the absence of assessment of the secretory activity of equine EqAT-MSCs following priming with different concentrations of CBD-rich cannabis extract at 24 and 48 h.

Conclusion

Priming of EqAT-MSCs with CBD-rich cannabis extract after LPS stimulation resulted in increased BDNF gene expression after 48 h of stimulation (3 and 5 µM), while NGF expression decreased at both 24 and 48 h (3, 5 and 7 µM). IL-1β expression decreased after 24 h (3 and 7 µM), and IL-6 showed a reduction at both 24 (5 and 7 µM) and 48 h (3, 5 and 7 µM). These findings suggest that CBD-rich cannabis extracts can selectively modulate the immunomodulatory and inflammatory gene expression profiles of EqAT-MSCs. Further studies are needed to explore CBD’s interaction with MSCs and other cell types to better understand its mechanism of action. Additionally, species-specific inflammatory model protocols for equines should be further investigated.

Author contributions

Conceptualization, B.C.K. and R.M.A.; methodology, B.C.K., L.V.O.F., N.D.C., J.P.M.O., D.N.R.S.; validation, M.C. and R.M.A.; formal analysis, B.C.K., M.C. and R.M.A.; investigation, B.C.K., L.V.O.F., N.D.C., J.P.M.O., D.N.R.S., M.C. and R.M.A.; resources, R.M.A.; data curation, B.C.K and R.M.A.; writing—original draft preparation, B.C.K.; writing—review and editing, L.V.O.F. and R.M.A.; visualization, B.C.K. and L.V.O.F.; supervision, R.M.A.; project administration, R.M.A. All authors have read and agreed to the published version of the manuscript.

Funding

The Article Processing Charge (APC) for the publication of this research was funded by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) (ROR identifier: 00x0ma614). This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brazil (CAPES) – Finance Code 001.

Data availability

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Code availability

Not applicable.

Declarations

Ethics approval

This study was approved by Ethics Committee on the Use of Animals (CEUA) of UNESP, Botucatu, São Paulo, Brazil, under protocol number 000.254 on 31 October 2024.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Clinical trial number

Not applicable.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Barberini DJ, Freitas NPP, Magnoni MS, Maia L, Listoni AJ, Heckler MC, Sudano MJ, Golim MA, Landim-Alvarenga FC, Amorim RM (2014) Equine mesenchymal stem cells from bone marrow, adipose tissue and umbilical cord: immunophenotypic characterization and differentiation potential. Stem Cell Res Ther 5:25. 10.1186/scrt414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Battistin L, Moya LFA, Ferreira LVO, Braz AMM, Carvalho M, Golim MA, Amorim RM (2025) In vitro Immunomodulatory effects of equine adipose tissue-derived mesenchymal stem cells primed with a cannabidiol-rich extract. Int J Mol Sci 26:4208. 10.3390/ijms26094208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Betancourt AM (2012) New cell-based therapy paradigm: induction of bone marrow-derived multipotent mesenchymal stromal cells into pro-inflammatory MSC1 and anti-inflammatory MSC2 phenotypes. Adv Biochem Eng Biotechnol 130:163–197. 10.1007/10_2012_141 [Google Scholar]
  4. Boorman S, Scherrer NM, Stefanovski D, Johnson A (2020) Facial nerve paralysis in 64 equids: clinical variables, diagnosis, and outcome. J Vet Intern Med 34:1308–1320. 10.1111/jvim.15767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caillaud M, Richard L, Vallat JM, Desmouliere A, Billet F (2019) Peripheral nerve regeneration and intraneural revascularization. Neural Regen Res 14:24–33. 10.4103/1673-5374.243699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Ceprián M, Vargas C, García-Toscano L, Penna F, Jiménez-Sánchez L, Achicallende S, Elezgarai I, Grandes P, Hind W, Pazos MR, Martínez-Orgado J (2019) Cannabidiol administration prevents hypoxia-ischemia-induced hypomyelination in newborn rats. Front Pharmacol 10:1131. 10.3389/fphar.2019.01131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cequier A, Sanz C, Rodellar C, Barrachina L (2021) The usefulness of mesenchymal stem cells beyond the musculoskeletal system in horses. Animals 11:931. 10.3390/ani11040931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Clark AK, Old EA, Malcangio M (2013) Neuropathic pain and cytokines: current perspectives. J Pain Res 6:803–814. 10.2147/JPR.S53660 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Haider KH (2024) Priming mesenchymal stem cells to develop super stem cells. World J Stem Cells 16:623. 10.4252/wjsc.v16.i6.623 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Heo H, Yoo M, Han D, Cho Y, Joung I, Kwon YK (2013) Upregulation of TrkB by forskolin facilitated survival of MSC and functional recovery of memory deficient model rats. Biochem Biophys Res Commun 431:796–801. 10.1016/j.bbrc.2012.12.122 [DOI] [PubMed] [Google Scholar]
  11. Kowalczuk A, Marycz K, Kornicka-Garbowska K, Kornicka J, Bujalska-Zadrożny M, Groborz S (2022) Cannabidiol (CBD) protects adipose-derived mesenchymal stem cells (ASCs) against endoplasmic reticulum stress development and its complications. Int J Environ Res Public Health 19:10864. 10.3390/ijerph191710864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Li X, Guan Y, Li C, Zhang T, Meng F, Zhang J, Li J, Chen S, Wang Q, Wang Y, Peng J, Tang J (2022) Immunomodulatory effects of mesenchymal stem cells in peripheral nerve injury. Stem Cell Res Ther 13:18. 10.1186/s13287-021-02690-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Libro R, Scionti D, Diomede F, Marchisio M, Grassi G, Pollastro F, Piattelli A, Bramanti P, Mazzon E, Trubiani O (2016) Cannabidiol modulates the immunophenotype and inhibits the activation of the inflammasome in human gingival mesenchymal stem cells. Front Physiol 7:559. 10.3389/fphys.2016.00559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  15. Mante N, Undale V, Sanap A, Bhonde R, Tambe P, Bansode M, Gupta RK (2025) Disease microenvironment preconditioning: an evolving approach to improve therapeutic efficacy of human mesenchymal stromal cells. Int Immunopharmacol 157:114701. 10.1016/j.intimp.2025.114701 [DOI] [PubMed] [Google Scholar]
  16. Noronha NC, Mizukami A, Caliári-Oliveira C, Cominal JG, Rocha JLM, Covas DT, Swiech K, Malmegrim KCR (2019) Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res Ther 10:131. 10.1186/s13287-019-1224-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pandey S, Mudgal J (2022) A review on the role of endogenous neurotrophins and Schwann cells in axonal regeneration. J Neuroimmune Pharmacol 17:398–408. 10.1007/s11481-021-10034-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Perez M, Cartarozzi LP, Chiarotto GB, Guimarães FS, Oliveira ALR (2021) Short and long-term neuroprotective effects of cannabidiol after neonatal peripheral nerve axotomy. Neuropharmacology 197:108726. 10.1016/j.neuropharm.2021.108726 [DOI] [PubMed] [Google Scholar]
  19. Perino VS, Ferreira LVO, Kamura BC, Chimenes ND, Olbera AVG, Pereira TT, Braz AMM, Golim MA, Carvalho M, Amorim RM (2025) Priming Canine Adipose Tissue-Derived Mesenchymal Stem Cells with CBD-Rich Cannabis Extract Modulates Neurotrophic Factors Expression Profile. Vet Sci 12:926. 10.3390/vetsci12100926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Pezzanite LM, Chow L, Johnson V, Griffenhagen GM, Goodrich L, Dow S (2021) Toll-like receptor activation of equine mesenchymal stromal cells to enhance antibacterial activity and Immunomodulatory cytokine secretion. Vet Surg 50:858–871. 10.1111/vsu.13628 [DOI] [PubMed] [Google Scholar]
  21. Ruhl T, Kim BS, Beier JP (2018) Cannabidiol restores differentiation capacity of LPS exposed adipose tissue mesenchymal stromal cells. Exp Cell Res 370:653–662. 10.1016/j.yexcr.2018.07.030 [DOI] [PubMed] [Google Scholar]
  22. Sales AJ, Fogaça MV, Sartim AG, Pereira VS, Wegener G, Guimarães FS, Joca SR (2019) Cannabidiol induces rapid and sustained antidepressant-like effects through increased BDNF signaling and synaptogenesis in the prefrontal cortex. Mol Neurobiol 56:1070–1081. 10.1007/s12035-018-1143-4 [DOI] [PubMed] [Google Scholar]
  23. Sánchez DNR, Bertanha M, Fernandes TD, Resende LAL, Deffune E, Amorim RM (2017) Effects of canine and murine mesenchymal stromal cell transplantation on peripheral nerve regeneration. Int J Stem Cells 10:83–92. 10.15283/ijsc16037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Santos NAG, Martins NM, Sisti FM, Fernandes LS, Ferreira RS, Queiroz RHC, Santos AC (2015) The neuroprotection of Cannabidiol against MPP⁺-induced toxicity in PC12 cells involves TrkA receptors, upregulation of axonal and synaptic proteins, neuritogenesis, and might be relevant to parkinson’s disease. Toxicol In Vitro 30:231–240. 10.1016/j.tiv.2015.11.004 [DOI] [PubMed] [Google Scholar]
  25. Saparov A, Ogay V, Nurgozhin T, Jumabay M, Chen WC (2016) Preconditioning of human mesenchymal stem cells to enhance their regulation of the immune response. Stem Cells Int 2016:3924858. 10.1155/2016/3924858 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Smirnova I, Poltorak A, Chan EK, McBride C, Beutler B (2000) Phylogenetic variation and polymorphism at the Toll-like receptor 4 locus (TLR4). Genome Biol 1:1–10. 10.1186/gb-2000-1-1-research002 [Google Scholar]
  27. Soundara Rajan T, Giacoppo S, Scionti D, Diomede F, Grassi G, Pollastro F, Piattelli A, Bramanti P, Mazzon E, Trubiani O (2017) Cannabidiol activates neuronal precursor genes in human gingival mesenchymal stromal cells. J Cell Biochem 118:1531–1546. 10.1002/jcb.25815 [DOI] [PubMed] [Google Scholar]
  28. Tomita K, Madura T, Sakai Y, Yano K, Terenghi G, Hosokawa K (2013) Glial differentiation of human adipose-derived stem cells: implications for cell-based transplantation therapy. Neuroscience 236:55–65. 10.1016/j.neuroscience.2012.12.066 [DOI] [PubMed] [Google Scholar]
  29. Turner S, Barker VD, Adams AA (2021) Effects of cannabidiol on the in vitro lymphocyte pro-inflammatory cytokine production of senior horses. J Equine Vet Sci 103:103668. 10.1016/j.jevs.2021.103668 [DOI] [PubMed] [Google Scholar]
  30. Turner S, Knych HK, Adams AA (2023) The effects of cannabidiol on immune function and health parameters in senior horses. Vet Immunol Immunopathol 257:110549. 10.1016/j.vetimm.2023.110549 [DOI] [PubMed] [Google Scholar]
  31. Vézina Audette R, Lavoie-Lamoureux A, Lavoie JP, Laverty S (2013) Inflammatory stimuli differentially modulate the transcription of paracrine signaling molecules of equine bone marrow multipotent mesenchymal stromal cells. Osteoarthritis Cartilage 21:1116–1124. 10.1016/j.joca.2013.05.004 [DOI] [PubMed] [Google Scholar]
  32. Waterman RS, Tomchuck SL, Henkle SL, Betancourt AM (2010) A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an immunosuppressive MSC2 phenotype. PLoS One 5:e10088. 10.1371/journal.pone.0010088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Xie J, Xiao D, Xu Y, Zhao J, Jiang L, Hu X, Zhang Y, Yu L (2016) Up-regulation of immunomodulatory effects of mouse bone-marrow derived mesenchymal stem cells by tetrahydrocannabinol pre-treatment involving cannabinoid receptor CB2. Oncotarget 7:6436–6447. 10.18632/oncotarget.7042 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yu Y, Yue Z, Xu M, Zhang M, Shen X, Ma Z, Li J, Xie X (2022) Macrophages play a key role in tissue repair and regeneration. PeerJ 10:14053. 10.7717/peerj.14053 [Google Scholar]
  35. Zhang X, Zhang Y, Chen Y, Ji Y, Lyu Y, Miao Z, Duan X, Liu X (2025) Unraveling the immune system’s role in peripheral nerve regeneration: a pathway to enhanced healing. Front Immunol 16:1540199. 10.3389/fimmu.2025.1540199 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Not applicable.

Articles from Veterinary Research Communications are provided here courtesy of Springer

RESOURCES