Effects of Light Spectrum and Intensity on Cellular Stress Responses in Baikal Whitefish and Its Hybrid Embryos: A Basis for Optimizing the Aquaculture Environment

Simple Summary

Different spectra of light can be a source of stress for developing fish in aquaculture, but the specific effects are not well understood. We incubated the eggs of the Baikal whitefish and its hybrid from fertilization until after hatching under various light conditions: white, darkness, red, blue, and green. The key indicators of stress and health in the embryos, including markers of cellular damage, energy balance, and genetic integrity, were measured. Our results show that red light and complete darkness acted as significant stressors, causing signs of cellular damage and energy imbalance. In contrast, green light had more favorable effects. Interestingly, the hybrid was more sensitive to blue light and bright white light than the pure Baikal whitefish. We conclude that for the incubation of these whitefish forms, red light and darkness should be avoided, while green light provides a significantly more favorable environment, and the predominance of this spectrum range is recommended for use in the artificial cultivation of eggs. These findings offer a practical basis for optimizing light conditions to improve fish health and welfare in aquaculture production.

Abstract

The light spectrum is a key factor in aquaculture, but its effects on molecular stress responses during early fish development are unclear. This study examined how light of different wavelengths (spectra) affects embryos of Baikal whitefish Coregonus baicalensis and its hybrid with Yenisei hump-snout whitefish C. fluviatilis. Eggs were incubated from 35 days post-fertilization under white light (1.8 and 20 µmol m⁻² s⁻¹), darkness, red (peak at 631 nm), green (peak at 507 nm) and blue (peak at 459 nm) light. We analyzed relative telomere length, telomerase activity, blood profiles, and expression of stress-related genes (HSP-90, MtCK) at key developmental stages. Notably, a significant increase in telomere length was observed throughout early development (from embryo to larva to fry), independent of the light spectrum. Red light and darkness acted as potent stressors, indicating proteotoxic stress and energy imbalance. In Baikal whitefish, this was accompanied by notable telomere shortening at the earliest stage and elongation at later stages under certain conditions, potentially mediated by increased telomerase activity, a response that may be metabolically costly. Conversely, green light was the most neutral. The effect of blue light differed between Baikal whitefish and its hybrid, with the hybrid proving more sensitive. Furthermore, high-intensity white light (20 µmol m⁻² s⁻¹) also induced negative effects in the hybrid, such as increased telomere length, suggesting that excessive irradiance itself can be a stressor, independent of spectral composition. We conclude that darkness or a predominance of red light is suboptimal for incubating these whitefish, while green light provides a more favorable environment, offering a basis for optimizing aquaculture light conditions.

1. Introduction

Light is a fundamental abiotic factor regulating physiology and development in teleost fish, with its spectral composition, intensity, and photoperiod acting as key environmental cues [1,2,3,4,5,6,7]. In aquatic ecosystems, the spectral environment changes significantly with depth: short-wavelength blue and green light penetrates deeper, while long-wavelength red light is rapidly absorbed, creating specific light regimes for different species [8,9]. During early ontogeny, light perception can occur via extra-retinal photoreceptors (e.g., melanopsin expressed in the brain and skin) before retinal maturation, later transitioning to visual pigments [10,11,12]. These light signals are integrated by the neuroendocrine system, influencing a wide range of processes from metabolism and pigmentation to organismal homeostasis [1,2,4].

In aquaculture, artificial light is a critical technological parameter that can be used to mimic natural conditions or to deliberately modulate developmental trajectories, growth, and welfare [2,13,14,15]. However, its biological effects are profoundly species-specific [3,4,5,6,7,16,17,18,19,20,21,22,23,24,25,26,27], likely dependent on ecological niche and evolutionary adaptation [14]. For instance, blue light can impede growth [17] or induce a stress response in rainbow trout Oncorhynchus mykiss [21] but promote growth in gilthead seabream Sparus aurata [17] or leopard coral grouper Plectropomus leopardus [18,19]. Contrasting effects are observed even within the same spectral range: green light was associated with the highest malformation rate in turbot Scophthalmus maximus [3], yet enhanced feeding in Chinese longsnout catfish Leiocassis longirostris [23]. Similarly, red light can suppress growth in turbot [24] and alter behavior in steelhead trout [25], but improve growth and lipid content in tilapia Oreochromis niloticus [27]. Blue light has been shown to improve feeding success in haddock Melanogrammus aeglefinus larvae [26] and promote more homogeneous growth in tilapia [27]. Beyond growth and behavior, specific spectra can modulate immuno-physiological parameters, such as red blood cell count and total protein levels [28]. Consequently, targeted spectral regimes are used to optimize aquaculture outcomes [2,29] (e.g., blue light for rainbow trout [22] or green light for some flatfish [30,31]). The pattern of exposure is also critical, as demonstrated in zebrafish Danio rerio, where single-pulse light delayed hatching while continuous irradiation accelerated development [32].

To objectively assess certain light spectrum and intensity effects a multi-level biomarker approach is essential [33]. Key molecular indicators include heat shock proteins (HSPs) [34,35], particularly the highly conserved and abundant HSP-90, which stabilizes client proteins under stress and is involved in immune function and steroid signaling [36,37,38,39,40,41]; and mitochondrial creatine kinase (MtCK), a pivotal enzyme for cellular energy buffering and a sensitive marker of oxidative and metabolic stress [42,43,44]. At the cellular level, telomere dynamics (length and telomerase activity) provide insight into replicative history and stress-induced ageing [45], while classical hematology, especially the leukocyte profile and the neutrophil-to-lymphocyte ratio, serves as a reliable, responsive indicator of physiological and immunological status in fish [46,47,48].

The Baikal whitefish Coregonus baicalensis and its artificially produced atypical for the natural environment hybrid with the Yenisei hump-snout whitefish C. fluviatilis represent compelling models for this research. The ecology, physiology, and evolution of whitefish are comprehensively documented [49,50,51,52], providing a robust foundation for subsequent studies. In particular, Baikal whitefish have emerged as model organisms for investigating morpho-functional adaptations [53,54,55,56], telomere biology [45,57], and stress biology [58,59], and their natural populations and spawning conditions have also been well studied [50,53]. In addition, they are of significant and growing interest for aquaculture due to their economic value [60,61,62,63,64] and, in the case of the hybrid, its rapid growth performance [48,49,50]. Furthermore, natural populations of endemic Baikal whitefish are declining, making the development of scientifically grounded, optimized artificial incubation protocols crucial for both conservation stocking and sustainable commercial production [48,51,63]. However, a critical gap in this effort is the lack of data on the influence of a key abiotic factor, light spectrum, on their early development. This is particularly relevant given the known photosensitivity of whitefish eggs [50] and the fact that their natural under-ice spawning environment in Lake Baikal is spectrally restricted, dominated by shorter blue-green wavelengths [50,65].

Therefore, this study aimed to investigate the species- and stage-specific effects of different light spectra on the embryonic development of Baikal whitefish and its hybrid (Baikal whitefish ♀ × Yenisei hump-snout whitefish ♂). Embryos were incubated under white light (at two intensities: LDWmin as a technical control and LDWmax), complete darkness, and monochromatic red (LDR, peak at 631 nm), blue (LDB, peak at 459 nm), and green (LDG, peak at 507 nm) light. A comprehensive stress assessment was performed by analyzing telomere length, telomerase activity, HSP-90 and MtCK gene expression, and analysis of the blood profiles. We hypothesize that: (1) spectral conditions deviating from the natural under-ice photic environment (i.e., red light and complete darkness) will act as significant stressors, eliciting distinct molecular and cellular stress responses; (2) blue and green light, spectrally aligned with the natural spawning niche [50,65], will be comparatively neutral or favorable; and (3) the hybrid form, as an evolutionarily novel and potentially less stabilized genotype, will exhibit heightened sensitivity to these environmental stressors compared to the native Baikal whitefish, as suggested by the concept of hybrid instability and prior observations [48].

2. Materials and Methods

2.1. Fertilization and Egg Incubation

Fertilization of native Baikal whitefish eggs for subsequent incubation and experimentation was conducted in late December in Chivyrkuisky Bay, Lake Baikal, within the species’ spawning migration area near Kurbulik settlement (Republic of Buryatia, 53°42′14.3″ N, 109°02′16.8″ E). The second study subject was a hybrid between Yenisei hump-snout whitefish (♂) and Baikal whitefish (♀), produced via artificial fertilization in late December. Cryopreservation of the Yenisei hump-snout whitefish sperm for subsequent hybrid production was performed in October on the Upper Angara River, approximately 80 km upstream from Novy Uoyan settlement (Republic of Buryatia, 56°10′50.1″ N, 111°37′56.5″ E). The use of cryopreserved sperm enabled hybridization between geographically and temporally isolated species. Unlike the Yenisei hump-snout whitefish, which spawns in tributaries during autumn, Baikal whitefish spawn later in the lake’s shallow bays under the ice [64]. All procedures followed established methodological guidelines [50,66], which are based on the long-term operation of field incubation facilities and prior physiological-embryological research.

Incubation of the fertilized eggs was carried out at the Experimental Freshwater Aquarium Complex of Baikal Hydrobionts of the Limnological Institute, Siberian Branch of the Russian Academy of Sciences (Listvyanka settlement). After fertilization, the eggs were initially incubated for up to 35 days (until stage V of optic vesicle formation [50]) in a scaled-down system based on the Weiss apparatus [48], which is designed for commercial whitefish egg incubation. During this phase, incubation was carried out under natural light with a continuous supply of aerated Baikal water. Subsequently (from day 35 until larval hatching in April–May), the eggs were transferred to a specially designed system (Figure 1). This system consisted of boxes with individual lighting, each containing non-pyrogenic 12-well cell culture plates (flat bottom with low-evaporation lid; Wuxi Nest Biotechnology Co., Wuxi, China). Each well was filled with 3–4 mL of Baikal water, which ensured sufficient medium for gas exchange and minimized water volume to facilitate screening of multiple treatment groups, and were maintained at 1–3 °C for eggs, and then at 3–6 °C for juveniles after hatching. The eggs (2–4 per well) were monitored carefully, with water changes performed at 48 h intervals.

Figure 1.

A system of boxes with individual lighting: (a) an aluminum lid with mounted RGBW LED strips, (b) separate 12-well plates containing incubating whitefish eggs, (c) general view of a foam box with individual thermometers, (d) a system of boxes with holes for aeration inside a refrigerated unit at a temperature of 1–6 °C.

2.2. Experimental Design

On day 35 post-fertilization, the formation of optic vesicles, corresponding to developmental stage V (according to the whitefish embryonic stages by [50]), was observed (Figure 2). From this stage onwards, the eggs were incubated in specially designed system of boxes with individual RGBW LED strips (Cononlux Technology Co., Shenzhen, China) under different conditions: white light at two intensities of 1.8 and 20 µmol m⁻² s⁻¹ (LDWmin and LDWmax, respectively), complete darkness, red light (LDR, maximum peak at 631 nm, 2.2 µmol m⁻² s⁻¹), blue light (LDB, maximum peak at 459 nm, 1.7 µmol m⁻² s⁻¹), and green light (LDG, maximum peak at 507 nm, 2.1 µmol m⁻² s⁻¹) (see Figure A1 for measured spectra). Cold white light (with color temperature ~6500 K) was used for LDWmin and LDWmax, as it most closely matches natural daylight, provides a balanced full spectrum, and is common in fishery and aquaculture [31,67].

Figure 2.

Light experiment: effects of light spectrum and intensity on the early developmental stages of Baikal whitefish and its hybrid. Experimental lighting was initiated at the stage of optic vesicles formation (Stage V, 35 days’ post-fertilization). Sampling was performed at the following stages: I (Stage VII, 75 days’ post-fertilization); II (Stage IX, 180 days’ post-fertilization); III (Stage XIII, 30 days’ post-hatch); IV (Stage XIV, 45 days’ post-hatch).

The moderate-intensity white light (LDWmin, 1.8 µmol m⁻² s⁻¹) served as the primary technical control for statistical comparison. This condition replicates the full-spectrum lighting commonly used in commercial aquaculture practices [1,29,67]. Its intensity was calibrated to approximate the light level in the littoral zone of Lake Baikal in March under a 10 cm snow cover [68], where Baikal whitefish spawn at 5 m depth, representing a realistic scenario during mid-incubation [50,64]. Using a standardized white LED light as a control, rather than variable uncontrolled natural daylight, is a scientifically justified and often preferable approach [1], as it ensures strict experimental reproducibility and isolates the spectral factor, which is critical for attributing any observed effects specifically to the light spectrum [1,29]. However, for the purpose of biological interpretation and identification of optimal cultivation conditions, an additional frame of reference was used. Based on the primary findings of this study, the green light treatment (LDG) consistently supported the most favorable blood profiles, and resulted in the highest survival rates among all treatments (see Section 2.3 and Section 4.2). This interpretation is further supported a priori by the species ecology: the natural under-ice photic environment during Baikal whitefish spawning is dominated by the blue-green spectrum due to selective absorption by snow, ice, and water itself [50,65]. Consequently, the data analysis employed a dual comparative approach: (1) all spectral treatments were statistically compared against the technical control (LDWmin) to quantify the effects of spectral deviation from a common aquaculture standard; and (2) stress biomarker levels in all other treatments were evaluated relative to the optimal spectral condition (LDG), which mimics the natural environment (ecological control). This approach allowed us to assess both the stress induced by atypical spectra relative to common practice and to identify the most favorable lighting regime for practical aquaculture applications.

The monochromatic treatments had slightly varying intensities (1.7–2.2 µmol m⁻² s⁻¹) but these were all maintained as close as technically possible to the primary technical control intensity (LDWmin, 1.8 µmol m⁻² s⁻¹), while LDWmax was a separate high-intensity treatment. The high-intensity white light treatment (LDWmax, 20 µmol m⁻² s⁻¹) was chosen to simulate a potentially stressful condition of excessive brightness and to test whether negative effects could arise from the intensity of irradiance per se, independent of spectral composition. The light intensity of LDWmax was comparable to that under snow-free ice cover in Chivyrkuisky Bay of Lake Baikal [68] and represents a potentially possible level in artificial aquaculture conditions. Light intensity was controlled using a light meter LI-250A equipped with LI-190R Quantum Sensor (Li-COR, Lincoln, NE, USA), and the spectral composition was measured using a mini-spectrometer (Model HPCS-300P, Hangzhou Hopoo Light&Color Technology Co., Hangzhou, China). Continuous monitoring of these parameters confirmed the consistency of conditions throughout all experiments (Figure A1).

A photoperiod of 15 h of light and 9 h of darkness, simulating mean winter-spring conditions at Lake Baikal, was maintained. The water temperature was gradually increased from 1 °C to 6 °C over the course of the experiment, which corresponds to the spring warming of water in natural conditions. Embryos were maintained in individual chambers until hatching. After hatching, all larvae and juveniles were incubated under LDWmin, with only the persistent (delayed) effects of the earlier treatments being observed (Figure 2).

2.3. Survival Rates, Sample Collection and Ethical Standards

Survival rates were monitored throughout the experiment to evaluate the trade-off between developmental pace (hatching time) and overall viability under monochromatic light. Notably, although monochromatic treatments delayed hatching, they significantly reduced mortality by 21–46% compared to white light (the technical control). This substantial increase in survival suggests that these spectra enhance early viability.

Whitefish eggs from the control and treatment groups were collected using a Pasteur pipette at 75- and 180-days post-fertilization (dpf) (stages VII and IX, according to [50]). Larvae and fry were sampled at 30- and 45-days post-hatch (dph) (stages XIII and XIV, according to [50]). For each experimental and control group, 15 individuals were sampled. A total of 2880 eggs/larvae were analyzed. The individual embryo/larva was treated as the statistical unit in survival and molecular analyses.

Samples were taken from euthanized eggs, larvae, and fry. Euthanasia was performed using tricaine methanesulfonate (MS-222) in accordance with the 2020 AVMA Guidelines for the Euthanasia of Animals. The experimental protocol and publication of the results were approved by the Ethics Committee of the Limnological Institute SB RAS, in compliance with the standards and guidelines on animal welfare (Protocol #4, 3 November 2025). Samples were preserved in 70% ethanol and TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA).

2.4. Telomere Length and Telomerase Activity Analyses

Genomic DNA was extracted employing a standard phenol/chloroform protocol [69,70]. Subsequently, the DNA concentration was determined using a Rotor-Gene Q 6000 instrument (QIAGEN, Hilden, Germany). Following DNA concentration measurement, the sample with the highest concentration was selected and serially diluted (5–6 steps) to generate a standard curve for PCR, enabling the quantification of telomeric and reference gene concentrations in the test samples.

Telomere length quantification was performed using quantitative polymerase chain reaction (qPCR). The relative telomere length (RTL), expressed as the T/S ratio of telomere to single-copy gene DNA concentration, was quantified via qPCR on a Rotor-Gene Q 6000 instrument, following the protocol established by Cawthon [71]. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene served as the reference gene for normalization. The primer pair was designed based on the Atlantic salmon Salmo salar gene sequence (BT045621). The following primer sequences were utilized: reverse, 5′-ACAGCCTACGACACAGAGACTAA-3′; and forward, 5′-GCACTCACACCCTCCATAAC-3′. Each qPCR reaction was prepared in a final volume of 10 µL and consisted of the following components: 1× Snp buffer, 2.5 mM MgCl₂ (Evrogen, Moscow, Russia), 0.25 mM dNTP, 0.2 U Snp polymerase, 0.5× SYBR Green dye (Lumiprobe, Hunt Valley, MD, USA), 0.2–0.3 ng of DNA, and 0.5 pmol of each GAPDH primer. The telomere qPCR assay utilized 0.17 pmol Tel1 and 0.5 pmol Tel2 primers in place of the GAPDH primers. Following an initial 3 min activation at 95 °C, amplification in the telomere reaction was carried out for 45 cycles (95 °C for 15 s, 54 °C for 2 min). The reference gene fragment was amplified using touchdown qPCR, involving a gradual decrease in the primer annealing temperature from 64 °C to 58 °C over the first seven cycles. A single cycle for GAPDH consisted of the following steps: 10 s at 95 °C, 15 s at 58–64 °C, and 15 s at 72 °C. The cycle was repeated 35 times. Telomere length was measured in triplicate (technical replicates) for each of the 15 biological samples per group using qPCR. The mean value ± SD was used to represent the T/S ratios.

To complement the telomere length analyses, telomerase activity was assessed via a quantitative telomere repeat amplification protocol (Q-TRAP) in real-time [47,72]. Total protein was extracted from both control and experimental fish using CHAPS buffer, following the procedure outlined by Yip et al. [73]. To improve the accuracy of protein concentration determination, the protein mixture was purified from CHAPS buffer components by adding 200 µL of acetonitrile (Cryochrom, St. Petersburg, Russia) to 50 µL of the mixture, followed by centrifugation at 13,400× g for 10 min. Following solubilization in 8 M urea (Sigma-Aldrich, Burlington, MA, USA), the protein concentration was measured using a commercial Bradford reagent (Sileks, Moscow, Russia) [74].

Telomerase activity was quantified using the Q-TRAP assay on a Rotor-Gene Q 6000 instrument, based on the work of Yip et al. [73] with minor changes. The 15 µL reaction mixture contained the following components: 1× reaction buffer (Evrogen, Moscow, Russia), 1× Encyclo DNA polymerase, 0.25 mM dNTPs, 0.5× SYBR Green dye, 1 pmol of TS primer [75], 0.5 pmol ACX primer [76], and 200 ng of protein extract. The protocol began with a telomerase-mediated extension step, in which the TS primer was incubated at 6 °C for 30 min to reflect the natural habitat temperature of whitefish. Telomerase was then inactivated, and the polymerase activated, by heating at 95 °C for 10 min. Amplification proceeded for 35 cycles under the following conditions: 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 60 s. A no-template control, containing all components except the protein extract, was included in each run. All samples were analyzed in duplicate. Cycle threshold (Ct) values, automatically assigned from fluorescence amplification curves, were used to quantify activity. Relative telomerase activity (RTA) was computed using the comparative ΔΔCt quantification approach [77], as integrated into the Rotor Gene Q 6000 software (version 2.3.1). The activity level of the first control fish was normalized to 1, and all other values were expressed relative to this reference, consistent with the approach described by Yip et al. [73].

2.5. RNA Extraction and qPCR for Genes Expression Analysis

Total RNA extraction from whole eggs and larvae was performed with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. For this type of analysis, 15 specimens per group were also used. The quality of the extracted RNA was assessed using an EzDrop1000 spectrophotometer (Bluy-Ray Biotech, New Taipei City, Taiwan). For qPCR analysis, two significantly expressed genes, HSP-90 and MtCK, were analyzed, with GAPDH used as the reference gene [51,78]. Primers for MtCK and HSP-90 were designed with Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/; accessed on 5 February 2026) using the previously obtained and annotated whitefish gene sequences [51]. Details regarding primer design, including nucleotide sequences, are presented in Table 1.

Table 1.

Primers for quantitative real-time PCR (qPCR) analysis.

Name	Primer Sequence (5′-3′)	Reference	Product Size (bp)
GAPDH F GAPDH R	CCGTCCGTCTGGAGAAGGC GAAGTGGTCGTTCAGAGCAATG	[78]	183
MtCK F MtCK R	GACGGACAGTCTCTCCACTG TGTAGGGAGGGGATGACCTG	[51]	134
HSP-90 F HSP-90 R	TGGTGCCACGACCAATAGAC GGTGGCTGAGAGAGTGACTG	[51]	128

The qPCR was performed using a BIO-RAD CFX96 Touch Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). The qPCR mixture contained 0.25 mM dNTPs, 0.2 U Snp polymerase, 2.5 mM MgCl₂ (Evrogen, Moscow, Russia), 1× Snp buffer, 0.5× SYBR Green due (Lumiprobe, Hunt Valley, MD, USA), 0.2–0.3 ng DNA, and 0.5 pmol of each primer. DNA polymerase was activated at 95 °C for 3 min. During qPCR, the target and reference gene fragments were amplified simultaneously with a primer annealing temperature of 60 °C. A single cycle consisted of three standard steps: 10 s at 95 °C, 15 s at 60 °C, and 15 s at 72 °C. The PCR protocol consisted of 40 cycles. Data analysis was performed using the BIO-RAD instrument’s software package, where the relative quantification of the target gene expression was computed based on the ΔΔCq method.

2.6. Hematological Analysis

To monitor inflammatory activity and oxidative stress indicators, azure-eosin-stained smears of peripheral blood from individuals were examined under an Axiostar plus light microscope equipped with an AxioCam ICc1 camera (Zeiss, Jena, Germany). Differential cell counts were performed for peripheral blood (classifying erythroblasts, myeloblasts, lymphoblasts, hemocytoblasts, macrophages, lymphocytes, and neutrophils) in accordance with the previously described methodology [47,48]. A minimum of 139 and up to 394 cells were analyzed per sample, with 15 specimens studied per experimental group. The neutrophil-to-lymphocyte (N:L) ratio was calculated as a key systemic inflammatory index based on the differential counts obtained from these smears.

2.7. Statistical Analysis

The data were first tested for compliance with parametric test assumptions. Homogeneity of variances was verified using the Brown-Forsythe test, and normality was assessed with the Shapiro–Wilk test. Although the assumption of equal variances was met (p > 0.05), deviations from normality were detected in some distributions. Therefore, non-parametric statistical methods were employed for robust inference. Specifically, differences among the experimental groups with the technical control (LDWmin) or the ecological control (LDG) were evaluated with the Kruskal–Wallis H-test implemented in the Statistica 10 software package (StatSoft, Tulsa, OK, USA). Results were deemed statistically significant when p-values were below 0.05.

3. Results

3.1. Species- and Stage-Specific Telomere and Telomerase Responses

The analysis established that telomere length significantly increases during early development from embryo to larva and fry in whitefish, irrespective of the light spectrum, suggesting that ectothermic vertebrates are capable of active telomere regulation during early ontogeny (Figure 3). Notably, a difference in dynamics was observed: telomere elongation occurred in the hybrid already by the larval stage, potentially indicating an altered pace of developmental maturation due to heterosis effects compared to the parental Baikal whitefish, where gradual elongation was observed only by the fry stage.

Figure 3.

Dynamics of changes in telomere length and telomerase activity in Baikal whitefish (C. baicalensis) and its hybrid during embryogenesis under different light. 1—Stage VII, 75 days’ post-fertilization; 2—Stage IX, 180 days’ post-fertilization; 3—Stage XIII, 30 days’ post-hatch; 4—Stage XIV, 45 days’ post-hatch. Dark—complete darkness; R—red; B—blue; G—green; Wmax—high-intensity white light; Wmin—low-intensity white light. Data are presented as mean ± standard deviation for n = 15 individuals per group. Asterisks denote statistically significant differences relative to stage VII, 1st sampling (* p < 0.05, Kruskal–Wallis test).

Consistent with these findings, analysis of telomerase activity revealed patterns that complement the telomere length dynamics (Figure 3). Telomerase activity significantly increased during early development from embryo to larva and fry in Baikal whitefish and its hybrid, independent of the light spectrum, confirming the potential for active telomere maintenance in early ontogeny.

However, irrespective of these natural developmental patterns, a significant telomere shortening was observed in Baikal whitefish embryos (stage VII, according to [50] and experimental design at Figure 2), incubated under the red spectrum, relative to the technical control (LDWmin) (Figure 4). This shortening is biologically consistent, as telomeres are inherently short at this embryonic stage (Figure 3), and the natural phase of telomere elongation has not yet commenced. Consequently, exposure to suboptimal conditions predictably exacerbates telomere attrition. In contrast, hybrid larvae and fry exposed to red light exhibited a significant increase in telomere length (Figure 4). At these later developmental stages, the natural trajectory involves telomere elongation (Figure 3); thus, under unfavorable conditions, we may be observing an intensification of this pre-existing trend. Complete darkness also stimulated telomere elongation at the hatching and fry stages in Baikal whitefish, and at the larval and fry stages in the hybrid. In addition, high-intensity white light (LDWmax) exerted a negative effect by increasing telomere length in hybrid fry (stage XIV) as a persistent change (Figure 4). This effect is also evident in the stage-by-stage telomere dynamics observed during ontogeny under LDWmax exposure. Exposure to other light spectra (blue and green) did not induce significant changes in telomere length relative to the technical control (LDWmin).

Figure 4.

Changes in relative telomere length in Baikal whitefish (C. baicalensis) and its hybrid under different light conditions. Dark—complete darkness; R—red; B—blue; G—green; Wmax—high-intensity white light; Wmin—low-intensity white light. Data are presented as mean ± standard deviation (n = 15 per group). Statistical significance was assessed using the Kruskal–Wallis test (* p < 0.05). Black asterisks indicate significant differences from the technical control (tc, Wmin, aquaculture standard); green asterisks indicate significant differences from the ecological control (ec, G, natural environment). Arrows indicate a notable decline (↓) or rise (↑) in the parameters.

These light-induced alterations in telomere length were accompanied by corresponding modulations in telomerase activity (Figure 5). In Baikal whitefish, elevated telomerase activity was observed at the embryonic stage under red light, blue light, and complete darkness, compared to both the technical control (LDWmin) and the ecological control (LDG). In the hybrid, telomerase activity increased at the hatching stage under darkness, red, blue, and high-intensity white light (LDWmax). At the fry stage, telomerase activity was especially increased in darkness but decreased under green light in both Baikal whitefish and its hybrid. Collectively, these data suggest that the red and blue light, as well as complete darkness, appeared to increase telomerase activity, which may indicate the activation of adaptive mechanisms under unfavorable environmental conditions (Figure 5). Moreover, the data obtained from comparing results under red light and in complete darkness using the technical control (LDWmin) as the common aquaculture standard are largely confirmed when the results are compared with the ecological control (LDG), which mimics the natural environment of Lake Baikal during the spawning season of Baikal whitefish.

Figure 5.

Changes in relative telomerase activity in Baikal whitefish (C. baicalensis) and its hybrid exposed to different light. Dark—complete darkness; R—red; B—blue; G—green; Wmax—high-intensity white light; Wmin—low-intensity white light. Data are presented as mean ± standard deviation (n = 15 per group). Statistical significance was assessed using the Kruskal–Wallis test (* p < 0.05, ** p < 0.01). Black asterisks indicate significant differences from the technical control (tc, Wmin, aquaculture standard); green asterisks indicate significant differences from the ecological control (ec, G, natural environment). Arrows indicate a notable decline (↓) or rise (↑) in the parameters.

3.2. Analysis of Differential HSP-90 Expression

The results demonstrated that HSP-90 gene expression in Baikal whitefish was upregulated in darkness and under red light at the embryonic stage, compared to both the technical control (LDWmin) and the ecological control (LDG), followed by a significant decrease by the hatching stage (Figure 6). No significant alterations in the expression of this gene were observed under different light conditions at other developmental stages. Thus, Baikal whitefish exhibited sensitivity in this biomarker specifically during embryonic stages under direct exposure, with no apparent persistent effects. In contrast, the hybrid showed increased HSP-90 gene expression under red light at the embryonic stage and under blue light at the larval stage, indicating persistent effects from exposure to blue light (Figure 6).

Figure 6.

Changes in HSP-90 gene expression in Baikal whitefish (C. baicalensis) and its hybrid exposed to different light. Dark—complete darkness; R—red; B—blue; G—green; Wmax—high-intensity white light; Wmin—low-intensity white light. Data are presented as mean ± standard deviation (n = 15 per group). Statistical significance was assessed using the Kruskal–Wallis test (* p < 0.05, ** p < 0.01). Black asterisks indicate significant differences from the technical control (tc, Wmin, aquaculture standard); green asterisks indicate significant differences from the ecological control (ec, G, natural environment). Arrows indicate a notable decline (↓) or rise (↑) in the parameters.

3.3. Modulation of Energy Metabolism via MtCK Expression

Data analysis revealed that in Baikal whitefish, MtCK gene expression was significantly decreased only at the early stage under red light, compared to both the technical control (LDWmin) and the ecological control (LDG) (Figure 7). In the hybrid, MtCK gene expression was upregulated at the embryonic stage under red light and at the larval stage under the blue light, mirroring the expression pattern of the HSP-90 gene and indicating delayed effects of blue light exposure. However, at the fry stage, a decrease in MtCK gene expression was observed under darkness and blue light (Figure 7).

Figure 7.

Changes in creatine kinase (MtCK) gene expression in Baikal whitefish (C. baicalensis) and its hybrid exposed to different light. Dark—complete darkness; R—red; B—blue; G—green; Wmax—high-intensity white light; Wmin—low-intensity white light. Data are presented as mean ± standard deviation (n = 15 per group). Statistical significance was assessed using the Kruskal–Wallis test (* p < 0.05). Black asterisks indicate significant differences from the technical control (tc, Wmin, aquaculture standard); green asterisks indicate significant differences from the ecological control (ec, G, natural environment). Arrows indicate a notable decline (↓) or rise (↑) in the parameters.

3.4. Changes in the Blood Profiles

The investigation of peripheral blood profiles revealed complex, stage-specific alterations in hematopoiesis in response to different light spectra in both Baikal whitefish and its hybrid. The key inflammatory index, the neutrophil-to-lymphocyte (N:L) ratio, was significantly elevated during embryogenesis under dark, red, and blue light in both forms, indicating a stress-induced leukocyte shift (Figure 8 and Figure 9, Table A1 and Table A2). Beyond this ratio, detailed differential counts showed pronounced changes in the proportions of specific blast cell types.

Figure 8.

Changes in the blood profile of Baikal whitefish (C. baicalensis) exposed to different light (percentage of the total blood cells). EB—erythroblasts; MB—myeloblasts; LB—lymphoblasts; GCB—hemocytoblasts; MP—macrophages; N:L—neutrophil-to-lymphocyte ratio. Data are presented as mean value (n = 15 per group). Statistically significant differences from the technical control (tc; Wmin, aquaculture standard) are indicated by asterisks (* p < 0.05, Kruskal–Wallis test). Arrows indicate a notable decline (↓) or rise (↑) in the parameters. Data indicating standard deviations (SD) are given in Table A1.

Figure 9.

Changes in the blood profile of the whitefish hybrid exposed to different light (percentage of the total blood cells). EB—erythroblasts; MB—myeloblasts; LB—lymphoblasts; GCB—hemocytoblasts; MP—macrophages; N:L—neutrophil-to-lymphocyte ratio. Data are presented as mean value (n = 15 per group). Statistically significant differences from the technical control (tc; Wmin, aquaculture standard) are indicated by asterisks (* p < 0.05, Kruskal–Wallis test). Arrows indicate a notable decline (↓) or rise (↑) in the parameters. Data indicating standard deviations (SD) are given in Table A2.

At the earliest embryonic stage (VII, 75 dpf), hematopoiesis was predominantly erythropoietic. In Baikal whitefish, a significant increase in the proportion of erythroblasts (EB) was observed under blue (85.6%), green (95%), and high-intensity white light (LDWmax, 94.7%) compared to the technical control (LDWmin, 75%). Notably, under green and LDWmax light, erythropoiesis appeared almost exclusive, with myeloblasts (MB) and lymphoblasts (LB) proportions minimized. In contrast, red light and darkness promoted a more mixed profile with a lower EB percentage and a higher relative share of MB and LB (Figure 8, Table A1). In the hybrid, the EB proportion was consistently high (64.4–72.5%) across all spectra at this stage (Figure 9, Table A2), showing less variability than in Baikal whitefish.

By the pre-hatching stage (IX, 180 dpf), the focus of hematopoiesis shifted. In Baikal whitefish, myeloblasts became the dominant cell type across all light conditions (43.6–64.3% of total cells), indicating active granulopoiesis. The proportion of erythroblasts decreased substantially. A notable appearance of hemocytoblasts (GCB), multipotent hematopoietic stem cells, was recorded under darkness (16.3%) in Baikal whitefish, suggesting enhanced hematopoietic activity (Figure 8, Table A1). In the hybrid, the cellular profile was more heterogeneous (Figure 9, Table A2). While myeloblasts were also prevalent under red light (50%), darkness resulted in a unique profile with the highest EB proportion (46%) among all stage IX groups. Furthermore, a significant expansion of lymphoblasts (LB) was evident under blue light (41.3%) and green light (28.3%) in the hybrid, accompanied by a substantial proportion of GCB under green light (21.7%), pointing towards intensified lymphopoiesis.

Post-hatching, at the larval stage (XIII, 30 dph), myelopoiesis remained highly active. In Baikal whitefish, the myeloblast proportion was particularly elevated under darkness (76.9%) and white light conditions (60.4–61%) (Figure 8, Table A1). Under red light, a distinct response was observed: a sharp drop in EB (4.4%), a moderate MB level (47.8%), and a notable presence of both GCB (26.1%) and macrophages (MP, 13%). This profile suggests a stress-related shift towards phagocytic cell production and stem cell mobilization. In the hybrid, the cellular distribution was more balanced at this stage (Figure 9, Table A2). However, under blue light, a decreased EB proportion (14.5%) coincided with increased GCB (14.5%) and macrophage (8.2%) counts.

At the actively fry stage (XIV, 45 dph), divergent strategies became apparent. In Baikal whitefish, erythropoiesis was strongly promoted under blue light (EB: 60.6%) and under the technical control LDWmin (EB: 50%) (Figure 8, Table A1). Conversely, red light suppressed erythropoietic markers (EB: 10.7%) while promoting myelopoiesis (MB: 57.1%). The hybrid exhibited a widespread enhancement of erythropoiesis at this stage under all conditions except darkness and red light (Figure 9, Table A2). The most pronounced effect was seen under the technical control LDWmin (EB: 80%), followed by LDWmax (71.7%), green (59.3%), and blue light (52.1%). Darkness and red light resulted in a lower EB proportion (35% and 31.5%, respectively) and a more balanced profile including myeloblasts and hemocytoblasts.

In summary, the light spectrum induced profound and stage-specific reprogramming of hematopoiesis. Green and blue light tended to support or enhance erythropoiesis during critical early and late stages in Baikal whitefish, while red light and darkness consistently promoted a stress-associated profile characterized by granulopoiesis, stem cell mobilization, and phagocyte activation. The hybrid demonstrated greater heterogeneity and distinct sensitivities, particularly marked lymphopoiesis under blue light at stage IX and a robust erythropoietic response to most spectra at the fry stage, underscoring its differential physiological response to the photic environment.

4. Discussion

4.1. Stressful Impact of Red Light and Darkness: Molecular and Cellular Evidence

This study reveals species- and stage-specific effects of different light spectra on the embryonic development of Baikal whitefish and its hybrid. The key finding is that red light and complete darkness act as significant stressors during embryogenesis, evidenced by telomere dynamics (Figure 4), relative telomerase activity (Figure 5), HSP-90 and MtCK genes expression (Figure 6 and Figure 7), and blood profiles (Figure 8 and Figure 9).

In both studied whitefish forms, red light and darkness induced significant dysregulation of HSP-90 gene expression at early stages (stage VII, according to [50]), followed by normalization (Figure 6). This aligns with observations in other species, where red light induced oxidative stress [79] and upregulated stress proteins like HSP-70 [80]. Heat shock proteins are conserved molecular chaperones, and their induction is a canonical response to proteotoxic stress, aimed at counteracting protein denaturation [81,82,83,84]. This proteotoxic component is supported by changes in the energy metabolism biomarker, mitochondrial creatine kinase (MtCK) (Figure 7). MtCK is crucial for cellular energy homeostasis and is sensitive to oxidative damage [85,86,87,88]. Its concurrent dysregulation with HSP-90 suggests a multifaceted stress response involving disrupted cellular energetics, a compensatory mechanism to maintain ATP levels under stress [43]. These molecular data are consistent with reported detrimental effects of long-wavelength light in other fish, such as reduced growth in Epinephelus akaara [89] and induced oxidative stress in Pagrus major [80].

Telomere dynamics provided further evidence of stress (Figure 4). Significant telomere shortening in Baikal whitefish at stage VII under red light, followed by elongation in both whitefish forms under red light and darkness at later stages, indicates suboptimal conditions. This molecular stress is strongly corroborated by hematological data in Baikal whitefish (Figure 8) and its hybrid (Figure 9). Red light and darkness promoted a stress-associated blood profile characterized by granulopoiesis, stem cell mobilization, phagocyte activation, and an elevated neutrophil-to-lymphocyte (N:L) ratio), a classic stress indicator in fish [46,48]. The suppression of erythropoietic markers under these conditions points to a broader dysregulation of hematopoietic function [48].

The mechanism of the light spectrum influence, capable of modulating fundamental cellular processes, appears stage-dependent, which accounts for the differential biomarker responses observed between stage V and stage XIV. During early development (beginning at stage V, with the formation of the optic vesicles), the primary mechanism of light perception might involve either extra-retinal photoreception [90,91] or whitefish egg pigments, such as carotenoids, which have absorption maxima around 462–492 nm [50,92,93,94]. However, given the absorption properties of known whitefish egg pigments [50,92,94], the stress response under red light (peak at 631 nm) could result from a lack of appropriate photic stimuli, functionally akin to darkness, disrupting normal signaling for homeostasis [47,72,92]. This disruption may impair mitochondrial function and energy allocation, thereby diverting them from core differentiation and growth processes [87,95].

In later stages (stage VII, blood circulation onset), the visual system likely becomes the primary mediator [10,12]. The functional retina contains a complement of opsins with distinct spectral sensitivities [92,96]. While the specific opsin profile in developing whitefish is unknown, the general sensitivity of larval fish visual systems is typically highest in medium (green) wavelengths [97]. Exposure to spectra with lower sensitivity (like red) may require higher irradiance for adequate neuroendocrine signaling via the hypothalamic-pituitary axis [98,99], potentially leading to suboptimal activation and the observed stress responses. Although retinal plasticity under monochromatic light is documented in teleosts [80,100,101], direct evidence in larvae is lacking, highlighting a need for future research.

The localized stress is then propagated systemically. It is likely communicated via the neuroendocrine axis (e.g., hypothalamus-pituitary-interrenal axis), stimulating cortisol release [102]. Cortisol, in turn, exerts broad systemic effects, which can suppress hematopoiesis, as observed via inhibited erythropoietic markers. Thus, the molecular signatures of proteotoxic and energetic stress (HSP-90, MtCK) are translated into cellular and systemic physiological dysregulation. The telomere elongation observed in Baikal whitefish and its hybrid under specific conditions at later stages of development (Figure 4) may represent a downstream consequence of this integrated stress cascade, reflecting a physiological trade-off where resources are allocated to telomere maintenance [47,103].

4.2. Benign Nature of Blue-Green Light and Ecological Rationale for Species-Specific Responses

In contrast to the stress induced by red light and complete darkness, our data show that blue and green light had more favorable effects on HSP-90, MtCK, and telomere length, in Baikal whitefish embryos (Figure 4, Figure 5, Figure 6 and Figure 7). In addition, the green and blue light tended to support or enhance erythropoiesis during critical early and late stages in Baikal whitefish (Figure 8, Table A1). Moreover, a critical observation from our study is the pronounced survival advantage under monochromatic light, particularly green, despite a delayed hatching. Unlike Baikal whitefish, its hybrid showed greater sensitivity (lower resistance) to blue light, which may be a result of heterosis effects [48]. This differential sensitivity was reflected both in molecular markers, such as telomerase, HSP-90, and MtCK (Figure 5, Figure 6 and Figure 7), as well as in cellular physiology, marked by pronounced lymphopoiesis and an elevated N:L ratio under blue light (Figure 9, Table A2), highlighting a unique response to the light spectrum. Our findings on high-intensity white light (LDWmax) also indicate that for the whitefish hybrid, maintaining a moderate light intensity is as crucial as selecting an appropriate spectrum, as excessive irradiance can trigger compensatory and potentially costly stress responses at the telomeres level (Figure 4).

The data obtained are ecologically consistent, as the aquatic environment can acts as a spectral filter, rapidly attenuating long-wavelength red light in the natural wildlife [9]. Unlike the Yenisei hump-snout whitefish, which spawns in tributaries during autumn, Baikal whitefish spawn in the lake’s shallow bays under the ice [64]. Bio-optical research in Lake Baikal confirms that snow, ice, and the ultra-oligotrophic water itself act as powerful spectral filters, creating a narrow under-ice light field predominated by blue-green wavelengths (~430–560 nm) [50,65,66,104]. Consequently, the underwater light field is strongly modified by selective absorption, creating a highly specific photic environment for developing whitefish embryos. In particular, previous research indicates that closely related whitefish species, such as Baikal omul Coregonus migratorius, at the early life stages exhibit positive phototaxis specifically towards the blue-green part of the spectrum [50,105]. Furthermore, studies of the optical characteristics of omul eggs using spectrophotometry have shown that the light absorption capacity of the eggs increases in various spectral regions during development [50,94]. The highest optical density of the eggs is in the blue region of the visible spectrum, while the lowest is in the yellow and red regions. Omul eggs (and those of other whitefish species) are light orange in color (600–580 nm) due to their carotenoid and cytochrome content. The green (~520 nm) and blue (~470 nm) wavelengths of light penetrating the ice into the water are complementary to orange and yellow, which promotes more complete absorption of solar radiant energy by the whitefish embryo [50]. Measurements show that green light is particularly prevalent and can dominate at the depth of the euphotic zone bottom, a pattern corroborated by observations of phytoplankton absorption spectra showing a distinct peak at ~560 nm at these depths, complementary to the ambient irradiance [106,107]. Therefore, our hypothesis that spectra deviating from this natural blue-green environment (such as red light or complete darkness) would act as stressors is strongly supported by both the bio-optical context of Lake Baikal and our experimental molecular data.

This assumption also holds true for other species in the context of the ecological habitat of these species. The key predictors are apparently the temperature, depth, season and, consequently, the predominant light environment during critical early ontogenetic stages in the wild. For instance, tilapia and rainbow trout often spawn in very shallow, littoral zones (0.2–3 m depth) [108,109], where long-wavelength red light is still present and may serve as a natural cue for surface or near-shore environments, potentially stimulating feeding or growth, as was shown in the experimental work [21,27]. In contrast, the embryos of many marine species, like red seabream or haddock, develop at greater depths or in pelagic zones [110,111] where water acts as a strong spectral filter, rapidly attenuating red light. This fact may explain why red seabream exhibited oxidative stress, suppressed appetite-related hormones, and poorest growth performance under exposure to red light in artificial conditions [80], while haddock larvae improved feeding success under blue light [26]. The ice winter conditions at spawning grounds are also a crucial factor, as even at relatively shallow spawning depths [50], an ice and snow cover acts as a spectral filter that attenuates the red spectrum, a situation exemplified by the Baikal whitefish. Complete darkness, while a potent stressor for most photoperiod-regulated species [50], might be neutral for those whose embryos develop in caves or under rocks. Thus, the optimal artificial light spectrum for a given species in aquaculture likely corresponds to the predominant wavelengths present in its natural spawning and nursery grounds during early development. Hybrids and artificially selected forms may exhibit atypical sensitivities due to disrupted co-adapted gene complexes governing photophysiological integration, as observed in the heightened response of the hybrid to blue light.

4.3. Telomere and Telomerase Dynamics: Integration in the Context of Stress and Early Development

The interpretation of the telomere length and telomerase activity results requires careful consideration not only in the context of spectral exposure, but within an ontogeny framework (Figure 3), particularly in light of contrasting findings in the literature on vertebrates [112,113,114]. The telomere shortening observed under red light in early-stage Baikal whitefish is consistent with the classical role of telomeres as biomarkers of stress and ageing [45,48,59,72]. However, a generalized telomere elongation and shift in telomerase activity occurred between embryonic and larval stages across all experimental conditions (Figure 3). This phenomenon, independent of light spectrum, points to an inherent potential for active telomere maintenance during the most energy-consuming phase of early ontogeny. Notably, this elongation occurred across all light conditions, which suggests a natural energy-intensive process of telomere maintenance during early ontogeny. These data are corroborated by telomere studies in Atlantic salmon Salmo salar, which also demonstrated significant telomere elongation between the embryonic and larval stages [115]. This finding contrasts with the typical telomere shortening observed during post-embryonic development in most vertebrates, which is associated with cellular aging processes [45,57]. Collectively, the present and previous [115] data suggest that telomere elongation is a viable physiological process in early fish development, potentially serving to mitigate environmental stressors.

The observed increase in telomerase activity under specific spectral conditions (red/blue light, darkness) (Figure 5) further suggests embryos can activate this enzyme as a compensatory mechanism. In general, telomere elongation facilitated by telomerase, which aligns with a trend of telomere lengthening during early ontogenesis, could be interpreted as an adaptive facilitating response that buffers the developing organism against environmental challenges and chromosomal damage. At these developmental stages, the natural trajectory involves telomere elongation (Figure 3). It is plausible, therefore, that the stressful conditions did not suppress but rather intensified these inherent restorative processes. In this context, the elongation in darkness or under red light in Baikal whitefish could be seen as a protective, plastic response mediated by upregulated telomerase.

Nevertheless, the longitudinal study of McLennan et al. [116] found that Atlantic salmon smolts with shorter telomeres had a higher probability of surviving their marine migration and returning to spawn. This finding suggests that in some contexts, shorter telomeres may not be a simple marker of poor health but could be linked to a life-history strategy involving greater investment in “physiological preparedness” for a challenging life stage, potentially mediated by hormones like cortisol. This investment may come at the cost of telomere maintenance [117]. This fact is also confirmed by the early shortening of telomeres in the whitefish hybrid, as well as a decrease in telomerase activity in both Baikal whitefish and its hybrid by the fry stage in this work, irrespective of the light spectrum (Figure 3). In particular, telomere erosion, driven by oxidative stress, may be a key pathway through which mitochondria are believed to accelerate the aging process at the cellular level [47,118]. Applying this framework, the telomere elongation (Figure 4) and elevated telomerase activity (Figure 5) observed in Baikal whitefish and its hybrid under red light and in darkness could also be reinterpreted. It might indicate a different, and potentially less optimal, allocation of resources driven by chronic stress [47,116,117]. The metabolic state of the hybrid, exhibiting heterosis, might prioritize telomere maintenance (via telomerase), diverting energy from other functions essential for immediate stress response or somatic growth. This is analogous to findings in rainbow trout, where chronic stress under unfavorable conditions can lead to physiological trade-offs that impact long-term fitness [17]. The fact that this elongation and telomerase activation occurs under conditions we have identified as stressful (red light) or devoid of natural spectral signals (darkness) supports the idea that it may be part of a dysregulated or costly stress response. The significant dysregulation of HSP-90 and MtCK in the hybrid under red and blue light, as well as in darkness at later stages, in particular at XIII and XIV stages (as a persistent effect, Figure 6 and Figure 7), confirms that these conditions indeed impose a physiological cost.

4.4. Implications for Aquaculture and Future Directions

The multi-biomarker approach, from molecular chaperones and energy metabolism to chromosomal integrity and blood cell dynamics, demonstrates that red light and complete darkness are suboptimal and stressful for the early development of both Baikal whitefish and its hybrid. In contrast, blue and green light, which better approximate the natural photic environment, either fail to activate these stress pathways in Baikal whitefish or modulate them in a more physiological manner in its hybrid. This allows embryonic cells to dedicate resources to programmed development rather than to costly stress mitigation, thereby providing a coherent molecular basis for the optimization of aquaculture lighting protocols. Notably, green and blue light were associated with stable or enhanced erythropoietic activity at the earliest stages in Baikal whitefish (Figure 8), suggesting a more supportive environment for hematopoietic development. These recommendations are consistent with optimized practices for several other species, such as the use of blue light for red seabream [80] and the avoidance of red light for long-term cultivation of steelhead trout due to its association with oxidative stress [119].

It has also been recently suggested that a dynamic lighting regime combining potentially beneficial and adverse spectra could be advantageous [119]. Specifically, in steelhead trout juveniles, a dynamic regime alternating more and less favorable spectra (1.5 h of blue, 9 h of red, and 1.5 h of blue light) was found to optimize digestive enzyme activity and protein synthesis, outperforming static monochromatic light [119]. This implies that while a favorable monochromatic light is often beneficial, simulating natural diel spectral shifts may create an even more advantageous environment for salmonids by supporting different physiological processes at appropriate times [119]. Therefore, future research in Baikal whitefish aquaculture should explore the efficacy of such dynamic spectral schedules, which could function as a form of hormesis [48,51,59,120,121,122]. This work certainly requires the inclusion of modern approaches, such as transcriptome and DNA methylation analyses in response to different light conditions.

In general, for optimizing the environment in aquaculture, our results strongly advise against using red light and complete darkness during the incubation of Baikal whitefish and hybrid eggs. Green light emerges as the most favourable choice, providing a light environment that supports healthy hematopoiesis and more stable cellular and genetic integrity during critical early developmental stages. The significant reduction in mortality under monochromatic regimes, particularly green light, provides a compelling practical rationale for modifying standard full-spectrum protocols. Introducing a controlled monochromatic component could act as a mild hormetic trigger, strengthening embryos and increasing survival, which is a key objective in aquaculture production. Future research should focus on the long-term fitness consequences of these early-life spectral exposures to fully validate these recommendations. In addition, separate experiments with direct effects on juveniles are needed to optimize their rearing conditions. The focus may shift to explore the potential of dynamic light spectra that mimic natural environments [119], and investigate the underlying neuroendocrine pathways, particularly those involving deep-brain photoreceptors [90,91], to fully validate and refine these recommendations.

5. Conclusions

This study demonstrates that the light spectrum is a critical environmental factor with significant and distinct effects on the molecular physiology of developing Baikal whitefish and its hybrid. The integrated, multi-biomarker analysis establishes that red light and complete darkness act as stressors during embryogenesis. These conditions induced a clear stress syndrome, including proteotoxic stress evidenced by upregulated HSP-90 expression, a disruption of cellular energy homeostasis indicated by dysregulated MtCK, and systemic inflammation marked by an elevated neutrophil-to-lymphocyte ratio and suppressed erythropoiesis. Concurrent alterations in telomere dynamics further underscore the suboptimal nature of these light environments for early development.

In striking contrast, green light provided the most favourable conditions, resulting in neutral stress biomarker profiles, supportive effects on hematopoiesis in Baikal whitefish, and the highest survival rates. This finding aligns ecologically with the natural under-ice photic environment of Lake Baikal, which is dominated by blue-green wavelengths. Blue light elicited a more complex, species-specific response. While generally less stressful than red light, blue light triggered pronounced stress biomarker reactions and specific hematopoietic shifts in the hybrid, highlighting its greater sensitivity compared to the native Baikal whitefish and underscoring the conditional suitability of this spectrum. Furthermore, our results indicate that light intensity itself can be an independent stressor, as high-intensity white light induced negative effects in the hybrid.

Therefore, for optimizing incubation protocols in aquaculture, we conclude that red light and complete darkness should be avoided, while green light provides a significantly less stressful environment that promotes early viability. These evidence-based recommendations offer a practical foundation for improving fish welfare and production efficiency in the cultivation of these valuable whitefish species.

Appendix A

Figure A1.

Spectral characteristics in different light conditions: LDR—red; LDB—blue; LDG—green; LDWmax—high-intensity white light; LDWmin—low-intensity white light. Light intensity was controlled using a light meter LI-250A equipped with LI-190R Quantum Sensor (Li-COR, Lincoln, NE, USA), and the spectral composition was measured using a mini-spectrometer (Model HPCS-300P, Hangzhou Hopoo Light&Color Technology Co., Hangzhou, China).

Table A1.

Comparison of Baikal whitefish (C. baicalensis) blood profiles ¹ (percentage of the total blood cells) in different light conditions.

		EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1			EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1
1 sampling: VII stage	Dark							2 sampling: IX stage	Dark
	M	62.2	29.7	8.1	0	0	3.7		M	20.4	51	12.3	16.3	0	4.1
	SD	2.6	2.6	0.2	0	0	0.2		SD	1.9	3.2	0.4	0.7	0	0.2
	LDR (Red)								LDR (Red)
	M	69.5	27.8	2.7	0	0	10.3		M	33.3	55.6	11.1	0	0	5
	SD	3.1	3.1	0.1	0	0	0.3		SD	2.1	2.9	0.5	0	0	1.7
	LDB (Blue)								LDB (Blue)
	M	85.6	10.6	3.8	0	0	2.8		M	37.5	56.2	6.3	0	0	8.9
	SD	4.1	0.5	0.1	0	0	0.1		SD	2.7	3.8	0.15	0	0	0.7
	LDG (Green)								LDG (Green)
	M	95	5	0	0	0	0		M	28.2	43.6	25.6	2.6	0	1.7
	SD	1.6	1.6	0	0	0	0		SD	1.6	1.6	1.1	0.14	0	0.1
	LDWmax (high-intensity white light)								LDWmax (high-intensity white light)
	M	94.7	5.3	0	0	0	0		M	30	50	25	0	0	2
	SD	1.9	1.9	0	0	0	0		SD	1.6	2.1	1.8	0	0	0.1
	LDWmin (low-intensity white light)								LDWmin (low-intensity white light)
	M	75	16.7	8.3	0	0	2		M	17.9	64.3	17.8	0	0	3.6
	SD	1.9	0.4	0.3	0	0	0.4		SD	1.8	4.2	0.5	0	0	0.1
		EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1			EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1
3 sampling: XIII stage	Dark							4 sampling: XIV stage	Dark
	M	17.4	76.9	3.8	0	1.9	20.2		M	28	30	30	2	10	1
	SD	1.6	1.6	0.6	0	0.1	1.5		SD	1.3	1.7	1.7	0.6	2.1	0.2
	LDR (Red)								LDR (Red)
	M	4.4	47.8	8.7	26.1	13	5.5		M	10.7	57.1	14.3	3.6	14.3	4
	SD	0.7	2.1	0.1	0.8	0.1	0.1		SD	2.2	1.9	2.6	0.1	2.6	0.2
	LDB (Blue)								LDB (Blue)
	M	17.7	49.4	25.3	3.8	3.8	1.9		M	60.6	10.8	0	25	3.6	0
	SD	1.9	1.6	1.1	0.1	0.1	0.1		SD	1.6	2.2	0	1.6	0.8	0
	LDG (Green)								LDG (Green)
	M	24	40	30	2	4	1.3		M	28.6	64.3	7.1	0	0	2
	SD	1.1	1.9	2.1	0.1	0.1	0.1		SD	2.2	2.4	1.6	0	0	1.1
	Wmax (high-intensity white light)								Wmax (high-intensity white light)
	M	22.3	61	13.9	0	2.8	4.4		M	25	45	22.5	7.5	0	2
	SD	1.7	1.9	1.6	0	0.1	0.8		SD	2.1	2.4	2.1	1.6	0	1.1
	Wmin (low-intensity white light)								Wmin (low-intensity white light)
	M	29.7	60.4	7.4	0	2.5	8.2		M	50	19.2	23.1	0	7.7	0.8
	SD	1.6	2.1	1.4	0	0.6	1.5		SD	3.2	2.1	2.9	0	1.6	0.2

¹ EB—erythroblasts; MB—myeloblasts; LB—lymphoblasts; GCB—hemocytoblasts; MP—macrophages; N:L—neutrophil-to-lymphocyte ratio. In the data, mean (M) ± standard deviation (SD) is displayed. Data are presented as mean value (n = 15 per group).

Table A2.

Comparison of whitefish hybrid blood profiles ¹ (percentage of the total blood cells) in different light conditions.

		EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1			EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1
1 sampling: VII stage	Dark							2 sampling: IX stage	Dark
	M	70	25	5	0	0	5		M	46	32	18	2	2	1.8
	SD	3.2	2.8	1.4	0	0	1.6		SD	3.2	2.8	1.6	0.1	0.1	0.1
	LDR (Red)								LDR (Red)
	M	72.5	25	2.5	0	0	10		M	28.5	50	14.3	7.2	0	3.5
	SD	4.3	2.4	0.1	0	0	0.4		SD	1.9	3.2	0.7	0.9	0	0.6
	LDB (Blue)								LDB (Blue)
	M	64.4	28.5	7.1	0	0	4		M	33.3	23.8	41.3	1.6	0	0.6
	SD	2.9	1.8	1.5	0	0	1.2		SD	2.6	1.8	4.3	0.6	0	0.1
	LDG (Green)								LDG (Green)
	M	66.7	33.3	0	0	0	0		M	17.4	30.4	28.3	21.7	2.2	1.1
	SD	1.6	1.6	0	0	0	0		SD	0.3	2.4	1.7	0.3	0.1	0.1
	Wmax (high-intensity white light)								Wmax (high-intensity white light)
	M	72	12	16	0	0	0.8		M	35	40	25	0	0	1.6
	SD	3.2	1.6	1.7	0	0	0.2		SD	1.8	1.8	0.6	0	0	0.1
	Wmin (low-intensity white light)								Wmin (low-intensity white light)
	M	71.4	14.3	14.3	0	0	1		M	25	37.5	37.5	0	0	1
	SD	2.1	0.6	0.3	0	0	0.1		SD	1.7	2.1	2.1	0	0	0.1
		EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1			EB 1	MB 1	LB 1	GCB 1	MP 1	N:L 1
3 sampling: XIII stage	Dark							4 sampling: XIV stage	Dark
	M	32.4	51.4	10.8	2.7	2.7	4.8		M	35	32	25	5	3	1.3
	SD	1.7	2.1	0.1	0.1	0.1	0.5		SD	1.7	1.6	2.7	0.2	0.1	0.1
	LDR (Red)								LDR (Red)
	M	34.7	32.7	18.4	10.2	4	1.8		M	31.5	38.9	11.1	14.8	3.7	3.5
	SD	2.6	2.6	1.3	0.9	0.1	0.1		SD	1.8	2.1	0.7	0.7	0.1	0.9
	LDB (Blue)								LDB (Blue)
	M	14.5	43.5	19.3	14.5	8.2	2.2		M	52.1	21.7	17.4	8.8	0	1.2
	SD	1.7	2.1	2.1	1.7	0.9	0.1		SD	1.9	2.1	2	1.6	0	0.3
	LDG (Green)								LDG (Green)
	M	30	34	30	4	2	1.1		M	59.3	25.9	0	14.8	0	0
	SD	1.6	1.8	1.6	0.3	0.2	0.2		SD	2.8	1.6	0	0.7	0	0
	Wmax (high-intensity white light)								Wmax (high-intensity white light)
	M	18.1	31.8	27.3	9.2	13.6	1.2		M	71.7	8.3	0	15	5	0
	SD	1.8	1.6	1.9	1.5	1.6	0.3		SD	1.7	0.5	0	1.1	0	0
	Wmin (low-intensity white light)								Wmin (low-intensity white light)
	M	19.5	39.8	36.1	0	4.6	1.1		M	80	20	0	0	0	0
	SD	1.3	1.8	1.8	0	0.2	0.2		SD	1.7	1.7	0	0	0	0

¹ EB—erythroblasts; MB—myeloblasts; LB—lymphoblasts; GCB—hemocytoblasts; MP—macrophages; N:L—neutrophil-to-lymphocyte ratio. In the data, mean (M) ± standard deviation (SD) is displayed. Data are presented as mean value (n = 15 per group).

Author Contributions

Conceptualization, Y.P.S., A.G.K., S.A.P. and L.V.S.; methodology, Y.P.S., A.G.K., V.M.Y., V.A.P., I.A.A., C.T., X.L., O.Y.G., A.A.E., E.A.V. and L.V.S.; software, S.A.P., A.A.E., E.A.V., V.A.P., C.T., X.L. and I.A.A.; validation, S.A.P., A.A.E., E.A.V., V.A.P., C.T., X.L. and I.A.A.; formal analysis, S.A.P., A.A.E., E.A.V., V.A.P., C.T., X.L. and I.A.A.; investigation, Y.P.S., S.A.P., A.G.K., V.M.Y., E.A.V. and A.A.E.; resources, Y.P.S., O.Y.G. and L.V.S.; data curation, Y.P.S., S.A.P., A.G.K., V.M.Y., E.A.V. and A.A.E.; writing—original draft preparation, Y.P.S.; writing—review and editing, Y.P.S., A.G.K., S.A.P., V.M.Y., V.A.P., I.A.A., C.T., X.L., O.Y.G., A.A.E., E.A.V. and L.V.S.; visualization, Y.P.S.; supervision, Y.P.S., A.G.K., S.A.P., O.Y.G., V.M.Y., V.A.P., C.T., X.L. and I.A.A.; project administration, Y.P.S., A.G.K., S.A.P. and L.V.S.; funding acquisition, Y.P.S., O.Y.G. and L.V.S. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The experiments and sampling were conducted under the animal welfare laws, guidelines, and policies of Russia, and approved by the Ethics Committee of Limnological Institute SB RAS (Protocol #4, 3 November 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author(s).

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was funded by the Russian Science Foundation, the grant No. RSF 25-24-00634 (https://rscf.ru/project/25-24-00634/, accessed on 12 December 2025).