Abstract
Multiple sclerosis (MS) is a chronic neuroinflammatory disorder characterized by demyelination, oligodendrocyte (OLG) loss, and progressive neurological decline. While current disease-modifying therapies primarily target immune responses, they offer limited neuroprotective or remyelinating effects. Through its receptors, including cannabinoid receptor type 1 (CB1R) and the G protein-coupled receptor GPR55, the endocannabinoid system (ECS) has emerged as a promising therapeutic target due to its roles in neuronal survival and glial function. To better study the functional role of these receptors and their potential as targets for remyelinating therapies, we sought a human cell model that lacks endogenous expression of CB1R and GPR55. Quantitative PCR confirmed that human OLG-derived HOG cells do not express these receptors, providing a clean background for transfection-based functional studies. Using this system, we found that expressing either CB1R or GPR55 was sufficient to confer resistance to cuprizone (CPZ)-induced cytotoxicity, while co-expression produced a comparable level of protection but uncovered a distinct pharmacological interaction consistent with functional receptor crosstalk. In situ proximity ligation assays confirmed the formation of CB1R/GPR55 receptor complexes in co-transfected cells. The protective effects were evident even under serum-containing conditions, suggesting that serum components may provide basal receptor activation. In serum-free conditions, selective activation of CB1R with arachidonyl-2'-chloroethylamide (ACEA) or GPR55 with CID1792197 enhanced cell survival, while the CB1R antagonist SR141716 blocked both ACEA- and CID1792197-induced protection. These cross-antagonistic interactions support the presence of heteromer-dependent signaling. Altogether, our findings identify CB1R/GPR55 heteromers as novel modulators of OLG resilience and highlight their potential as therapeutic targets for promoting neuroprotection and remyelination in demyelinating diseases such as MS.
Supplementary Information
The online version contains supplementary material available at 10.1007/s12035-026-05780-5.
Keywords: Demyelination, Neuroprotection, Oligodendrocytes, Cuprizone model, Endocannabinoid system, Receptor heteromers
Introduction
Multiple sclerosis (MS) is a chronic, immune-mediated neurodegenerative disorder of the central nervous system (CNS) characterized by progressive demyelination, axonal injury, and irreversible neurological disability [1–5]. Globally, MS is one of the leading causes of non-traumatic incapacity in young adults, with a significantly higher incidence in women than men [6, 7]. Epidemiological studies point to a rising prevalence in developed nations, a trend linked to genetic predisposition compounded by environmental risk factors such as vitamin D deficiency, Epstein–Barr virus (EBV) infection, smoking, and gut microbiota dysbiosis [8–10].
The pathogenesis of MS involves autoimmune activation, particularly of CD4+ T lymphocytes and B cells, which target myelin and trigger oligodendrocyte (OLG) apoptosis, neuroinflammation, and gliosis [1–3, 11, 12]. This leads to the formation of demyelinated plaques and progressive neurological decline, manifesting initially in a relapsing–remitting pattern before often transitioning to a secondary progressive stage [13–15]. Although disease-modifying therapies (DMTs), mostly immunomodulatory, have reduced relapse rates and delayed disability, no curative treatment exists and benefits in remyelination or neuroregeneration are limited [9, 16–18]. This gap has prompted recent studies to explore alternative molecular targets beyond traditional immune modulation, shifting the focus toward neuroprotective mechanisms aimed at preserving or restoring CNS function [19–21]. Notably, Sativex® (nabiximols) is among the most widely approved symptomatic treatments for MS-related spasticity. This oromucosal spray, derived from a standardized Cannabis sativa L. extract, contains Δ9-tetrahydrocannabinol (THC) and cannabidiol (CBD) in a 1:1 ratio [22–24]. The sustained clinical success of this formulation over more than a decade has attracted increasing attention to the endocannabinoid system (ECS), which plays a crucial regulatory role in the CNS by modulating synaptic plasticity, neuroinflammation, neuronal survival, and homeostatic responses to injury [25–28]. Consequently, there is increasing interest in the clinical potential of phytocannabinoids and of synthetic cannabinoids, particularly in targeting cannabinoid receptors, as promising candidates for neuroprotective interventions in MS [20, 29, 30].
Central to the therapeutic potential of the ECS are its primary receptors, cannabinoid receptor type 1 (CB1) and type 2 (CB2), which mediate diverse neurophysiological and immunomodulatory effects. CB1R are among the most abundantly expressed G protein-coupled receptors (GPCR) in the CNS, particularly in regions such as the hippocampus, cortex, basal ganglia, and cerebellum [31–34]. They are predominantly localized at presynaptic terminals, where they modulate neurotransmitter release through Gi/o-coupled mechanisms by reducing calcium influx and enhancing potassium efflux [35, 36]. The cascade decreases intracellular cAMP and activates MAPK (ERK1/2, p38, JNK) and PI3K/Akt signaling. These pathways contribute to motor coordination, cognitive function, pain modulation, and regulation of oxidative stress [36–38]. CB2R, primarily an immune-system receptor, is expressed by microglia and astroglia and is strongly upregulated during CNS injury or inflammation [39–43]. CB2R also couples to Gi/o proteins, modulating immune responses, reducing neuroinflammation, and contributing to neuronal cell survival [29, 44, 45]. Beyond these classical receptors, GPR55 has emerged as a putative third cannabinoid receptor of growing interest due to its structural divergence and distinct signaling profile. Despite its endogenous ligand is believed to be lysophosphatidylinositol (LPI), GPR55 also responds to various phytocannabinoids and synthetic ligands originally developed for CB1R, such as rimonabant and AM251 [46–48]. Unlike CB1R and CB2R, GPR55 primarily signals through Gα13 and RhoA, activating ERK1/2 and mobilizing intracellular calcium, processes involved in cell proliferation, migration, and cytoskeletal dynamics [36, 47, 49–51]. Although less studied, GPR55 is expressed in several CNS regions, including the striatum and the hippocampus, and has been associated with glial reactivity and neuroinflammatory responses [34, 36, 43, 52, 53].
Given this complex receptor landscape and their distinct signaling mechanisms, attention has turned to how the ECS contributes to the pathophysiology and/or treatment of MS [54, 55]. In this context, CB1R activation has been shown to promote neuronal and OLG survival, modulate glial reactivity, and reduce oxidative stress, contributing to a neuroprotective milieu [56–59]. In contrast, GPR55 expression is often elevated under inflammatory and demyelinating conditions, suggesting a complex or dualistic role that may depend on context and ligand availability [60]. Nevertheless, the complexity of cannabinoid signaling extends beyond classical receptor-ligand interactions. In fact, an emerging paradigm in cannabinoid pharmacology is receptor heteromerization, which confers novel functional properties distinct from those of individual receptors [61–63]. CB1R/GPR55 heteromers, for instance, have been identified in neuronal cultures and brain tissue from rodents and primates, particularly in the striatum, where they exhibit biased agonism, cross-antagonism, and unique calcium signaling dynamics [34, 64, 65]. This molecular interaction introduces a new layer of regulation in ECS signaling that may be particularly relevant in pathological states [43, 64]. Although OLGs in vivo are known to express CB1R, and GPR55 expression has been reported in glial cells, evidence for their co-expression in OLG lineage cells is still lacking. Notably, a recent study by Menéndez-Pérez et al. (2024) provided the first evidence of CB1R/GPR55 heteromer expression in post-mortem brain tissue of MS patients, specifically in the prefrontal cortex. Using a powerful technique, namely in situ proximity ligation assay (PLA), the authors demonstrated a significant upregulation of these heteromers in MS samples compared to controls [66].
There is a well-established murine model that recapitulates key MS pathologies [67–69]. Administration of the copper-chelating agent cuprizone (CPZ) induces reproducible demyelination in the CNS of mice, affecting both white and gray matter. This effect is mediated by the selective triggering of OLG apoptosis, astrocyte activation, and the generation of proinflammatory microglia [70–74]. Complementary to studies in animal models and to adapt to the methods that replace, reduce, and refine animal use, cell-based CPZ cytotoxicity models are increasingly used to explore the molecular mechanisms underlying MS, thanks to its simplicity, high reproducibility, and applicability in drug screening [75, 76]. The aim of the present study was to investigate the neuroprotective potential of CB1 and/or GPR55 receptors using the CPZ-induced cytotoxicity model in OLGs of human origin. Specifically, we assessed the effects of selective synthetic cannabinoid ligands, acting as agonists or antagonists of CB1R and GPR55, to elucidate receptor-dependent mechanisms of action. In addition, we examined possible pharmacological interactions between these receptors that could modulate cellular responses to CPZ-induced damage.
Materials and Methods
Drugs
N-(2-Chloroethyl)−5Z,8Z,11Z,14Z-eicosatetraenamide (ACEA; 1319 Tocris Bioscience, Bristol, UK), 5-(4-chlorophenyl)−1-(2,4-dichlorophenyl)−4-methyl-N-1-piperidinyl-1H-pyrazole-3-carboxamide (SR141716, rimonabant; 168,273–06-1, Cayman Chemical, Michigan, USA), and CID1792197 from PubChem [46], in-house synthesized (> 99% purity), were used in this study. ACEA was obtained as a pale-yellow oil and prepared as a 10 mM stock solution by diluting in ethanol. Stock solutions of SR141617 and CID1792197 were similarly made at 10 mM in dimethyl sulfoxide (DMSO). All aliquots were stored at − 20 °C until needed.
RNA Purification
Cells were collected from culture dishes using scrapers and TRIzol (15,596,018, Invitrogen, Paisley, Scotland, UK). Total RNA was then isolated with the RNeasy Mini Kit (74,104, Qiagen, Valencia, CA, USA), including an on-column DNase digestion (79,204, Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol.
Quantitative Real-Time PCR
First-strand cDNA was synthesized from 1 μg of total RNA using random primers and the SuperScript III kit (11,752,050, Invitrogen, Paisley, Scotland, UK) in a final volume of 20 μL, following the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was performed by combining the cDNA with SYBR Green PCR Master Mix (a25778, Applied Biosystems, Carlsbad, CA, USA) and 0.3 μM of the corresponding forward and reverse primers (Table 1). Gene expression was quantified using a 7300 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). The cycling program included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. A dissociation curve from 60 to 95 °C was included at the end of the run to confirm the specificity of the amplified products. Relative gene expression levels were determined using a standard curve, and all data were normalized to the housekeeping genes 18S and GAPDH.
Table 1.
Primers used for qRT-PCR in this study
| Oligonucleotide | Sequence | |
|---|---|---|
| CNR1-Fw | –––– | CAGATACCACCTTCCGCACC |
| CNR1-Rev | –––– | GTCTCCCGCAGTCATCTTCT |
| GPR55-Fw | –––– | CAGTCCACATCCCCACCTTC |
| GPR55-Rev | –––– | TGGAGGTGGCAGCATAATCG |
| GAPDH-Fw | –––– | AAATCCCATCACCATCTTCC |
| GAPDH-Rev | –––– | GACTCCACGACGTACTCAGC |
| 18S-Fw | –––– | ATGCTCTTAGCTGAGTGTCCCG |
| 18S-Rev | –––– | ATTCCTAGCTGCGGTATCCAGG |
The annealing temperature was 60 °C for all primers. 18S and GAPDH RNAs were used as housekeeping genes
Fusion Proteins and Expression Vectors
Human CB1R and GPR55 cDNAs were cloned into pcDNA3.1 and amplified without their stop codons using sense and antisense primers containing unique EcoRI or BamHI restriction sites. The resulting fragments were subcloned in-frame with EYFP into the BamHI and EcoRI sites of an EYFP-expressing vector (EYFP-N1; enhanced yellow variant of GFP; Clontech, Heidelberg, Germany), producing plasmids encoding CB1R-YFP and GPR55-YFP, with the fluorescent tag fused to the C-terminal end of each receptor. Receptor expression was confirmed by confocal microscopy, and receptor functionality was assessed via ERK1/2 activation assays.
Cell Line Culture and Transfection
The HOG cell line, established from a human oligodendroglioma by Dr. A. T. Campagnoni (University of California, UCLA, Berkeley, CA, USA) [77] was generously provided by Dr. J. A. López-Guerrero (Universidad Autónoma de Madrid, Madrid, Spain) [78]. Cells were maintained in low-glucose DMEM supplemented with pyruvate, HEPES (22,320–022, Invitrogen, Paisley, Scotland, UK), 10% (v/v) heat-inactivated fetal bovine serum (FBS) (10,270–106, Invitrogen, Paisley, Scotland, UK), and penicillin/streptomycin at 100 units/mL (17-602E, Invitrogen, Paisley, Scotland, UK). Cultures were kept at 37 °C in a humidified incubator with 5% CO₂ and were subcultured twice weekly once they reached 80–90% confluency, with passages limited to 20 to preserve cell characteristics.
For transient expression, cells in 10 cm dishes were transfected with the appropriate fusion protein cDNAs (see figure legends) using Lipofectamine 3000 (3000–015, Invitrogen, Paisley, Scotland, UK) according to the manufacturer’s protocol. Parallel control cultures received Lipofectamine 3000 without DNA. Cell viability was assessed relative to untreated cells, and no significant cytotoxic effects were detected.
Cell Treatments
Cell treatments were performed 48 h after transfection. For MTT reduction assays, 3,000 cells were seeded in each well of 96-well plates, whereas 30,000 cells per well were plated on 8-well chambered cover glasses (Nunc® Lab-Tek® II, Sigma-Aldrich, St. Louis, MO, USA) for immunofluorescence and proximity ligation assays (PLA). Cytotoxicity was triggered by treating cells with CPZ at increasing concentrations (50–1000 μM; see figure legends). A 30 mM CPZ stock solution (C9012-25G, Sigma-Aldrich, St. Louis, MO, USA) was freshly prepared by dissolving CPZ powder in a 50% ethanol/medium mixture and incubating it at 60 °C with shaking (225 rpm) for 15–20 min until full dissolution. Final working concentrations were obtained by diluting the stock in complete medium to keep ethanol content at a minimum [75, 76].
For experiments involving CB1R and GPR55 ligands, cells cultured in serum-free DMEM for 2 h, were either left untreated or treated with the CB1R agonist ACEA (100 nM) and the GPR55 agonist CID1792197 (1 μM) for 30 min prior to the addition of freshly prepared CPZ (500 μM). In experiments using the CB1R antagonist, cells were pre-incubated with the SR141716 (rimonabant; 250 nM) for 20 min before agonist treatment. When multiple compounds were applied, they were added simultaneously to the medium. Concentrations and incubation times were chosen based on previous studies on receptor pharmacology and our own prior experience [46, 64].
Control groups received either the same volume of fresh medium or the corresponding vehicle.
MTT Reduction Assay
Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyltetrazolium bromide (MTT) reduction assay, which relies on mitochondrial NADH-dependent oxidoreductase activity as an indicator of mitochondrial function. After completion of the treatments, 10 µL of MTT solution (5 mg/mL in phosphate-buffered saline, PBS; 5655, Sigma-Aldrich, St. Louis, MO, USA) was added to each well. Following a 4-h incubation, 100 µL of lysis buffer (20% SDS, 50% dimethylformamide, pH 4) was added, and plates were incubated overnight at 37 °C. Absorbance was measured at 570 nm using a Multiskan EX Microplate Reader (ThermoFisher Scientific, Waltham, MA, USA). Background readings from wells containing only medium were subtracted, and cell viability was expressed as a percentage relative to untreated control/vehicle cells.
Immunofluorescence
HOG cells expressing CB1R and GPR55 were washed three times with PBS and fixed in 4% paraformaldehyde for 15 min. Following fixation, cells were rinsed three times and permeabilized with 0.05% Triton X-100 at room temperature for 15 min. To block nonspecific binding, cells were incubated with 1% bovine serum albumin for 30 min at room temperature. For CB1R detection, cells were incubated overnight at 4 °C in a humidified chamber with a rabbit anti-CB1R antibody (1:500; PA1-745, Thermo Scientific, Rockford, USA). After three PBS washes, cells were incubated for 30 min at room temperature with a biotinylated horse universal secondary antibody (1:40; Vector, PK-8800, Vector Laboratories Inc., Newark, NJ, USA), followed by streptavidin Alexa Fluor® 550 conjugate (1:500; S2138, Invitrogen, Paisley, Scotland, UK). GPR55 was visualized via its YFP fusion, allowing direct detection through its intrinsic fluorescence. Nuclei were counterstained with TOPRO®−3 (1:500; T3605, Invitrogen, Paisley, UK), and samples were mounted with Neomount Fluo (NB-23–00158-2, NeoBioTech, Nanterre, France). Negative controls were included to verify the absence of nonspecific labeling or signal amplification.
Imaging was carried out with a Leica TCS-SP8X spectral confocal microscope (Leica Microsystems, Mannheim, Germany) fitted with a 63X apochromatic oil-immersion objective (N.A. 1.4) and laser lines of 405 nm and 561 nm. For every field, stacks of images were collected across five Z planes at 1 μm steps in two separate channels (each corresponding to one fluorophore).
In SituProximity Ligation Assay
For PLA experiments, HOG cells that expressed CB1R, GPR55, or both receptors (HOG-CB1R, HOG-GPR55, HOG-CB1R/GPR55) were first fixed with 4% paraformaldehyde for 15 min, rinsed in PBS containing 20 mM glycine to neutralize aldehyde residues, and then permeabilized in the same buffer with 0.05% Triton X-100 for 5 min. The PLA probes were generated by coupling a rabbit anti-CB1R antibody (PA1-745, Thermo Scientific, Rockford, USA) to a PLUS oligonucleotide (Duolink® In Situ Probemaker PLUS DUO92009, Sigma-Aldrich, St. Louis, MO, USA) and a rabbit anti-GPR55 antibody (10,224, Cayman Chemicals, Michigan, USA), which recognizes the human 207–2019 sequence, to a MINUS oligonucleotide (Duolink® In Situ Probemaker MINUS DUO92010, Sigma-Aldrich, St. Louis, MO, USA), following the instructions provided by the manufacturer. After blocking with the solution from the PLA kit for 1 h at 37 °C, cells were incubated overnight at 4 °C with the antibody-linked probes at a final concentration of 75 µg/mL. Non-transfected HOG cells were used to confirm specificity.
Receptor clusters were visualized with the Duolink II in situ PLA detection kit (Duolink® In Situ Detection Reagents Red DUO92008, Sigma-Aldrich, St. Louis, MO, USA). The samples were incubated with the ligation solution for 1 h at 37 °C, rinsed, and afterwards exposed to the amplification solution in a humidified chamber for 100 min at 37 °C. Nuclei were labeled using TOPRO®−3 (1:500; T3605, Invitrogen, Paisley, UK), and coverslips were mounted with Neomount Fluo (NB-23–00158-2, NeoBioTech, Nanterre, France). To rule out nonspecific staining and amplification of signal, negative controls were performed. Negative controls included HOG cells transfected with CB1R alone or GPR55 alone, as well as empty-vector (lipofectamine-only) treated cells lacking receptor expression. These conditions were processed in parallel and showed no detectable PLA signal, confirming assay specificity.
Images were acquired on a Leica TCS-SP8X spectral confocal microscope (Leica Microsystems, Mannheim, Germany) equipped with a 63X apochromatic oil-immersion objective (N.A. 1.4) and 405 nm and 561 nm laser lines. For each microscopic field, stacks of images were collected over five Z planes with 1 μm intervals in two separate channels (one for each fluorophore).
Data Analysis
After obtaining the raw data, outliers were identified using GraphPad Prism’s ROUT method and excluded before analysis. The outlier detection procedure was applied uniformly across all conditions. The resulting outlier-free datasets were then evaluated for normality and homogeneity of variances prior to statistical analysis. Statistical comparisons were performed using one-way or two-way analysis of variance (ANOVA), as appropriate for the experimental design, followed by Bonferroni’s post hoc test for multiple group comparisons. In directly comparative experiments, planned comparisons versus the corresponding control condition were applied. Differences were considered statistically significant at p < 0.05. All statistical analyses were performed using GraphPad Prism version 8 (San Diego, CA, USA).
Results
Heterologous Expression of CB1R and GPR55 HOG Cells
Prior to these experiments, we confirmed by qPCR assays that HOG cells do not express endogenous CB1R or GPR55 (Supplementary Fig. S1). The absence of amplification signal for both receptors rules out any potential interference from endogenous expression, thereby providing a suitable system to evaluate receptor function and potential heteromer formation upon transfection. Accordingly, HOG cells were transiently transfected with the plasmids encoding for CB1R-Rluc and GPR55-YFP fusion proteins (see details in Materials and Methods). Immunofluorescence was performed to verify successful co-expression; CB1R was detected using an anti-CB1R antibody (red fluorescence, Fig. 1A), while GPR55 was visualized directly through the intrinsic fluorescence of its YFP tag (green fluorescence, Fig. 1B). Both receptors were primarily expressed at the plasma membrane, as shown by fluorescence, and were colocalized in several regions within the cell (yellow signal, Fig. 1C), suggesting close spatial proximity and potential heteromer formation. Notably, receptor expression was observed throughout the entire cell, including the cytoplasm and cellular extensions, indicating widespread distribution.
Fig. 1.
Confocal laser fluorescence microscopy images showing the expression of CB1R-Rluc (A) and GPR55-YFP (B) in co-transfected HOG cells. CB1R was detected by immunofluorescence using an anti-CB1R antibody (red fluorescence), while GPR55 fused to YFP was visualized based on its intrinsic fluorescent properties (green fluorescence). Colocalization of both receptors is shown in yellow (C). Cell nuclei were stained with TOPRO®−3 (blue). Scale bar: 10 µm. Detail 100x
Based on colocalization data suggesting a direct interaction, we used PLA to probe for CB1R/GPR55 heteromerization. A distinct punctate red fluorescence, indicative of receptor–receptor interactions, was observed exclusively in cells co-transfected with both receptors (Fig. 2D). In contrast, non-transfected cells and cells expressing either CB1R or GPR55 alone showed no detectable PLA signal, displaying only the TOPRO®−3 nuclear counterstain (Fig. 2A, B, C).
Fig. 2.
Confocal laser fluorescence microscopy images showing the presence or absence of CB1R/GPR55 heteromers (red fluorescent puncta) detected by in situ proximity ligation assay in HOG cells (A), HOG cells transfected with GPR55 (B), HOG cells transfected with CB1R (C) and HOG cells co-transfected with both receptors (D). Nuclei were stained with TOPRO®−3 (blue). Scale bar: 10 µm. Detail 100x
Neuroprotective Effect of CB1R and GPR55 Expression Against Cuprizone-Induced Cytotoxicity in HOG cells
We next examined the potential neuroprotective role of CB1R and GPR55 in a cellular model of CPZ-induced cytotoxicity. HOG cells were transiently transfected with CB1R, GPR55, or both receptors (CB1R/GPR55) and subsequently exposed to increasing concentrations of CPZ (50–1000 µM) for 24 h. Viability was assessed by the MTT reduction assay that measures mitochondrial activity. It is important to note that independent experiments were conducted separately for each transfection condition and were not performed as direct side-by-side comparisons.
In non-transfected cells, CPZ produced a significant reduction in viability, with losses of approximately 20% at concentrations above 200 µM (Fig. 3A). CPZ-induced toxicity in these cells did not follow a linear concentration–response relationship across the concentration range tested. A marked decrease in MTT reduction was observed already at 200 µM CPZ, with no significant additional decrease at 500–1000 µM. By contrast, cells expressing CB1R, GPR55, or both receptors exhibited marked resistance to CPZ-induced toxicity (Fig. 3B–D). We next compared these conditions side-by-side within the same experimental runs (Fig. 4) to enable an unbiased assessment of relative efficacy. In this matched analysis, expression of CB1R or GPR55 alone conferred resistance to CPZ-induced toxicity, and co-expression did not further increase the magnitude of this effect. Notably, this cytoprotective response was observed in the absence of exogenous agonists, consistent with the possibility that basal receptor activity contributes to cell survival in HOG cells. However, under serum-starved conditions CPZ toxicity was restored, suggesting that one or more serum-derived factor(s) may provide endogenous activation or otherwise support receptor-dependent signaling at CB1R and/or GPR55.
Fig. 3.
Cuprizone effect on cell viability in HOG-CB1R (B), HOG-GPR55 (C), and double-transfected HOG-CB1R/GPR55 (D) cells treated with increasing concentrations of the toxic (50–1000 µM) for 24 h. Cell viability was assessed by the MTT reduction assay. Non-transfected HOG cells under the same conditions are shown as controls (A). Every condition was assayed in at least 5 different experimental sessions using 3 wells per condition per group. Each condition was normalized to its corresponding control/vehicle (100%) thus generating at least 15 raw data per condition. Data represent the mean ± SEM of normalized percentages after excluding outliers (see Methods). Vehicle treatment did not significantly affect viability; therefore, cuprizone-treated conditions were compared directly with the corresponding control group. Statistical significance was determined by one-way ANOVA followed by Bonferroni’s post hoc test with planned comparisons versus control (*p < 0.05, **p < 0.01, ***p < 0.001 versus control)
Fig. 4.
Comparative effect of cuprizone on cell viability in non-transfected HOG (blue bars), HOG-CB1R (green bars), HOG-GPR55 (red bars), and double-transfected HOG-CB1R/GPR55 (yellow bars) cells treated with increasing concentrations of the toxic (50–1000 µM) for 24 h. Cell viability was assessed by the MTT reduction assay. Every condition was assayed in at least 5 different experimental sessions using 3 wells per condition per group. Each condition was normalized to its corresponding control/vehicle (100%) thus generating at least 15 raw data per condition. Data represent the mean ± SEM of normalized percentages after excluding outliers (see Methods). Vehicle treatment did not significantly affect viability; therefore, cuprizone-treated conditions were compared directly with the corresponding control group. Statistical significance was determined by two-way ANOVA with Bonferroni's post-hoc test (#p < 0.05; # #p < 0.01; # # #p < 0.001 versus non-transfected control cells)
To further explore the role of receptor activation, we next evaluated the neuroprotective potential of pharmacological stimulation of CB1R and GPR55. HOG cells, either non-transfected or expressing CB1R, GPR55, or both receptors, were pretreated with the selective CB1R agonist arachidonyl-2'-chloroethylamide (ACEA, 100 nM) or the GPR55 agonist CID1792197 (1 µM), administered individually or in combination with the CB1R antagonist SR141716 (250 nM). These assays were performed under serum-starved conditions. It is important to note that no selective antagonist for GPR55 is commercially available.
In cells expressing either CB1R or GPR55 alone, agonist treatment did not elicit a consistent or receptor-specific enhancement of viability (Fig. 5A–B). Although modest statistically significant changes were observed under some conditions, these effects were small, variable, and did not reveal a robust agonist-driven survival profile in single-receptor expressing cells. In contrast, in cells co-expressing CB1R and GPR55, ACEA treatment induced a modest but significant decrease in mitochondrial activity, which was fully reversed by the CB1R antagonist SR141716, thereby implicating CB1R in this response (Fig. 5C). Notably, pharmacological modulation by the GPR55 agonist CID1792197 was altered in the presence of CB1R antagonism across receptor-expressing conditions, revealing a complex pattern of cross-regulation rather than a uniform blockade. This behavior is consistent with the atypical pharmacological properties described for CB1R/GPR55 receptor complexes and reflects current limitations in selectively dissecting GPR55 signaling in the absence of a highly specific antagonist [79–82].
Fig. 5.
MTT reduction assay in HOG-CB1R (A), HOG-GPR55 (B), and HOG-CB1R/GPR55 (C) cells treated with the CB1R agonist, ACEA (100 nM), or the GPR55 agonist CID1792197 (1 μM), in the presence or absence of the CB1R antagonist SR141716 (250 nM). Every condition was assayed in at least 3 different experimental sessions using 2 wells per condition per group. Each condition was normalized to its corresponding control (100%) thus generating at least 6 raw data per condition. Data represent the mean ± SEM of normalized percentages after excluding outliers (see Methods). Statistical analysis was performed by a one-way ANOVA followed by Bonferroni’s post hoc test with planned comparisons versus the respective control group (*p < 0.05, **p < 0.01, ***p < 0.001 versus control; &&p < 0.01, &&&p < 0.001 versus the respective agonist treatment)
We next evaluated whether pharmacological activation of CB1R or GPR55 could counteract CPZ-induced cytotoxicity. As shown in Fig. 6, treatment with the CB1R agonist ACEA or the GPR55 agonist, CID1792197, significantly attenuated CPZ-induced loss of viability in HOG cells co-expressing both receptors (Fig. 6D). In cells transfected with CB1R alone, ACEA fully restored cell viability to control levels, an effect that was abolished by co-treatment with the selective CB1R antagonist, SR141716 (Fig. 6B). This protective effect was not observed in non-transfected cells (Fig. 6A). By contrast, in cells expressing GPR55 alone, cannabinoid ligands did not enhance survival beyond the modest effects associated with receptor expression itself (Fig. 6C).
Fig. 6.
MTT assay in HOG (A), HOG-CB1R (B), HOG-GPR55 (C), and HOG-CB1R/GPR55 (D) cells pretreated with the CB1R agonist ACEA (100 nM) or the GPR55 agonist CID1792197 (1 µM), in the presence or absence of the CB1R antagonist SR141716 (250 nM), 30 min prior to exposure to cuprizone (500 µM, 24 h). Every condition was assayed in at least 3 different experimental sessions using 2 wells per condition per group. Each condition was normalized to its corresponding control/vehicle (100%) thus generating at least 6 raw data per condition. Data represent the mean ± SEM of normalized percentages after excluding outliers (see Methods). Statistical analysis was performed by a one-way ANOVA followed by Bonferroni’s post hoc test with planned comparisons versus the respective control group (*p < 0.05, **p < 0.01, ***p < 0.001 versus control; #p < 0.05, # # #p < 0.001 versus cuprizone; &&&p < 0.001 versus the respective agonist treatment)
Together, these results highlight the atypical pharmacological profile associated with CB1R/GPR55 receptor co-expression and support the presence of functional receptor interactions that modulate pharmacological responses to CPZ-induced toxicity.
Discussion
This study provides novel evidence that GPR55 and the cannabinoid CB1 receptor exert significant neuroprotective effects against CPZ-induced cytotoxicity in human oligodendroglial cells, with comparable levels of protection observed upon individual or combined receptor expression, alongside evidence for a distinct pharmacological interaction when both receptors are co-expressed. These findings significantly extend our previous work on CB1R/GPR55 heteromerization [34, 43, 64, 65] and underscore the therapeutic potential of targeting this receptor complex in demyelinating pathologies like MS.
Before addressing the receptor-dependent mechanisms underlying the observed neuroprotection, some methodological aspects of the CPZ-based in vitro model should be considered. The lack of a clear concentration-dependent decrease in viability in CPZ-treated HOG cells deserves specific consideration. In this study, cell viability was assessed using the MTT reduction assay, which primarily reflects mitochondrial metabolic activity rather than absolute cell number or membrane integrity. CPZ is known to induce early mitochondrial dysfunction in oligodendroglial cells, leading to a rapid decrease in metabolic activity that may plateau over a wide concentration range without necessarily reflecting incremental cell death. Similar non-linear concentration–response profiles have been previously reported in CPZ-based in vitro models and are thought to reflect a threshold effect on mitochondrial function rather than progressive cytotoxicity [75]. Therefore, the steady state viability observed at higher CPZ concentrations likely reflects saturation of mitochondrial impairment rather than resistance to CPZ toxicity.
Within this context, expression of CB1R, GPR55, or both receptors conferred substantial resistance to CPZ-induced toxicity. Although we did not detect a statistically greater effect of co-expression under these conditions, the data robustly support protection with receptor expression, and future work will address whether specific stimulus contexts reveal synergistic effects. In this sense, one plausible explanation for the absence of an additive effect of co-expression in the baseline CPZ assay is that, under serum-containing conditions, receptor-dependent protective signaling may already be partially engaged by endogenous factor(s) present in fetal bovine serum (FBS). Indeed, protection was observed in the absence of exogenous agonists but was lost under serum-starved conditions, arguing against a purely constitutive mechanism and instead supporting the presence of a serum-dependent permissive “tone” (e.g., bioactive lipids/endocannabinoid-related mediators) capable of sustaining CB1R and/or GPR55 signaling. This interpretation is particularly relevant for GPR55, whose pharmacology has been widely described as atypical, context-dependent (including functional selectivity), and still incompletely defined, with ongoing debate regarding ligand classification and receptor “identity” [83–85]. Under such conditions, basal activation and/or pathway saturation could compress the dynamic range of a viability readout and obscure incremental gains expected from co-expression, even if receptor–receptor interactions meaningfully alter signaling quality without substantially changing the overall magnitude of the response. Importantly, because all groups were assayed under identical media composition and normalized within each experiment, this interpretation not compromise the validity of the matched comparisons but instead provides context for the absence of additivity.
Rather than increasing the magnitude of the response, co-expression revealed evidence of receptor–receptor interaction consistent with heteromer formation and atypical pharmacological modulation. This aligns with our prior reports of unique pharmacological properties in these heteromers, including cross-antagonism and biased signaling [64, 65]. The present pharmacological data further cement this interpretation: the response to a GPR55-specific agonist was significantly attenuated by a CB1R antagonist. This cross-receptor modulation is a recognized hallmark of GPCR heteromerization [79–82, 86] and highlights an atypical signaling profile that could be exploited for next-generation therapeutics in neurodegenerative and demyelinating diseases.
Interpretation of these pharmacological interactions must take into account current limitations in the available pharmacological tools for GPR55. The absence of a truly selective and well-characterized GPR55 antagonist is a recognized constraint in the field and complicates the dissection of GPR55-specific signaling using classical pharmacological approaches. In the present study, we therefore employed a strategy consistent with current best practice, using selective agonists in combination with CB1R antagonism to assess functional modulation and cross-regulatory behavior. While genetic approaches such as GPR55 knockdown or knockout would provide complementary mechanistic insight, these strategies represent a distinct experimental expansion and are more appropriately addressed in future studies. Importantly, the pharmacological effects observed here are sufficient to support functional interaction and atypical signaling behavior consistent with receptor-complex formation rather than isolated receptor activity.
The translational implications for MS are considerable. Current standard-of-care therapies primarily target the immune component of the disease but offer limited efficacy in promoting remyelination or protecting neural cells from damage [9, 18, 87, 88]. Our results propose a paradigm shift by targeting oligodendroglial resilience directly. Therefore, developing ligands that selectively target the CB1R/GPR55 heteromer to modulate its specific signaling output may represent a more precise and effective strategy to enhance OLG survival in the hostile inflammatory milieu of MS lesions.
Despite these promising insights, several considerations must be acknowledged. Firstly, the use of the human HOG oligodendroglial cell line represents a deliberate reductionist approach. Although HOG cells are derived from an oligodendroglioma and do not fully recapitulate the complexity of primary OLGs, their lack of endogenous CB1R and GPR55 expression provides a unique experimental advantage. This feature allows receptor-specific effects to be examined in isolation, without interference from endogenous cannabinoid signaling, thereby enabling a clear functional assessment of CB1R, GPR55, and their co-expression. While this simplified system cannot model the full cellular and molecular environment of the CNS, it is well suited to dissect receptor-dependent mechanisms under controlled conditions. CB1R expression has been documented in cells of the OLG lineage [56–59], where it contributes to survival and differentiation, and GPR55 expression has been reported in glial populations, with upregulation under inflammatory conditions [60]. However, whether OLGs co-express both receptors in vivo remains unresolved. To date, the only available evidence for CB1R/GPR55 complexes in the human brain comes from our recent study of post-mortem MS tissue, in which these heteromers were detected in the prefrontal cortex [66]. Accordingly, our reductionist model serves as a unique tool to uncover mechanistic principles that may underlie OLG resilience in demyelinating conditions, while highlighting the need for further studies in primary cultures, animal models, and patient-derived samples. The apparent protective effect observed in cells expressing CB1R and GPR55, even in the absence of exogenous agonists, is unlikely to reflect constitutive receptor activity, as our data under serum-free conditions do not support this interpretation. Accordingly, future studies employing targeted lipidomics in serum/plasma (and in commonly used culture sera) will be valuable to determine whether endocannabinoids or structurally related bioactive lipids are present at concentrations compatible with CB1R and/or GPR55 engagement, potentially contributing to a permissive basal signaling tone. However, such mechanistic dissection is beyond the scope of the present study. Serum is known to contain bioactive lipids, including endocannabinoids and structurally related molecules, which may contribute to basal receptor tone and partially activate CB1R and/or GPR55 in the absence of exogenous agonists. Importantly, all experimental conditions were assessed under identical media composition and normalized within each experiment, ensuring that relative comparisons between conditions remain valid and are not confounded by serum-derived effects. This leads to a novel hypothesis: that the loss of these receptors in vivo could itself be detrimental to OLG resilience [89–91]. However, it is important to note that this immortalized cell line cannot fully capture the complexity of primary OLGs or the intricate cellular crosstalk with astrocytes, microglia, and neurons that defines the in vivo CNS environment. Secondly, the acute CPZ-induced cytotoxicity model, while useful, replicates aspects of demyelination but not the chronic immune-mediated pathogenesis characteristic of MS [74, 92]. Thirdly, the field is constrained by a limited pharmacological toolkit for GPR55, particularly the absence of a highly selective and potent antagonist, which hinders the precise dissection of individual receptor contributions within the complex [46]. Finally, while we demonstrate protection against acute toxicity, future work must determine if this translates to enhanced remyelination and long-term functional recovery in more complex systems.
By demonstrating receptor-dependent protection and receptor–receptor interaction in a human oligodendroglial model, this work provides a rationale for further exploration of heteromer-specific cannabinoid signaling in demyelinating conditions. Future research must now validate these results in vivo, using advanced animal models and ultimately human clinical samples, to translate this promising mechanism into a viable strategy for halting progression and promoting repair in MS. In this regard, preclinical studies such as that of Reynoso-Moreno et al., who demonstrated that the selective endocannabinoid reuptake inhibitor WOBE437 reduces disease progression in a mouse model of MS, further underscore the therapeutic promise of cannabinoid system modulation in demyelinating disorders [93]. Future studies using primary OLG cultures, organotypic systems, or in vivo demyelination models (e.g. Experimental Autoimmune Encephalomyelitis models) will be required to validate the translational relevance of these findings.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
This research was funded by Fondo de Investigaciones Sanitarias (FIS), which belongs to the Spanish National Instituto de Salud Carlos III though the project (PI15/00601) (Co-funded by European Regional Development Fund and European Social Fund “Investing in your future”).
Author Contributions
Conceptualization was agreed by EMP and RF, who also participated in the design of the project and analyzed the results; EMP, JMCM performed the majority of the experiments; CMP, SVC, RRS, RP participated in a significant number of experiments; EMP, AN, RP and RF participated in the software, data analysis and preparing the final figures; EMP and RF wrote the first draft of the manuscript which was further edited by all co-authors, who agreed with the final submission. All authors have read and agreed to the published version of the manuscript.
Funding
Open Access funding provided thanks to the CRUE-CSIC agreement with Springer Nature. This research was funded by Fondo de Investigaciones Sanitarias (FIS), which belongs to the Spanish National Instituto de Salud Carlos III though the project (PI15/00601) (Co-funded by European Regional Development Fund and European Social Fund “Investing in your future”).
Data Availability
The datasets generated and/or analyzed during the current study are not publicly available due to privacy/ethical restrictions but are available from the corresponding author upon reasonable request.
Declarations
Ethics Approval
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Eva Martínez-Pinilla and José Manuel Calatayud-Morán contributed equally to this work.
Contributor Information
Eva Martínez-Pinilla, Email: martinezeva@uniovi.es.
Rafael Franco, Email: rfranco123@gmail.com.
References
- 1.Reich DS, Lucchinetti CF, Calabresi PA (2018) Multiple sclerosis. N Engl J Med 378:169–180. 10.1056/NEJMra1401483 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Calabrese M, Magliozzi R, Ciccarelli O et al (2015) Exploring the origins of grey matter damage in multiple sclerosis. Nat Rev Neurosci 16:147–158 [DOI] [PubMed] [Google Scholar]
- 3.Cao Y, Diao W, Tian F et al (2021) Gray matter atrophy in the cortico-striatal-thalamic network and sensorimotor network in relapsing–remitting and primary progressive multiple sclerosis. Neuropsychol Rev 31:703–720 [DOI] [PubMed] [Google Scholar]
- 4.Oh J, Vidal-Jordana A, Montalban X (2018) Multiple sclerosis: clinical aspects. Curr Opin Neurol 31:752–759 [DOI] [PubMed] [Google Scholar]
- 5.Andica C, Hagiwara A, Kamagata K et al (2019) Gray matter alterations in early and late relapsing-remitting multiple sclerosis evaluated with synthetic quantitative magnetic resonance imaging. Sci Rep 9:1–10. 10.1038/s41598-019-44615-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Walton C, King R, Rechtman L et al (2020) Rising prevalence of multiple sclerosis worldwide: insights from the Atlas of MS, third edition. Mult Scler J 26:1816–1821. 10.1177/1352458520970841 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Yamout B (2025) Update in multiple sclerosis. eNeurolSci 38:100553. 10.1016/j.ensci.2025.100553 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bjornevik K, Cortese M, Healy BC et al (2022) Longitudinal analysis reveals high prevalence of Epstein-Barr virus associated with multiple sclerosis. Science 375:296–301. 10.1126/science.abj8222 [DOI] [PubMed] [Google Scholar]
- 9.Baskaran AB, Grebenciucova E, Shoemaker T, Graham EL (2023) Current updates on the diagnosis and management of multiple sclerosis for the general neurologist. J Clin Neurol 19:217. 10.3988/JCN.2022.0208 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Correale J, Hohlfeld R, Baranzini SE (2022) The role of the gut microbiota in multiple sclerosis. Nat Rev Neurol 18:544–558 [DOI] [PubMed] [Google Scholar]
- 11.Cavallo S (2020) Immune-mediated genesis of multiple sclerosis. J Transl Autoimmun. 10.1016/j.jtauto.2020.100039 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Titus HE, Chen Y, Podojil JR et al (2020) Pre-clinical and clinical implications of “inside-out” vs. “outside-in” paradigms in multiple sclerosis etiopathogenesis. Front Cell Neurosci. 10.3389/fncel.2020.599717 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lublin FD, Reingold SC, Cohen JA et al (2014) Defining the clinical course of multiple sclerosis: the 2013 revisions. Neurology 83:278–286. 10.1212/WNL.0000000000000560 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Arredondo-Robles AV, Rodríguez-López KP, Ávila-Avilés RD (2025) Clinical management in multiple sclerosis. Neuroglia 6:6 [Google Scholar]
- 15.Thompson AJ, Banwell BL, Barkhof F et al (2018) Diagnosis of multiple sclerosis: 2017 revisions of the McDonald criteria. Lancet Neurol 17:162–173 [DOI] [PubMed] [Google Scholar]
- 16.Goodin DS (2014) Glucocorticoid treatment of multiple sclerosis. In: Handbook of Clinical Neurology. pp 455–464 [DOI] [PubMed]
- 17.Krajnc N, Bsteh G, Berger T et al (2022) Monoclonal antibodies in the treatment of relapsing multiple sclerosis: an overview with emphasis on pregnancy, vaccination, and risk management. Neurotherapeutics 19:753–773 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Mohseni SO, Au KM, Issa W et al (2025) Multiple sclerosis treatments a review of current biomedical engineering approaches. Biomaterials 313:122807 [DOI] [PubMed] [Google Scholar]
- 19.Deshmukh VA, Tardif V, Lyssiotis CA et al (2013) A regenerative approach to the treatment of multiple sclerosis. Nature 502:327–332. 10.1038/nature12647 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fernández-Ruiz J, Gómez-Ruiz M, García C, et al (2017) Modeling neurodegenerative disorders for developing cannabinoid-based neuroprotective therapies. In: Methods in enzymology. pp 175–198 [DOI] [PubMed]
- 21.Campagnoli LIM, Marchesi N, Varesi A et al (2024) New therapeutic avenues in multiple sclerosis: is there a place for gut microbiota-based treatments? Pharmacol Res 209:107456 [DOI] [PubMed] [Google Scholar]
- 22.Conte A, Silván CV (2022) Review of available data for the efficacy and effectiveness of Nabiximols oromucosal spray (Sativex®) in multiple sclerosis patients with moderate to severe spasticity. Neurodegener Dis 21:55–62 [DOI] [PubMed] [Google Scholar]
- 23.Pau M, Porta M, Spinicci G et al (2023) Change in upper limb function in people with multiple sclerosis treated with nabiximols: a quantitative kinematic pilot study. Neurol Sci 44:685–691. 10.1007/s10072-022-06456-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Nicholas J, Lublin F, Klineova S et al (2023) Efficacy of nabiximols oromucosal spray on spasticity in people with multiple sclerosis: treatment effects on Spasticity Numeric Rating Scale, muscle spasm count, and spastic muscle tone in two randomized clinical trials. Mult Scler Relat Disord. 10.1016/j.msard.2023.104745 [DOI] [PubMed] [Google Scholar]
- 25.Cristino L, Bisogno T, Di Marzo V (2020) Cannabinoids and the expanded endocannabinoid system in neurological disorders. Nat Rev Neurol 16:9–29 [DOI] [PubMed] [Google Scholar]
- 26.Aymerich MS, Aso E, Abellanas MA et al (2018) Cannabinoid pharmacology/therapeutics in chronic degenerative disorders affecting the central nervous system. Biochem Pharmacol 157:67–84 [DOI] [PubMed] [Google Scholar]
- 27.Martinez Ramirez CE, Ruiz-Pérez G, Stollenwerk TM et al (2023) Endocannabinoid signaling in the central nervous system. Glia 71:5–35. 10.1002/glia.24280 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zou S, Kumar U (2018) Cannabinoid receptors and the endocannabinoid system: signaling and function in the central nervous system. Int J Mol Sci. 10.3390/ijms19030833 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Mecha M, Carrillo-Salinas FJ, Feliú A et al (2020) Perspectives on cannabis-based therapy of multiple sclerosis: a mini-review. Front Cell Neurosci. 10.3389/fncel.2020.00034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Nouh RA, Kamal A, Abdelnaser A (2023) Cannabinoids and multiple sclerosis: a critical analysis of therapeutic potentials and safety concerns. Pharmaceutics. 10.3390/pharmaceutics15041151 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Shu-Jung Hu S, Mackie K (2015) Distribution of the endocannabinoid system in the central nervous system. In: Handbook of Experimental Pharmacology. pp 59–93 [DOI] [PubMed]
- 32.Glass M, Dragunow M, Faull RL, Dragunow M (1997) Cannabinoid receptors in the human brain: a detailed anatomical and quantitative autoradiographic study in the fetal, neonatal and adult human brain. Neuroscience 77:299–318. 10.1016/S0306-4522(96)00428-9 [DOI] [PubMed] [Google Scholar]
- 33.Chou S, Ranganath T, Fish KN et al (2022) Cell type specific cannabinoid CB1 receptor distribution across the human and non-human primate cortex. Sci Rep. 10.1038/s41598-022-13724-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Martínez-Pinilla E, Rico AJ, Rivas-Santisteban R et al (2020) Expression of cannabinoid CB1R–GPR55 heteromers in neuronal subtypes of the Macaca fascicularis striatum. Ann N Y Acad Sci 1475:34–42. 10.1111/nyas.14413 [DOI] [PubMed] [Google Scholar]
- 35.Lovinger DM (2008) Presynaptic modulation by endocannabinoids. Handb Exp Pharmacol 184:435–477. 10.1007/978-3-540-74805-2_14 [DOI] [PubMed] [Google Scholar]
- 36.Alexander SP, Christopoulos A, Davenport AP et al (2021) The concise guide to pharmacology 2021/22: G protein-coupled receptors. Br J Pharmacol 178:S27–S156. 10.1111/BPH.15538 [DOI] [PubMed] [Google Scholar]
- 37.Pertwee R (2010) Receptors and channels targeted by synthetic cannabinoid receptor agonists and antagonists. Curr Med Chem 17:1360–1381. 10.2174/092986710790980050 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Krishna Kumar K, Shalev-Benami M, Robertson MJ et al (2019) Structure of a signaling cannabinoid receptor 1-G protein complex. Cell 176:448-458.e12. 10.1016/j.cell.2018.11.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Glass M, Dragunow M, Faull RLM (1997) Cannabinoid receptors in the human brain: a detailed anatomical and quantitative autoradiographic study in the fetal, neonatal and adult human brain. Neuroscience 77:299–318. 10.1016/S0306-4522(96)00428-9 [DOI] [PubMed] [Google Scholar]
- 40.Liu QR, Pan CH, Hishimoto A et al (2009) Species differences in cannabinoid receptor 2 (CNR2 gene): identification of novel human and rodent CB2 isoforms, differential tissue expression and regulation by cannabinoid receptor ligands. Genes Brain Behav 8:519–530. 10.1111/j.1601-183X.2009.00498.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lanciego JL, Barroso-Chinea P, Rico AJ et al (2011) Expression of the mRNA coding the cannabinoid receptor 2 in the pallidal complex of Macaca fascicularis. J Psychopharmacol 25:97–104. 10.1177/0269881110367732 [DOI] [PubMed] [Google Scholar]
- 42.Cabral GA, Ferreira GA, Jamerson MJ (2015) Endocannabinoids and the immune system in health and disease. In: Endocannabinoids. pp 185–211 [DOI] [PubMed]
- 43.Martínez-Pinilla E, Rico AJ, Rivas-Santisteban R et al (2020) Expression of GPR55 and either cannabinoid CB1 or CB2 heteroreceptor complexes in the caudate, putamen, and accumbens nuclei of control, parkinsonian, and dyskinetic non-human primates. Brain Struct Funct 225:2153–2164. 10.1007/s00429-020-02116-4 [DOI] [PubMed] [Google Scholar]
- 44.Lynch DL, Hurst DP, Reggio PH (2020) The nucleotide-free state of the cannabinoid CB2/Gi complex. Cell 180:603–604 [DOI] [PubMed] [Google Scholar]
- 45.Fernández-Ruiz J, Moro MA, Martínez-Orgado J (2015) Cannabinoids in neurodegenerative disorders and stroke/brain trauma: from preclinical models to clinical applications. Neurotherapeutics 12:793–806 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Kotsikorou E, Madrigal KE, Hurst DP et al (2011) Identification of the GPR55 agonist binding site using a novel set of high-potency GPR55 selective ligands. Biochemistry 50:5633–5647. 10.1021/bi200010k [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Henstridge CM, Balenga NA, Schröder R et al (2010) GPR55 ligands promote receptor coupling to multiple signalling pathways. Br J Pharmacol 160:604–614. 10.1111/j.1476-5381.2009.00625.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Brown AJ, Daniels DA, Kassim M et al (2011) Pharmacology of GPR55 in yeast and identification of GSK494581A as a mixed-activity glycine transporter subtype 1 inhibitor and GPR55 agonist. J Pharmacol Exp Ther 337:236–246. 10.1124/jpet.110.172650 [DOI] [PubMed] [Google Scholar]
- 49.Henstridge CM, Balenga NAB, Ford LA et al (2009) The GPR55 ligand L‐α‐lysophosphatidylinositol promotes RhoA‐dependent Ca 2+ signaling and NFAT activation. FASEB J 23:183–193. 10.1096/fj.08-108670 [DOI] [PubMed] [Google Scholar]
- 50.Andradas C, Caffarel MM, Pérez-Gómez E et al (2011) The orphan G protein-coupled receptor GPR55 promotes cancer cell proliferation via ERK. Oncogene 30:245–252. 10.1038/onc.2010.402 [DOI] [PubMed] [Google Scholar]
- 51.Drzazga A, Sowinska A, Krzeminska A et al (2017) Lysophosphatidylcholine elicits intracellular calcium signaling in a GPR55-dependent manner. Biochem Biophys Res Commun 489:242–247. 10.1016/j.bbrc.2017.05.145 [DOI] [PubMed] [Google Scholar]
- 52.Pietr M, Kozela E, Levy R et al (2009) Differential changes in GPR55 during microglial cell activation. FEBS Lett 583:2071–2076. 10.1016/j.febslet.2009.05.028 [DOI] [PubMed] [Google Scholar]
- 53.Sylantyev S, Jensen TP, Ross RA, Rusakov DA (2013) Cannabinoid- and lysophosphatidylinositol-sensitive receptor GPR55 boosts neurotransmitter release at central synapses. Proc Natl Acad Sci U S A 110:5193–5198. 10.1073/pnas.1211204110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Chiurchiù V, van der Stelt M, Centonze D, Maccarrone M (2018) The endocannabinoid system and its therapeutic exploitation in multiple sclerosis: clues for other neuroinflammatory diseases. Prog Neurobiol 160:82–100 [DOI] [PubMed] [Google Scholar]
- 55.Maramai S, Brindisi M (2020) Targeting endocannabinoid metabolism: an arrow with multiple tips against multiple sclerosis. ChemMedChem 15:1985–2003. 10.1002/cmdc.202000310 [DOI] [PubMed] [Google Scholar]
- 56.Molina-Holgado E, Vela JM, Arévalo-Martín A et al (2002) Cannabinoids promote oligodendrocyte progenitor survival: involvement of cannabinoid receptors and phosphatidylinositol-3 kinase/Akt signaling. J Neurosci 22:9742–53 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Basavarajappa BS, Shivakumar M, Joshi V, Subbanna S (2017) Endocannabinoid system in neurodegenerative disorders. J Neurochem 142:624–648. 10.1111/jnc.14098 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Galve-Roperh I, Aguado T, Palazuelos J, Guzman M (2008) Mechanisms of control of neuron survival by the endocannabinoid system. Curr Pharm Des 14:2279–2288. 10.2174/138161208785740117 [DOI] [PubMed] [Google Scholar]
- 59.Ilyasov AA, Milligan CE, Pharr EP, Howlett AC (2018) The endocannabinoid system and oligodendrocytes in health and disease. Front Neurosci 12 [DOI] [PMC free article] [PubMed]
- 60.Celorrio M, Rojo-Bustamante E, Fernández-Suárez D et al (2017) GPR55: a therapeutic target for Parkinson’s disease? Neuropharmacology 125:319–332. 10.1016/j.neuropharm.2017.08.017 [DOI] [PubMed] [Google Scholar]
- 61.Ferré S, Baler R, Bouvier M et al (2009) Building a new conceptual framework for receptor heteromers. Nat Chem Biol 5:131–134 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Franco R, Martínez-Pinilla E, Lanciego JL, Navarro G (2016) Basic pharmacological and structural evidence for class A G-protein-coupled receptor heteromerization. Front Pharmacol 7:. 10.3389/fphar.2016.00076 [DOI] [PMC free article] [PubMed]
- 63.Franco R, Aguinaga D, Jiménez J et al (2018) Biased receptor functionality versus biased agonism in G-protein-coupled receptors. Biomol Concepts 9:143–154 [DOI] [PubMed] [Google Scholar]
- 64.Martínez-Pinilla E, Aguinaga D, Navarro G et al (2019) Targeting CB 1 and GPR55 endocannabinoid receptors as a potential neuroprotective approach for Parkinson’s disease. Mol Neurobiol 56:5900–5910. 10.1007/S12035-019-1495-4 [DOI] [PubMed] [Google Scholar]
- 65.Martínez-Pinilla E, Reyes-Resina I, Oñatibia-Astibia A et al (2014) CB<inf>1</inf>and GPR55 receptors are co-expressed and form heteromers in rat and monkey striatum. Exp Neurol. 10.1016/j.expneurol.2014.06.017 [DOI] [PubMed] [Google Scholar]
- 66.Menéndez-Pérez C, Rivas-Santisteban R, Del Valle E et al (2024) Heteromers formed by GPR55 and either cannabinoid CB1 or CB2 receptors are upregulated in the prefrontal cortex of multiple sclerosis patients. Int J Mol Sci. 10.3390/ijms25084176 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Matsushima GK, Morell P (2006) The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol 11:107–116. 10.1111/j.1750-3639.2001.tb00385.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.van der Star B, Vogel D, Kipp M et al (2012) In vitro and in vivo models of multiple sclerosis. CNS Neurol Disord - Drug Targets 11:570–588. 10.2174/187152712801661284 [DOI] [PubMed] [Google Scholar]
- 69.Hh S, Kk B, Dc P et al (2014) A new model of cuprizone-mediated demyelination/remyelination. ASN Neuro. 10.1177/1759091414551955 [Google Scholar]
- 70.Zirngibl M, Assinck P, Sizov A, et al (2022) Oligodendrocyte death and myelin loss in the cuprizone model: an updated overview of the intrinsic and extrinsic causes of cuprizone demyelination. Mol Neurodegener 17 [DOI] [PMC free article] [PubMed]
- 71.Carassiti D, Altmann DR, Petrova N et al (2018) Neuronal loss, demyelination and volume change in the multiple sclerosis neocortex. Neuropathol Appl Neurobiol 44:377–390. 10.1111/nan.12405 [DOI] [PubMed] [Google Scholar]
- 72.Zhang Y, Cai L, Fan K et al (2019) The spatial and temporal characters of demyelination and remyelination in the cuprizone animal model. Anat Rec 302:2020–2029. 10.1002/ar.24216 [DOI] [PubMed] [Google Scholar]
- 73.Skripuletz T, Gudi V, Hackstette D, Stangel M (2011) De- and remyelination in the CNS white and grey matter induced by cuprizone: the old, the new, and the unexpected. Histol Histopathol 26:1585–1597 [DOI] [PubMed] [Google Scholar]
- 74.Sen MK, Almuslehi MSM, Coorssen JR et al (2020) Behavioural and histological changes in cuprizone-fed mice. Brain Behav Immun 87:508–523. 10.1016/j.bbi.2020.01.021 [DOI] [PubMed] [Google Scholar]
- 75.Martínez‐Pinilla E, Rubio‐sardón N, Villar‐conde S et al (2021) Cuprizone‐induced neurotoxicity in human neural cell lines is mediated by a reversible mitochondrial dysfunction: relevance for demyelination models. Brain Sci 11:1–16. 10.3390/brainsci11020272 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Martínez-Pinilla E, Rubio-Sardón N, Peláez R et al (2021) Neuroprotective effect of Apolipoprotein D in cuprizone-induced cell line models: a potential therapeutic approach for multiple sclerosis and demyelinating diseases. Int J Mol Sci 22:1260. 10.3390/ijms22031260 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Post GR, Dawson G (1992) Characterization of a cell line derived from a human oligodendroglioma. Mol Chem Neuropathol 16:303–317. 10.1007/BF03159976 [DOI] [PubMed] [Google Scholar]
- 78.Bello-Morales R, Crespillo AJ, García B et al (2014) The effect of cellular differentiation on HSV-1 infection of oligodendrocytic cells. PLoS One. 10.1371/journal.pone.0089141 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Rozenfeld R, Gupta A, Gagnidze K et al (2011) AT1R-CB1 R heteromerization reveals a new mechanism for the pathogenic properties of angiotensin II. EMBO J 30:2350–2363. 10.1038/emboj.2011.139 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Moreno E, Andradas C, Medrano M et al (2014) Targeting CB2-GPR55 receptor heteromers modulates cancer cell signaling. J Biol Chem 289:21960–21972. 10.1074/jbc.M114.561761 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Zhang M, Chen T, Lu X et al (2024) G protein-coupled receptors (GPCRs): advances in structures, mechanisms, and drug discovery. Signal Transduct Target Ther 9:1–43 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Kargl J, Balenga N, Parzmair GP et al (2012) The cannabinoid receptor CB1 modulates the signaling properties of the lysophosphatidylinositol receptor GPR55. J Biol Chem 287:44234–44248. 10.1074/jbc.M112.364109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Ross RA (2009) The enigmatic pharmacology of GPR55. Trends Pharmacol Sci 30:156–163 [DOI] [PubMed] [Google Scholar]
- 84.Sharir H, Abood ME (2010) Pharmacological characterization of GPR55, a putative cannabinoid receptor. Pharmacol Ther 126:301–313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Queiroz CM, de Oliveira KL, da Silva CRP et al (2025) Chemical diversity, receptor binding affinity, and pharmacology of phytocannabinoids: Insights into neuronal mechanisms. Prog Brain Res 296:1–28. 10.1016/bs.pbr.2025.07.006 [DOI] [PubMed] [Google Scholar]
- 86.Franco R, Casadó V, Cortés A et al (2007) Basic concepts in G-protein-coupled receptor homo- and heterodimerization. The Scientific World JOURNAL 7:48–57 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Zhang Y, Guo TB, Lu H (2013) Promoting remyelination for the treatment of multiple sclerosis: opportunities and challenges. Neurosci Bull 29:144–154 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.DeSilva TM (2023) Remyelinating versus neuroprotective therapies for multiple sclerosis. Open Access Gov 37:136–137. 10.56367/oag-037-10382 [Google Scholar]
- 89.Zhang H, Hilton DA, Hanemann CO, Zajicek J (2011) Cannabinoid receptor and N-acyl phosphatidylethanolamine phospholipase D-evidence for altered expression in multiple sclerosis. Brain Pathol 21:544–557. 10.1111/j.1750-3639.2011.00477.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Benito C, Romero JP, Tolón RM et al (2007) Cannabinoid CB1 and CB2 receptors and fatty acid amide hydrolase are specific markers of plaque cell subtypes in human multiple sclerosis. J Neurosci 27:2396–2402. 10.1523/JNEUROSCI.4814-06.2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Moreno-Luna R, Esteban PF, Paniagua-Torija B et al (2021) Heterogeneity of the endocannabinoid system between cerebral cortex and spinal cord oligodendrocytes. Mol Neurobiol 58:689–702 [DOI] [PubMed] [Google Scholar]
- 92.Vega-Riquer JM, Mendez-Victoriano G, Morales-Luckie RA, Gonzalez-Perez O (2019) Five decades of cuprizone, an updated model to replicate demyelinating diseases. Curr Neuropharmacol 17:129–141. 10.2174/1570159x15666170717120343 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Reynoso-Moreno I, Tietz S, Vallini E et al (2021) Selective endocannabinoid reuptake inhibitor WOBE437 reduces disease progression in a mouse model of multiple sclerosis. ACS Pharmacology & Translational Science 4:765–779. 10.1021/acsptsci.0c00214 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated and/or analyzed during the current study are not publicly available due to privacy/ethical restrictions but are available from the corresponding author upon reasonable request.






