Prophylactic C-terminal occludin–derived peptide attenuates LPS-induced airway inflammation via barrier preservation and mitochondrial ROS regulation

Abstract

Occludin is a key tight junction protein that contributes to epithelial barrier integrity and inflammatory regulation. Although its structural roles are well characterized, the physiological relevance of its C-terminal domain in airway inflammation remains poorly defined. Occludin expression was statistically reduced in inflamed human lung tissues. In BEAS-2B cells, occludin overexpression suppressed LPS-induced IL-8 release, restored barrier integrity, and reduced F-actin remodeling, whereas C-terminal deletion abolished these effects. The C-terminal occludin peptide (391∼412) significantly decreased IL-8 production, improved barrier function, and suppressed cytoskeletal changes, while a mutant peptide was ineffective. Transcriptomic analyses identified occludin as a central suppressor of inflammatory signaling. Mechanistically, the peptide inhibited p38 activation, preserved mitochondrial structure, and reduced mtROS production. In vivo, peptide pretreatment improved survival, lowered IL-1β, IL-6, IL-8, and TNF-α levels, and reduced goblet cell hyperplasia and inflammatory infiltration. Immune profiling further revealed restored T-cell populations, reduced myeloid expansion, and enhanced M2 alveolar macrophage polarization. The occludin C-terminal–derived peptide exerts robust anti-inflammatory, barrier-protective effects, and a modulator of mitochondrial redox balance representing a promising therapeutic candidate for LPS-induced and potentially broader inflammatory lung diseases.

Graphical abstract

Highlights

• •Occludin expression is reduced in inflamed human lung tissues.
• •An occludin C-terminal–derived peptide attenuates LPS-induced airway inflammation.

Abbreviations used:

LPS

Lipopolysaccharide

IL:

Interleukin

mtROS

Mitochondrial Reactive oxygen species

TNF

Tumor Necrosis Factor

TJs

Tight Junction proteins

ZO

Zonula Occludens

CPP

Cell-penetrating peptide

ELISA

Enzyme-Linked Immunosorbent Assay

OCLN

Occludin

i.t

intratracheally

H&E

Hematoxylin and eosin

PAS

Periodic acid Schiff

TEER

Trans-epithelial electrical resistance

WT

Wild-type

MAPK

Mitogen-activated protein kinase

BAL:

Bronchoalveolar lavage

AM

Alveolar Macrophage

1. Introduction

Airway inflammation is a major pathological feature of most respiratory diseases, including pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), asthma, and acute respiratory distress syndrome (ARDS), all of which are major contributors to global morbidity and mortality [1,2]. These pulmonary diseases are frequently characterized by epithelial barrier dysfunction, excessive immune cell infiltration, and overproduction of pro-inflammatory cytokines, leading to tissue injury and compromised pulmonary physiological function. The airway epithelium plays important roles as both a physical and immunological barrier, acting as the first line of defense against the environment, orchestrating innate immune responses while maintaining barrier integrity through specialized intercellular junctions known as tight junctions (TJs) [3]. The disruption of epithelial tight junctions impairs barrier integrity and heightens inflammatory signaling and immune cell infiltration, thereby worsening tissue damage.

Occludin, a well-known tetraspanin (TM4SF) protein and an important component of the TJ complex, plays a pivotal role in regulating paracellular permeability and epithelial homeostasis [4,5]. Structurally, occludin spans the plasma membrane four times and contains two extracellular loops, a short N-terminal cytoplasmic domain, and a long C-terminal cytoplasmic domain, the latter of which has been implicated in protein–protein interactions and intracellular signaling regulation [6]. Through interaction with cytoplasmic scaffolding proteins such as zonula occludens (ZO)-1, occludin anchors the TJ complex to the actin cytoskeleton and dynamically regulates the assembly and disassembly of tight junctions in response to physiological or pathological stimuli. Several studies have reported reduced occludin expression in inflamed or damaged lung tissue, implicating its downregulation in the pathogenesis of airway inflammatory diseases [7,8]. Beyond its structural role, occludin also participates in the intracellular signaling pathways that modulate inflammatory responses, particularly via its C-terminal domain [[9], [10], [11]]. However, the specific physiological pathways by which occludin alters airway inflammation and the functional significance of its critical structural domains, especially in the context of acute inflammatory insults, remain incompletely understood.

Peptide-based therapeutics have emerged as a promising class of pharmaceutical agents, offering distinct advantages in terms of specificity, safety, and structural versatility compared to small molecules and biologics [12,13]. Owing to their intrinsic ability to mimic endogenous protein–protein interactions, peptides can modulate a wide range of cellular processes with high target selectivity while minimizing off-target effects [14]. This property is particularly attractive in the context of inflammation, where the ability to interfere with specific molecular pathways—such as those involved in cytokine signaling or TJs regulation—may yield potent therapeutic effects with reduced systemic toxicity. In recent years, considerable progress has been made in overcoming the inherent limitations of peptide drugs, including their susceptibility to proteolytic degradation and poor cell permeability. Strategies such as chemical modification, cyclization, and conjugation to cell-penetrating motifs (e.g., TAT sequences) have significantly enhanced the stability and bioavailability of therapeutic peptides in both in vitro and in vivo settings [15]. Moreover, advances in peptide design have enabled the development of synthetic peptides that selectively target intracellular domains in key regulatory proteins, offering novel approaches to modulate cellular functions at the molecular level.

Here, we investigated the regulatory role of occludin and its C-terminal-derived peptide in airway epithelial inflammation using in vitro and in vivo models of LPS-induced injury. We hypothesized that restoration of occludin function, particularly via its C-terminal domain, would suppress pro-inflammatory signaling, mtROS production, preserve epithelial barrier integrity, and modulate immune cell populations, ultimately attenuating lung inflammation and tissue damage. Our findings reveal a novel protective mechanism for occludin and provide preclinical evidence supporting the therapeutic potential of occludin-derived peptides in inflammatory lung diseases.

2. Methods

2.1. Lung tissue array

A human lung disease spectrum tissue array was purchased from TissueArray (#LC487) A human lung disease spectrum tissue array. The tissue array consisted of 24 cases (48 scores), which included normal lung tissue, lung hyperplasia of stroma and pulmonary fibrosis with chronic inflammation of bronchiole, lung lobar pneumonia, pulmonary atelectasis, collapsed lung, pulmonary tuberculosis, pulmonary emphysema, and inflammatory pseudotumor plus lung small cell carcinoma, lung adenocarcinomas, and lung squamous cell carcinomas. Of these, we used three different groups of tissues: normal, hyperplasia, and inflammation. Lung sections were processed with anti-OCLN antibody (#33-1500, Invitrogen, USA), stained with Deep-Red, and images were taken for each core.

2.2. Cell culture

Human bronchial epithelial (BEAS-2b) cells were purchase from ATCC (CRL-9609), and cells were cultured in BEBM (Lonza, Basel, Switzerland) with a BEGM kit at 37 °C in a humidified incubation with 5% CO₂. The culture plates were pre-coated with a mixture of 0.01 mg/ml fibronectin, 2 mg/ml gelatin and 0.01 mg/ml bovine serum albumin dissolved in BEBM. The LPS from Pseudomonas aeruginosa was purchase from Sigma-Aldrich (L9143, St. Louis, MO, USA) and the cells were treated with LPS (10 mg/ml) for the time indicated.

2.3. Proteome profiler cytokine array

Proteome Profiler Human Cytokine Array kit was purchased from R&D Systems (cat no. ARY005B, USA). To determine whether LPS regulates the secretion of cytokines/extracellular chemokines that can control the airway microenvironment, after overexpression and knock-down of OCLN in BEAS-2b cells, the medium was recovered and a cytokine array was performed according to the manufacturer's instructions.

2.4. Real-time qPCR

Total RNA was isolated using TRIzol from BEAS-2b cells treated with LPS (10 μg/ml). cDNA was synthesized by AccuPower CycleScript RT premix (dT20). Real-time PCR was performed using a QuantStudio 3 Real-Time PCR system with TOPrealTMSYBR Green qPCR Mix. All reactions were carried out in a total volume of 20 μl which included 10 μl of 2x SYBR Green PCR Master Mix, 300 nM of each primer, and 1 μg of cDNA template. The parameters were 95 °C for 10 min, followed by 30 ∼ 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. All reactions were performed with triplicate. The relative gene expression levels were calculated using the 2–ΔΔCt method using GAPDH as a reference. The following primers were used (5′ → 3′): hOCLN, (F: CCAGCCTACTCTTTTTACCC, R: CTGCTCTTGGGTCTGTATAG); hIL-8, (F: GAGAGTGATTGAGAGTGGACCAC, R: CACAACCCTCTGCACCCAGTTT); hGAPDH, (F: CCACATGGCCTCCAAGGAGTAAGAC, R: AGGAGGGGAGATTCAGTGTGGTGGG).

2.5. Western blot

We purchased antibodies against occludin from invitrogen; phospho-p38, p38, phospho-ERK1/2, phosphor-JNK, phospho-IκBα, IκBα, phospho–NF–κB p65, NF-κB p65, and β-actin from Cell Signaling Technology; DRP1 from Santa Cruz; phospho-Drp1 form Thermo Fisher. Anti-mouse IgG HRP (#7076) and anti-rabbit IgG HRP (#7074) were purchased from Cell Signaling Technology as secondary antibodies. The cells were lysed with RIPA lysis buffer (50 mM Tris pH 7.4, 250 mM NaCl, 1% NP40, 0.05% SDS, 2 mM EDTA, 0.5% Deoxycholic acid, 10 mM β-glycerol phosphate, 5 mM NaF, 1 mM Na₃VO₄, protease inhibitor cocktail). Equal amounts of whole cell lysates were resolved by SDS-PAGE and transferred to the PVDF membrane. The membranes were blocked with 5% BSA for 1 h at room temperature. Blots were then incubated overnight with a specific antibody in TBST (Tris-buffered saline supplemented 0.5% Tween 20), respectively. After rinsing with TBST, the blots were further incubated for 1hr at room temperature with secondary antibody in TBST and visualized using the ECL system.

2.6. Trans-epithelial electrical resistance (TEER)

Before analysis, the electrodes were sterilized and assessed according to the manufacturer's instructions (Merck, Sigma-Aldrich, St. Louis, MO, USA). The shorter tip was set in the culture plate insert and the longer tip was set in the outer well. The unit area resistance (Ω X cm²) was determined by multiplying the sample resistance (Ω) by the effective area of the membrane (4.2 cm² for 6-well Millicell inserts).

2.7. F-actin staining

F-actin staining was performed using ActinRed 555 Ready Probe reagent (Molecular Probes; R37112) following the manufacturer's instructions. The cells were incubated for 30 min, the stain solution was removed, and the cells rinsed with PBS. Images were obtained using a Nikon Eclipse 80i microscope (Tokyo, Japan) with a 540 nm excitation filter and a 565 nm emission filter.

2.8. OCLN deletion mutant constructs, RNA interference and peptide synthesis of OCLN

The wild type and four deletion mutants of human OCLN were purchased from Addgene (USA): a N-terminal deletion (OCLN ΔN), an extracellular large loop 1 deletion (OCLN ΔEL1), an extracellular large loop 2 deletion (OCLN ΔEL2), and a C-terminal deletion (OCLN ΔC). The siRNA that targets OCLN gene and control siRNA were synthesized by Bioneer (Daejeon, Republic of Korea). The OCLN target sequences were as follows: siOCLN 1, 5′-CAGAACUUCAUCAGAUCAA (dTdT)-3′; siRNA-OCLN 2, 5′-GACGAUGUCUUCAUACCUA (dTdT))-3′; siRNA-OCLN 3, 5′-CUGCUUGGUAUUGCCUACA (dTdT)-3′; siControl, 5′-CCUACGCCACCAAUUUCGU (dTdT)-3′. Both wild type OCLN (WT OCLN) and mutant OCLN (mut OCLN) peptides were synthesized by BIONICS (Seoul, Korea). The peptide sequences were as follows: WT OCLN; FITC-GRKKRRQRRR (Tat) KRTEQDHYETDYTTGGESCDEL; mut OCLN, FITC-GRKKRRQRRR (Tat) KRTEQDHYETDAAAGGESCDEL. The mutant peptide replaced the important sequence of the occludin motif (YTT) with AAA. Peptides were synthesized with a Tat sequence to enable cell permeability. In addition, FITC was tagged to confirm intracellular internalization of the peptide. The constructs of OCLN were transfected using FuGENE6 reagent (Roche) according to the manufacturer's instructions.

2.9. RNA sequencing

Libraries were prepared from total RNA using the NEBNext Ultra II Directional RNA-Seq Kit (NEW ENGLAND BioLabs, Inc., UK). The isolation of mRNA was performed using the Poly(A) RNA Selection Kit (LEXOGEN, Inc., Austria). The isolated mRNAs were used for the cDNA synthesis and shearing, following manufacture's instruction. Indexing was performed using the Illumina indexes 1-12. The enrichment step was carried out using of PCR. Subsequently, libraries were checked using the TapeStation HS D1000 Screen Tape (Agilent Technologies, Amstelveen, The Netherlands) to evaluate the mean fragment size. Quantification was performed using the library quantification kit using a StepOne Real-Time PCR System (Life Technologies, Inc., USA). High-throughput sequencing was performed as paired-end 100 sequencing using NovaSeq 6000 (Illumina, Inc., USA).

2.10. Data analysis

A quality control of raw sequencing data was performed using FastQC. Adapter and low quality reads (<Q20) were removed using FASTX_Trimmer and BBMap. Then the trimmed reads were mapped to the reference genome using TopHat. The RC (Read Count) data were processed based on FPKM + Geometric normalization method using EdgeR within R (R development Core Team, 2020). FPKM (Fragments Per kb per Million reads) values were estimated using Cufflinks. Data mining and graphic visualization were performed using ExDEGA (Ebiogen Inc., Korea). DEGs were mapped to the search tool for retrieval of interacting genes (STRING) to acquire protein–protein interaction networks (Cytoscape, http://cytoscape.org).

2.11. Analyses of mitochondrial membrane potential

Mitochondrial membrane potential was assessed using the JC-1 assay, which relies on selective uptake of a potential-sensitive cationic probe by energized mitochondria. The assay was performed using the JC-1 Mitochondrial Membrane Potential Assay Kit (ab113850, Abcam, Cambridge, UK) according to the manufacturer's instructions.

2.12. Animal experiments

All animal experiments were performed with the guidelines and approval from the Institutional Animal Care and Use Committee of Kosin University College of Medicine, Busan, Republic of Korea. Mice were housed in a strictly controlled facility on a light-dark cycle with 12h light duration, food and water available ad libitum. Age-matched (8-week-old) C57BL/6 male mice were used the LPS-induced airway inflammation model. WT OCLN or mut OCLN peptides (5.0 mg/kg, respectively) were administered via intratracheally injection 24 h before LPS injection (5 mg/kg) via intratracheally injection. Mice were anesthetized with Alfaxan (80 mg/kg) and Rumpun (10 mg/kg) via intraperitoneal injection, and BALF and lung tissue were collected. Tissues were fixed with 4% paraformaldehyde in phosphate buffer (100 mM, pH 7.4). Samples were embedded in paraffin wax, and 5 μm-thick sections were prepared using a rotary microtome (Leica RM 2135, Nussloch, Germany). For histological examination, paraffin sections were deparaffinized in xylene and dehydrated in serial ethanol solutions, followed by hematoxylin and eosin (H&E) staining, Periodic acid Schiff (PAS) staining, and immunohistochemistry staining.

2.13. Immunohistochemistry

Immunohistochemistry was performed using the Vectastain Elite ABC Kit (Vector Laboratories). Briefly, deparaffinized sections were treated with citrate buffer (10 mM, pH 6.0) in a microwave for 3 min, and then treated with 0.3% hydrogen peroxide in methyl alcohol for 20 min to block endogenous peroxidase activity. Subsequently, sections were incubated with the matching blocking serum (10% [v/v] goat serum in phosphate-buffered saline (PBS); Vectastain Elite ABC Kit; Vector Laboratories). The samples were incubated with primary antibody, rabbit ant-ionized calcium binding adaptor molecule 1 (Iba1; 1:1000, 019-19749, LER0547, Wako) for 1 h at room temperature. After three washes with PBS, sections were incubated with biotinylated rabbit IgG antibody and then with ABC peroxidase, according to the manufacturer's instructions. The peroxidase reaction was developed using a 3-3′-diaminobenzidine substrate kit (Vector Laboratories), followed by counterstaining with hematoxylin before mounting.

2.14. Mitochondria isolation and mtROS measurement

Isolation of mitochondria from BEAS-2b was performed using a specific assay kit (89874, Thermo Fisher Scientific, St. Louis, MO, USA) according to the manufacturer's instructions. For mtROS measurement, isolated mitochondria samples (200 mg) were suspended in cellular ROS assay buffer. Then, 100 μl of mitochondria suspension was mixed with 20 μM of 2′,7′dichlorofluorescein diacetate (DCFDA). The mixture was incubated in the dark for 45 min at 37 °C. Finally, the fluorescence intensity of the samples was measured using an Agilent BioTek Synergy HTX multifunctional microplate reader (λ excitation: 485 nm and λ emission: 525 nm) in end point mode.

2.15. Fluorescence-activated cell sorting (FACS) analysis

Cell pellets from BALF were resuspended in FACS buffer containing 0.1% BSA and 1% FBS. Antibodies were purchased from BioLegend. For identification of mouse myeloid cells, cells were stained with fluorochrome-conjugated anti-mouse antibodies against CD45 (FITC, clone 30-F11), CD11b (PE, clone M1/70), F4/80 (APC/Cyanine7, clone BM8), CD170 (PE, S17007L), Ly6G (PerCP/Cyanine5.5, clone 1A8), CD86 (PerCP/Cyanine5.5, clone GL-1), or CD206 (APC, clone C068C2). Appropriate isotype control antibodies were used when necessary. After staining, labeled cells were washed twice with FACS buffer at 1500×g for 5 min at 4 °C and analyzed using CytoFLEX (Beckman Coulter Diagnostics, La Brea, CA, USA).

2.16. Statistical analysis

The data are presented as means ± standard deviations of more than three independent experiments. When appropriate, the statistical differences were measured using Wilcoxon Mann–Whitney tests. A p-value <0.05 was considered statistically significant.

3. Results

3.1. Occludin expression is decreased in human lung diseases related to inflammation

To investigate the clinical relevance of occludin expression in relation to inflammation in human lung tissue, immunohistochemistry was performed using an occludin-specific antibody on a human pathological lung tissue array (Fig. 1A). The clinical characteristics of the patients from whom lung samples were obtained are summarized in Table 1. Occludin expression was statistically decreased in the hyperplasia and inflammation groups compared with normal lung tissue, and the lowest expression was observed in the inflammation group. Representative images are presented along with quantification scores (Fig. 1B). These findings suggest that a significant reduction in occludin expression is closely associated with inflammatory disease processes in the lung.

Fig. 1.

Occludin expression correlated to inflammation in human pulmonary diseases.

(A) Human lung tissues from three distinct groups—normal, hyperplasia, and inflammation—were analyzed. Tissue sections were immunostained with an anti-occludin antibody and visualized using Deep-Red fluorescence. For each tissue core, five independent fields were imaged and subsequently scored on a scale of 1 to 7 by three blinded investigators. (B) Quantitative analysis of staining intensity was performed to compare occludin expression levels across groups. ∗p < 0.05 versus the normal group. All data are representative of at least three independent experiments.

Table 1.

The basic demographic information for the human samples.

NUmber	Age	Sex	Organ	Pathological diagnosis	Type
Normal 1	24	M	Lung	Normal lung tissue	Normal
Normal 2	42	M	Lung	Normal lung tissue	Normal
Normal 3	24	M	Lung	Normal lung tissue	Normal
Normal 4	42	M	Lung	Normal lung tissue	Normal
Hyperplasia 1	60	M	Lung	Mild hyperplasia of stroma	Hyperplasia
Hyperplasia 2	62	M	Lung	Mild hyperplasia of stroma	Hyperplasia
Hyperplasia 3	60	M	Lung	Hyperplasia of stroma with congestion	Hyperplasia
Hyperplasia 4	60	M	Lung	Mild hyperplasia of stroma	Hyperplasia
Hyperplasia 5	64	M	Lung	Mild hyperplasia of stroma with edema	Hyperplasia
Inflammation 1	52	M	Lung	Lobar pneumonia	Inflammation
Inflammation 2	63	M	Lung	Pulmonary tuberculosis	Inflammation
Inflammation 3	52	M	Lung	Lobar pneumonia	Inflammation
Inflammation 4	63	M	Lung	Pulmonary tuberculosis	Inflammation
Inflammation 5	61	F	Lung	Pulmonary tuberculosis	Inflammation
Inflammation 6	68	F	Lung	Pulmonary fibrosis with chronic inflammation of bronchiole	Inflammation
Inflammation 7	72	M	Lung	Pulmonary fibrosis with chronic inflammation of bronchiole	Inflammation
Inflammation 8	37	M	Lung	Pulmonary fibrosis with chronic inflammation of bronchiole	Inflammation
Inflammation 9	61	F	Lung	Pulmonary tuberculosis	Inflammation

3.2. The overexpression of occludin modulates the IL-8 expression, TEER, and LPS-induced F-actin formation in BEAS-2B cells

To investigate whether LPS regulates the expression of occludin during the early stages of exposure, BEAS-2B cells were treated with LPS in a time-dependent manner. As a result, both the gene and protein expression levels of occludin were statistically reduced after 1 h and 4 h of LPS treatment, respectively (Fig. 2A and B). LPS signaling is known to stimulate the secretion of various cytokines and chemokines, thereby amplifying inflammatory responses in cells. To test this hypothesis, a proteome profiler cytokine array assay was performed using the conditioned medium from LPS-treated cells. Interestingly, IL-8 secretion was statistically increased upon LPS stimulation (Fig. 2C). While IL-8 extracellular secretion was decreased in the cells transfected with a wide-type occludin overexpression construct, it was statistically increased in siRNA-occludin-transfected cells. Moreover, IL-8 gene expression was also regulated by occludin at the intracellular level (Fig. 2D). Trans-epithelial electrical resistance (TEER) is a widely used quantitative method for assessing the integrity and permeability of cellular monolayers, particularly in epithelial and endothelial cell cultures. TEER values reflect the tightness of tight junctions (TJs) between adjacent cells [16,17]. To determine whether occludin overexpression influences membrane integrity during LPS-induced airway inflammation, we performed a TEER assay. TEER was restored upon occludin overexpression, whereas siRNA-mediated occludin knockdown did not reinstate membrane integrity (Fig. 2E). Interestingly, while LPS stimulation statistically induced F-actin formation, occludin overexpression statistically attenuated LPS-induced F-actin formation. Conversely, LPS-induced F-actin formation was partially restored upon siRNA-mediated occludin knockdown (Fig. 2F). These findings indicate that occludin overexpression statistically decreased LPS-induced IL-8 secretion/production, TEER, and F-actin formation, thereby it may play a crucial role in regulating the inflammatory microenvironment and maintaining homeostasis in human bronchial epithelial cells following LPS exposure.

Fig. 2.

Occludin modulates LPS-induced IL-8 secretion, barrier integrity, and cytoskeletal remodeling in human bronchial epithelial cells.

(A) The BEAS-2b cells were transfected and were then incubated with LPS in a time-dependent manner before the generation of total cell lysates, and occludin transcripts were assessed by qRT-PCR. ∗p < 0.05 compared to the control. (B) The cells were treated with LPS in a time-dependent manner. The occludin-specific antibody was assessed by Western blot analysis. β-actin was used as a loading control. (C) A construct expressing wild-type occludin or siRNA-occludin was transiently transfected into BEAS-2b cells. The cells were washed and serum-starved overnight. They were subsequently treated with LPS for 2 h and a cytokine assay was performed with cultured media and cell lysates were harvested for qRT-PCR of IL-8 (D). The density of the resulting spots of IL-8 was measured using a densitometric analysis. ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with WT occludin-treated transfectants. (E) The cells were transfected with either the wild-type occludin construct or siRNA-occuldin before incubation with LPS for various times, and then TEER testing was performed. Error bars represent the SEM of at least three independent experiments. (F) Cells were then treated with LPS for 2 h. F-actin staining was performed using ActinRed 555 ReadyProbe reagent (Molecular Probes) following the manufacturer's instructions. Cell nuclei were stained with diluted Deep Red (1:300). The fluorescence intensity was analyzed and statistically evaluated (right panel). ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with WT occludin-treated transfectants. All data are representative of at least three independent experiments.

3.3. The C-terminal domain of the occludin protein is critical in suppressing LPS-induced airway inflammation

Occludin is a well-characterized tetraspanin protein that spans the cell membrane four times and consists of four structurally and functionally distinct domains [7,11,18]. To identify the key domains of occludin involved in regulating LPS-induced airway inflammation, we generated four deletion mutants of OCLN: an N-terminal deletion (OCLN ΔN), an extracellular loop 1 deletion (OCLN ΔEL1), an extracellular loop 2 deletion (OCLN ΔEL2), and a C-terminal deletion (OCLN ΔC) (Fig. 3A). These occludin deletion constructs were transfected into BEAS-2B cells, followed by LPS stimulation, and the gene expression of IL-8, TEER, and F-actin formation were assessed. Upon LPS stimulation, IL-8 gene expression (Fig. 3B) and F-actin formation (Fig. 3D) were statistically increased in the cells overexpressing OCLN ΔC as well as LPS only. Furthermore, TEER was not restored in the cells expressing the OCLN ΔC mutant, exhibiting a pattern similar to that observed with LPS treatment alone (Fig. 3C). These findings suggest that the C-terminal domain of occludin plays a critical physiological role in regulating LPS-induced airway inflammation.

Fig. 3.

The C-terminal domain of occludin reduces IL-8 expression and F-actin formation in BEAS-2b cells

(A) The occludin deletion mutants were imaged. (B) The cells were transfected with each occludin deletion mutant construct and treated with LPS for 2 h, the IL-8 transcripts were assessed by qRT-PCR and TEER testing was performed (C). ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with other deletion mutant construct-treated transfectants. (D) After transfected with deletion mutant construct, cells were then treated with LPS for 2 h. F-actin staining was performed using ActinRed 555 ReadyProbe reagent (Molecular Probes) following the manufacturer's instructions. Cell nuclei were stained with diluted Deep Red (1:300). The fluorescence intensity was analyzed and statistically evaluated (lower panel). ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with WT occludin-treated transfectants. All data are representative of at least three independent experiments.

3.4. An occludin-derived C-terminal peptide exhibits protective effects against LPS-induced airway inflammation

The results presented in Fig. 3 demonstrate that the C-terminal domain of occludin is essential for maintaining tight junction integrity and suppressing LPS-induced airway inflammation. To identify the core sequence within the C-terminal domain of occludin responsible for regulating airway inflammation and tight junction stability, we designed a FITC-tagged peptide consisting of 22 amino acids (residues 391 ∼ 412 of full-length occludin). To enhance cell permeability, this peptide was conjugated with a TAT (GRKKRRQRRR) sequence. Additionally, we generated a mutant peptide in which the critical C-terminal motif (YTT) was substituted with AAA (Fig. 4A). Interestingly, while the wild-type occludin peptide (pepWT OCLN) statistically reduced IL-8 gene expression (Fig. 4B) and F-actin formation (Fig. 4D) following LPS treatment, the mutant occludin peptide (pepMut OCLN) did not exhibit these effects. Moreover, TEER was restored upon treatment with the wild-type peptide but remained unaffected by the mutant peptide (Fig. 4C). These findings suggest that a peptide containing the core sequence of the occludin C-terminal domain may serve as a therapeutic agent for anti-inflammatory treatment and for preserving tight junction integrity in an inflamed environment.

Fig. 4.

A peptide based on the core sequence of the occludin C-terminal domain modulates LPS-induced inflammatory responses.

(A) Peptides were synthesized with a Tat region (italic amino acids) based on the C-terminal domain core sequence of occludin and also tagged with FITC for tracing. A mutant peptide was synthesized by substituting the core sequence YTT with AAA. (B) The BEAS-2b cells were treated with wild-type occludin peptide (pepWT OCLN) or mutant occludin peptide (pepMut OCLN) for 30 h and incubated with LPS for 2 h. The occludin transcripts were assessed by qRT-PCR (B), TEER testing (C), and F-actin formation (D) were performed (C). ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with wild-type occludin peptide-treated cells. The fluorescence intensity was analyzed and statistically evaluated (right panel). All data are representative of at least three independent experiments.

3.5. Transcriptomic analysis reveals occludin as a key suppressor of LPS-induced inflammatory networks

To investigate the role of occludin in regulating inflammatory responses, we performed transcriptomic profiling under conditions of LPS stimulation and occludin overexpression/knockdown. Hierarchical clustering and heatmap analysis showed remarkable transcriptional changes in the LPS/CTRL group, which were further accentuated upon si-occludin treatment (Fig. 5A). Compared with wild-type occludin, knockdown of occludin led to pronounced upregulation of pro-inflammatory genes in response to LPS. Additionally, functional enrichment analysis demonstrated that gene expression changes in the LPS/CTRL group were predominantly clustered in pathways related to inflammatory response and autoimmunity (12.99%), inflammasomes (12.82%), and inflammatory cytokines/receptors (11.69%) (Fig. 5C). Notably, si-occludin/CTRL cells exhibited even higher enrichment in these categories, with inflammatory response and autoimmunity (15.58%) and inflammasomes (15.38%) representing the most affected pathways (Fig. 5B). Conversely, overexpression of wild-type occludin attenuated LPS-induced enrichment, reducing inflammatory cytokines/receptors to 3.9% and autoimmunity pathways to 6.49%. Protein–protein interaction (PPI) network analysis highlighted a core set of inflammatory mediators as central hubs, including TNF, IL-6, CXCL2, CXCL8, and CCL2, as well as upstream regulators such as TLR4 (Fig. 5D). Importantly, wild-type occludin expression dampened the activation of these networks, further supporting its functional role in suppressing excessive cytokine and chemokine signaling, while these nodes exhibited stronger interconnectivity and higher degree centrality compared with controls, underscoring the potentiation of inflammatory cascades in the absence of occludin (Fig. 5C).

Fig. 5.

Comparison of mRNA expression in the BEAS-2b cells overexpressed occludin.

BEAS-2B cells were transfected with wild-type occludin or siRNA-occludin for 24 h and then incubated with LPS for 2 h, after which RNA sequencing analysis was performed. (A) The heat map shows the general regulation pattern of inflammation-related genes that are differentially expressed when WT occludin and siRNA-occludin were treated with LPS, an inflammatory substance. Each row represents a gene, and the columns represent the values of the control group treated only with LPS and the WT occludin and siRNA-occludin groups with LPS. This was used by converting each log value into a fold change value. All genes were adjusted to have the same mean and standard deviation, the unit of change is the standard deviation from the mean, and the color value range of each row is the same. (B) Significant genes were selected using Gene category chat (Fold change value of 2.00 and normalized data (log2) value of 4.00). The above pie chart shows the distribution of four gene categories when comparing LPS versus control, WT occludin + LPS/LPS, and siRNA-occludin + LPS/control. The bar graph below shows RED = upregulated, GREEN = downregulated for each gene category, and shows the number of upregulated and downregulated genes in each gene category. (C) The most markedly altered categories were summarized based on the results shown in panel B. (D) The protein-protein interaction network constructed by the STRING database differentially displays commonly occurring genes by comparing WT occludin + LPS/LPS, siRNA-occludin + LPS/LPS, and LPS/control. These nodes represent proteins associated with inflammation, and these connecting lines denote interactions between two proteins. Different line thicknesses indicate types of evidence used in predicting the associations.

3.6. Wild-type occludin peptide attenuates LPS-Induced p38 activation, mitochondrial dysfunction, and cytotoxicity

To investigate the regulatory effects of occludin on inflammatory signaling, we examined the activation of MAPK pathway and NF-κB signaling after treatment with wild-type occludin peptide. p38 was activated by LPS after 15 min. Wide-type occludin peptide markedly decreased the activation of p38, but not mutant occludin peptide for 60 min. In spite that NF- κB signaling was activated, each occludin peptide did not affect the signaling. Interestingly, the phosphorylation of Drp1 was decreased slightly by wild-type occludin peptide for 15 min, but not mutant peptide. The cleavage activation of caspase 1 and 3, which are essential components of the inflammasome, did not changed in our system (Fig. 6A). To investigate whether activation of p38 plays a critical role in LPS-induced inflammatory cytokine gene expression, a wild-type p38 overexpression construct and p38-specific siRNA were employed. Following LPS stimulation for 4 h, the mRNA expression levels of p38, IL-1β, IL-6, and IL-8 were statistically increased by wild-type p38 overexpression, whereas these increases were attenuated by p38 knockdown using siRNA. In contrast, TNF-α mRNA expression was not affected by either p38 overexpression or p38 silencing (Fig. 6B). These results indicate that p38 may be essential for the LPS-induced gene expression of specific proinflammatory cytokines. To investigate whether the peptide can control LPS-induced mitochondrial membrane potential, JC-1 assay was performed. The mitochondrial membrane potential of LPS-induced BEAS-2b cells treated with either WT OCLN peptide or mut peptide was assayed by the rate of JC-1 red and green fluorescence relative intensity. WT OCLN peptide statistically reversed the mitochondrial membrane potential in LPS-induced airway inflammation compared with LPS-treated cells, whereas the mutant peptide had no effect (Fig. 6C). To examine which occludin peptide affects LPS-induced mitochondrial membrane damage in BEAS-2b cells, Mitotracker 488 mitochondria dye was utilized. The mitoTracker staining was significantly decreased by LPS. Interestingly, wild-type occludin peptide significantly increased the staining compared to LPS only (Supplement Fig. 1). These findings suggest that occludin peptide could restore mitochondrial membrane potential and membrane integrity after LPS treatment. However, mutant occludin peptide did not have an effect. In addition, the staining of phospho-Drp1 antibody was utilized to observe LPS-induced mitochondria fission in BEAS-2b cells. Phospho-Drp1 staining was increased by LPS. Interestingly, wild-type occludin peptide statistically decreased the staining compared to LPS only. However, mutant peptide did not affect (Fig. 6D). To examine whether occludin peptide can alter LPS-induced cell cytotoxicity in BEAS-2b cells, cell toxicity assay was performed (Fig. 6E). LPS induced cytotoxicity; however, wild-type occludin peptide statistically attenuated the toxicity, while mutant peptide did not. Because this cytotoxicity caused by LPS is frequently due to mtROS production [19,20], ROS production in the mitochondria was measured in cellular mitochondria harvested from BEAS-2 cells (Fig. 6F). LPS robustly increased mtROS production to induce inflammation. However, the WT occludin peptide completely blocked LPS-induced mtROS production, while the mutant peptide did not. These results indicate that wild-type occludin peptide may have therapeutic effects on LPS-induced cytotoxicity and inflammation in BEAS-2b cells.

Fig. 6.

The peptide regulates mitochondrial dysfunction and ROS production by inhibiting LPS-induced p38 activation.

(A) The BEAS-2b cells were treated with wild-type occludin peptide (pepWT OCLN) or mutant occludin peptide (pepMut OCLN) and incubated with LPS for 15, 30 min. The phospho-specific and total antibodies were assessed by Western blot analysis. β-actin was used as a loading control. (B) The BEAS-2b cells were transfected with p38 overexpression construct (WT p38) or siRNA-p38 for 24 h and incubated with LPS for 4 h siRNA-scramble was used as a negative control. The proinflammatory cytokine transcripts were assessed by qRT-PCR. ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with WT p38-transfected cells. (C) The mitochondrial membrane potential of LPS-induced BEAS-2b cells treated with either WT OCLN peptide or mut peptide was stained with JC-1 dye. Images are representative results of 3 independent experiments. (D) The mitochondria fission was stained using phospho-Drp1 antibody and visualized. The fluorescence intensity was analyzed and statistically evaluated (right panel). ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS treatment; ∗∗∗p < 0.05 compared with WT OCLN peptide-treated transfectants. (E) After the BEAS-2b cells were harvested, cell lysates were used for MTT assay. (F) After mitochondria from the cells was isolated, the mitochondria lysates were used for mtROS measurement. ∗p < 0.05 compared with control; ∗∗p < 0.05 compared with LPS only; ∗∗∗p < 0.05 compared with LPS- and WT occludin peptide-treated cells. All data shown are representative of three independent experiments.

3.7. OCLN peptide has protective effects against LPS-induced airway inflammation in mice

We investigated the anti-inflammatory effects of the OCLN peptide in a mouse model of LPS-induced airway inflammation. Mice were pretreated with either wild-type or mutant OCLN peptide (5 mg/kg, intratracheally) for 24 h, followed by administration of LPS (5 mg/kg, intratracheally) to induce inflammation (Fig. 7A). Pretreatment with pepWT OCLN peptide statistically improved the body weight compared to LPS-only treated mice, whereas the pepMutant OCLN peptide showed no such protective effect (Fig. 7B). To assess whether WT OCLN peptide modulates the production and recruitment of pro-inflammatory cytokines in bronchoalveolar lavage (BAL) fluid following LPS administration, cytokine levels were measured by using qPCR with lung lysates and specific ELISAs with BALF. The results indicated that IL-1β, IL-6, IL-8, and TNF-α levels were statistically reduced in the lung and BALF of WT OCLN peptide-treated mice, while no significant changes were observed in mut OCLN peptide-treated mice (Fig. 7C). Furthermore, LPS administration increased inflammatory cell infiltration and mucosal thickness in the lung tissue (Fig. 7Da-d). However, this infiltration was reduced in mice pretreated with WT OCLN peptide, whereas mut OCLN peptide had no effect. LPS administration resulted in an increase in PAS-positive goblet cells within lung tissue, indicative of mucus hypersecretion. WT OCLN peptide treatment reduced PAS-positive goblet cells, but no such reduction was observed with mut OCLN peptide (Fig. 7De-h). We examined whether OCLN peptide affects acute lung damage during LPS-induced airway inflammation. And the immunohistochemistry staining using macrophage and microglia marker, Iba1, is helpful for the indication of inflamed site. Iba1 staining was strongly positive in LPS-administrated lung. This iba1 staining was decreased in WT OCLN treatment, but not mut OCLN (Fig. 7Di-l). In addition, to investigate whether lung permeability was also regulated by OCLN peptide in addition to its attenuation of LPS-induced tissue damage and inflammation, we measured total protein levels in BALF. Lung permeability increases when the alveolar–capillary barrier is disrupted, leading to leakage of plasma proteins such as albumin into the alveolar space and resulting in elevated BALF protein concentrations as indicators of pulmonary vascular leakage [21,22]. While LPS-induced increases in total protein levels were statistically reduced by OCLN peptide treatment, mutant OCLN peptide had no significant effect (Fig. 7E). These results indicate that the LPS-increased lung permeability can be effectively regulated by OCLN peptide. Given that LPS-induced cytotoxicity is often associated with mtROS production [19,20], we evaluated mitochondrial ROS levels in lung tissue (Fig. 7F). LPS treatment statistically increased mtROS production in a time-dependent manner, leading to lung inflammation. Notably, WT OCLN peptide significantly inhibited LPS-induced mtROS production, whereas mut OCLN peptide had no significant effect. These findings suggest that WT OCLN peptide exerts a protective effect against LPS-induced lung inflammation and lung damage, potentially through its anti-inflammatory and antioxidative properties.

Fig. 7.

The inhibitory effect of occludin peptide on LPS-induced airway inflammatory responses in vivo

(A) A schematic representation of the experimental timeline for LPS and peptide administration was provided. (B) The body weight was measured for the duration of LPS administration (5 days). (C) After 5 days, the gene expression and the concentrations of IL-1β, IL-6, IL-8, and TNF-α in the lung and BALF were measured using qPCR (left panel) and specific ELISAs. ∗p < 0.05 compared with saline-treated mice; ∗∗p < 0.05 compared with LPS-treated mice; ∗∗∗p < 0.05 compared with LPS- and WT occludin peptide-treated mice. (D) After the lung were harvested, hematoxylin and eosin (H&E), PAS, and Iba1 staining were performed on the tissue sections from the treated mice ( × 400). Indicated scale bars were 100 μm. (E) Total protein levels in BALF were quantified using a BCA protein assay kit. (F) After mitochondria from the lung was isolated, the mitochondria lysates were used for mtROS measurement. ∗p < 0.05 compared with saline-treated mice; ∗∗p < 0.05 compared with LPS-treated mice; ∗∗∗p < 0.05 compared with LPS- and WT occludin peptide-treated mice. All data shown are representative of three independent experiments.

3.8. OCLN peptide attenuates LPS-induced airway inflammation by regulating immune cells populations and M1/M2 macrophage polarization

To determine whether the OCLN peptide influences immune cell populations in LPS-treated BALF, we analyzed the immune cells by flow cytometry, including T cells, B cells, neutrophils, monocytes, and alveolar macrophages (AMs). LPS treatment statistically increased the percentage of CD3⁺ T cells in the BALF, while WT OCLN peptide treatment reduced T cell levels to near normal (Fig. 8B), but not mut peptide. In contrast, no significant differences were observed in B cell populations between LPS-only and WT OCLN peptide-treated mice (Fig. 8A), suggesting that B cells may directly recognize LPS via TLR4 and primarily respond through antibody production, requiring additional co-stimulatory signals for full activation. LPS also led to a substantial increase in neutrophils and AMs (Fig. 8D and F, respectively). These elevations were statistically attenuated by WT OCLN peptide, while mut OCLN peptide showed higher levels of these immune cells compared to WT OCLN-treated mice. To further examine the impact of OCLN peptide on alveolar macrophage polarization, we evaluated the proportions of M1 and M2 AMs in the BALF following LPS treatment (Fig. 8G–I). The CD170⁺CD86⁺ M1 AM population was increased by LPS and decreased by the OCLD peptide. In contrast, the CD170⁺CD206⁺ M2 AM population showed an opposite pattern and was increased by WT OCLN (Fig. 8H). Importantly, the M1/M2 AM ratio was increased in LPS and mut OCLN-treated groups compared to normal control, but showed a pronounced decrease in the WT OCLN-treated group (Fig. 8I), indicating a shift toward anti-inflammatory M2 AM polarization. This shift suggests that WT OCLN peptide can suppress pro-inflammatory M1 AM polarization while enhancing M2 AM polarization, contributing to the resolution of inflammation. Collectively, these findings suggest that WT OCLN peptide mitigates LPS-induced lung damage and inflammation by modulating immune cell populations and promoting immune homeostasis. This supports its potential as a therapeutic agent in controlling airway inflammation.

Fig. 8.

Occludin peptide dramatically increases M2 marker proteins to regulate M1/M2 AM polarization.

Flow cytometry analysis to determine the populations of immune cells in mice administered LPS and OCLN peptide. After LPS administration (5 mg/kg) for five days into the airway of mice that were injected 24 h prior to either the wild type OCLN peptide or the mutant OCLN peptide (5 mg/kg, respectively, i.t.), BALF were harvested. (A,B) To identify lymphocytes, CD19⁺ B cells or CD3⁺ T cells were analyzed by flow cytometry. Data for each cell phenotype are displayed as the percentages of CD19⁺ or CD3⁺ cells. (D) The neutrophils were identified as Ly6G + CD11b+. Data are displayed as the percentages of neutrophil in CD45⁺ cells. (E,F) Flow cytometry of alveolar macrophage (F4/80+CD170+) expression in CD45⁺ cells is shown. Data for each cell phenotype are displayed as the percentages of monocytes. (G,H) Subpopulations of two types of AMs identified as CD170+CD86⁺ (M1) and CD170+CD206+ (M2) in CD45⁺ cells. Data for each cell phenotype are displayed as the percentages of M1-and M2-macrophages in CD45⁺ cells. (I) The M1/M2 ratio was calculated based on the percentage of CD170+CD86⁺ cells and CD170+CD206+ cells in CD45⁺ cells. ∗p < 0.05 compared with saline-treated mice; ∗∗p < 0.05 compared with LPS-treated mice; ∗∗∗p < 0.05 compared with LPS- and WT OCLN peptide-treated mice. All data shown are representative of three independent experiments.

4. Discussion

Occludin is a key integral membrane protein located at TJs that plays physiological functions in maintaining the integrity and selective permeability of epithelial and endothelial barriers [23]. In this study, we demonstrated that occludin expression is significantly reduced in response to LPS-induced airway inflammation in the respiratory track, which suggests a potential mechanism by which barrier function is compromised under pathological conditions. Previous studies have established that occludin is not only structural but is also involved in signaling pathways that regulate TJ assembly and barrier permeability [24,25]. In addition, occludin phosphorylation has been linked to the dynamic regulation of paracellular permeability in response to various stimuli [7]. In this study, we suggest that occludin plays a pivotal role in modulating airway inflammation, particularly in the context of LPS-induced lung injury. Our findings establish a strong correlation between reduced occludin expression and inflammation in human lung tissues (Fig. 1), and further explore the molecular and cellular mechanisms by which occludin and its C-terminal-derived peptide exert protective effects against inflammatory responses.

Immunohistochemical analysis revealed that occludin expression is statistically reduced in inflamed human lung tissues compared to normal or hyperplastic tissues, consistent with previous reports showing tight junction disruption in inflamed epithelial barriers [7,26]. This suggests that occludin loss is not merely a consequence but may be a contributor to the progression of inflammatory lung diseases. In vitro studies using BEAS-2B airway epithelial cells further support this hypothesis. LPS stimulation downregulated occludin expression and induced IL-8 secretion, F-actin formation, and disruption of tight junction integrity—all hallmark features of an inflammatory microenvironment (Fig. 2) [27,28]. Remarkably, occludin overexpression reversed these effects, indicating its protective functions in preserving airway epithelial barrier function and mitigating inflammation [25].

We further identified that the C-terminal domain of occludin has indispensable anti-inflammatory functions. Deletion of the C-terminal region abolished occludin's ability to suppress IL-8 production, restore TEER, and reduce F-actin formation in response to LPS (Fig. 3). This is in line with earlier studies demonstrating the importance of the occludin C-terminal domain in tight junction stability and signaling as follows: 1) The structural integrity of tight junctions (TJs) is critically dependent on the interaction between transmembrane TJ proteins and cytoplasmic scaffolding molecules. The C-terminal cytoplasmic domain of occludin plays a pivotal role in this process by directly binding to ZO proteins. These interactions facilitate the anchoring of occludin to the actin cytoskeleton, thereby stabilizing the tight junction complex and maintaining epithelial and endothelial barrier functions [29,30]. 2) The occludin C-terminus and ZO protein complex also facilitates signal transduction events that regulate junctional dynamics. The scaffolding provided by ZO proteins enables occludin to integrate into the larger tight junction multiprotein complex, coordinating cytoskeletal organization and paracellular permeability [31]. Thus, the C-terminus of occludin not only serves as a physical tether but also functions as a regulatory interface within the tight junction architecture. 3) Phosphorylation of the C-terminal domain of occludin plays critical roles in the dynamic regulation of TJ assembly and barrier permeability. The C-terminus contains multiple serine, threonine, and tyrosine residues that undergo phosphorylation in response to a variety of physiological and pathological stimuli [32,33]. These post-translational modifications regulate occludin's localization at the TJ, protein-protein interaction with scaffold proteins, and its stability at the epithelial membrane. In addition, VEGF-induced tyrosine phosphorylation of occludin at its C-terminal domain contributes to increased vascular permeability, especially in pathological conditions like diabetic retinopathy and inflammation [34], suggesting that occludin phosphorylation is implicated in signal transduction pathways respond to extracellular cues such as cytokines, growth factors, and oxidative stress. Lastly, beyond its structural role in maintaining TJ integrity, the C-terminal domain of occludin is increasingly recognized as a key mediator in intracellular signaling pathways. This highly conserved cytoplasmic region serves as a platform for interaction with a variety of signaling molecules, thereby linking TJ dynamics to broader cellular processes such as proliferation, apoptosis, and inflammatory responses [35,36]. The C-terminus of occludin has been shown to interact with protein kinases, phosphatases, and adaptor proteins, which modulate signal transduction cascades in response to extracellular stimuli. For instance, occludin can recruit and activate PI3K and protein kinase B (Akt) pathways, contributing to cell survival and proliferation, particularly in endothelial and epithelial cells [37]. Moreover, the C-terminal domain is implicated in the regulation of mitogen-activated protein kinase (MAPK) signaling, affecting gene expression and tight junction remodeling under stress conditions [38]. Based on these findings, we developed a cell-permeable peptide derived from the C-terminal domain of occludin. This peptide (pepWT OCLN) not only restored tight junction integrity and reduced IL-8 expression in vitro but also conferred robust protection in vivo in a murine model of LPS-induced airway inflammation (Fig. 4).

This study provides mechanistic evidence that occludin functions as a key attenuator of LPS-induced inflammatory cascades at both the transcriptional and cellular levels. Transcriptomic profiling revealed that loss of occludin amplified pro-inflammatory gene expression, particularly that associated with autoimmunity, inflammasomes, and cytokine/chemokine signaling (Fig. 5). Network analysis positioned canonical mediators, including TNF, IL-6, CXCL2, CXCL8, and CCL2, as central hubs with increased interconnectivity under occludin knockdown, underscoring the potentiation of pulmonary inflammatory in the absence of occludin. Conversely, overexpression of wild-type occludin attenuated these responses, suggesting that occludin imposes a negative regulatory constraint on LPS-induced signaling networks in the airway.

At the functional level, we demonstrated that wild-type occludin peptide exerted a selective inhibitory effect on the MAPK pathway by suppressing p38 phosphorylation (Fig. 6A), while NF-κB activation was unaffected. This selective modulation indicates that occludin's anti-inflammatory action is pathway-specific rather than generally suppressive. Importantly, wild-type occludin peptide preserved mitochondrial integrity by reducing Drp1 phosphorylation and limiting excessive mitochondrial fission. Restoration of MitoTracker fluorescence and attenuation of phospho-Drp1 accumulation collectively suggest that occludin safeguards mitochondrial dynamics during endotoxin stress. Furthermore, occludin peptide prevented LPS-induced mitochondrial ROS overproduction and rescued epithelial cytotoxicity, thereby disrupting the positive feedback loop linking mitochondrial dysfunction to inflammatory amplification. Taken together, these findings support a dual role of occludin as both a structural component of epithelial junctions and a molecular modulator of intracellular signaling. By preventing transcriptional activation of inflammatory pathways and simultaneously preserving mitochondrial homeostasis, occludin serves as a checkpoint against uncontrolled cytokine and mtROS-driven injury. The lack of protective activity by mutant peptides further underscores the requirement for intact occludin–PDZ interactions in mediating these effects.

In vivo, pretreatment with the wild-type OCLN peptide improved survival, reduced pro-inflammatory cytokines (IL-1β, IL-6, IL-8, and TNF-α), and attenuated lung tissue damage, goblet cell hyperplasia, and oxidative stress. These results strongly suggest that the C-terminal-derived occludin peptide acts via specific molecular interactions to exert its protective functions [8,9]. Mechanistically, we found that OCLN peptide treatment not only modulated epithelial responses but also influenced immune regulation in the lung (Fig. 7C and D, and 8). Flow cytometric analysis revealed that the peptide restored T cell populations, reduced myeloid cell infiltration, and activated AM polarization toward an anti-inflammatory M2 phenotype (Fig. 8). This is particularly significant, as dysregulated immune cell responses and imbalanced M1/M2 AM polarization are key drivers of chronic inflammation and lung damage in airway diseases [39,40]. Taken together, our finding suggests that a multifaceted role for occludin in regulating epithelial and immune responses during LPS-induced airway inflammation. The C-terminal domain of occludin appears to be a functional hub responsible for preserving barrier integrity and modulating inflammatory signaling. The therapeutic peptide derived from this domain offers a promising strategy to mitigate acute and potentially chronic airway inflammation, such as that observed in diseases like COPD, asthma, or ARDS [[41], [42], [43]]. Future studies should examine the long-term efficacy, pharmacokinetics, and safety profile of the OCLN peptide in chronic inflammation models and investigate its potential synergy with existing anti-inflammatory therapies. Additionally, elucidating the downstream signaling cascades influenced by the occludin C-terminal domain could provide deeper insights into its immunoregulatory functions.

5. Conclusion

From a translational standpoint, the capacity of occludin-derived peptides to attenuate LPS-induced cytotoxicity underscores their potential as therapeutic agents in pathological states defined by barrier dysfunction and mitochondrial perturbation in lung injury. Rigorous in vivo investigations will be required to delineate their efficacy in modulating host inflammatory responses under clinically relevant conditions and to establish their utility as a novel class of barrier-stabilizing interventions. In conclusion, this study highlights occludin, particularly its C-terminal region, as a critical regulator of airway inflammation and a promising therapeutic target. The development of occludin-based peptides provides new avenues for treating inflammatory lung diseases by preserving epithelial integrity and restoring immune balance.

CRediT authorship contribution statement

Hyun-Chae Lee: Conceptualization, Investigation, Writing – original draft. Jeongtae Kim: Conceptualization, Data curation, Investigation, Visualization, Writing – original draft. Hye Min Jeong: Formal analysis, Investigation, Methodology. Jaewon Shim: Investigation, Supervision, Validation. Tae-Jin Lee: Conceptualization, Supervision, Validation. Sangwook Lim: Software, Validation, Visualization. Suk Won Chang: Methodology, Visualization. Kyoung Seob Song: Conceptualization, Data curation, Funding acquisition, Supervision, Validation, Writing – original draft.

Declaration of competing interest

The authors have no known competing financial interests or personal relationships to declare that could have influenced the work reported in this manuscript.

Appendix A. Supplementary data

The following is the supplementary data to this article:

Supplement Fig. 1

Mitochondrial mass was analyzed using MitoTracker Green FM staining.

The mitochondria morphology was stained using MitoTracker® Green FM and visualized. BEAS-2b cells were cultured on a coverslip inside a culture dish filled with the media. When the cells reached the desired confluency, the media was removed and 500 nM of MitoTracker® Green FM (Thermo Fisher Scientific) were added to visualize the mitochondrial network. The mixture was incubated for 15 ∼ 45 min at 37 °C. After the staining was completed, the staining solution was replaced with fresh media, and the mitochondrial morphology was observed using fluorescence microscopy.

Data availability

Sequencing data have been deposited and publicly available in Gene Expression Omnibus (GEO) under accession number GSE312390.

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312390.

All data generated or analyzed during this study are included in the manuscript and supporting files; source data files have been provided for Fig. 5.