Abstract
Background
Spinal cord injury (SCI) triggers a rapid and sustained cascade of secondary damage, with glutamate (Glu) excitotoxicity recognized as a central mechanism driving neuronal death and functional decline. Despite extensive research, no effective therapy targeting excitotoxicity, and no neuroprotective treatment in general, is currently available. This highlights the urgent need for novel and effective therapeutic strategies for managing SCI.
Methods
We developed a combined blood-glutamate scavenging (cBGS) therapeutic platform comprising two recombinant enzymes (rGOT1 and rGPT1), their respective co-substrates (oxaloacetate and pyruvate), and the cofactor pyridoxal phosphate (PLP). The efficacy of cBGS was evaluated in mouse and rat models of moderate-to-severe spinal cord compression and contusion injury. Glutamate concentrations were quantified in blood and cerebrospinal fluid (CSF), while histological and functional outcomes were assessed from 1 day to 7 weeks post-injury to determine neuroprotective efficacy.
Results
Systemic cBGS administration significantly reduced Glu concentrations in both blood and CSF, leading to a marked reduction in apoptosis, neuroinflammation, demyelination, and glial scarring, while promoting neuronal and axonal survival. Treated animals demonstrated substantial locomotor recovery, up to 80% improvement in performance. Notably, cBGS remained effective when administered up to eight hours post-injury, indicating a clinically relevant therapeutic window and excellent safety profile. Core findings were independently validated in a rat severe compression model performed by an external Contract Research Organization (CRO).
Conclusions
The cBGS platform represents a first-in-class systemic neuroprotective therapy that effectively mitigates glutamate excitotoxicity and secondary injury following SCI. Its robust efficacy, wide therapeutic window, and favorable safety profile support its strong potential for clinical translation in acute SCI and other excitotoxicity-driven neurotrauma conditions, where no effective treatments currently exist.
Supplementary Information
The online version contains supplementary material available at 10.1186/s41232-026-00411-x.
Keywords: Spinal cord injury, Glutamate, Excitotoxicity, Neuroprotection, Emergency treatment, Translational research
Introduction
Spinal cord injury (SCI) is a major cause of long-term disability, predominantly affecting young adults and imposing a substantial personal and socioeconomic burden [1]. Moreover, SCI represents a substantial financial burden for society, with estimates of approximately $2.35 million for the lifetime management of each SCI patient [2]. Despite advances in acute care, including early surgical decompression, no pharmacological therapy currently provides robust functional recovery after SCI [3, 4]. This underscores a critical unmet need for interventions that limit secondary injury processes initiated immediately after trauma.
The pathophysiology of SCI is multifaceted and includes primary and secondary events [5, 6]. A key driver of secondary injury following SCI is glutamate-mediated excitotoxicity. Within minutes of injury, extracellular glutamate levels rise sharply in the spinal cord, triggering overactivation of NMDA and AMPA receptors, calcium overload, mitochondrial dysfunction, and downstream apoptotic and inflammatory cascades [7, 8]. Elevated glutamate concentrations have been consistently reported in experimental SCI models during the acute phase and are strongly associated with neuronal loss and long-term neurological deficits [9, 10]. Once initiated, this excitotoxic cascade rapidly amplifies tissue damage, making early intervention essential. We recently reported a substantial increase, up to 300%, in Glu levels in the cerebrospinal fluid (CSF) 29 h post-spinal cord injury in a murine hemisection model [11].
Today, it is well recognized that glutamate balance in neurotrauma is a complex process, regulated by multiple interacting pathways [12–14]. Furthermore, astrocytes, which play a central role in maintaining glutamate homeostasis in the CNS mainly by re-uptaking it, contribute to injury-related excitotoxicity by releasing additional glutamate due to elevated intracellular Ca2+ levels [15–18]. However, previous neuroprotective drug development efforts have largely focused on blocking glutamate receptors or reducing neuronal glutamate release, approaches that have shown limited or no clinical efficacy and significant safety concerns, while failing to address impaired astrocytic glutamate uptake or injury-induced reverse glutamate release [19–21].
More recently, riluzole—a sodium channel blocker approved for the treatment of amyotrophic lateral sclerosis—has been shown to partially attenuate excitotoxicity by inhibiting presynaptic glutamate release and modulating persistent sodium currents, with in vitro studies also suggesting effects on glutamate uptake [22, 23]. Similar to previous neuroprotective approaches, Riluzole primarily targets neuronal glutamate release and does not address glutamate accumulation resulting from impaired clearance or non-neuronal sources, which may have contributed to its limited efficacy observed in Phase III clinical trials in patients with acute spinal cord injury [24, 25].
Astrocytic transporters mediate the majority of glutamate uptake in the CNS; however, endothelial cells of the blood–brain barrier also express EAAT 1–3 transporters that contribute to glutamate balance [26–29]. Under excitotoxic conditions, when astrocytic reuptake is impaired, endothelial EAATs facilitate the brain-to-blood efflux [27, 29]of glutamate. Glial cells associated with the BBB further support this process by transferring excess glutamate to endothelial cells, together forming a coordinated glia–endothelial clearance mechanism that limits extracellular glutamate accumulation during neurotrauma [30, 31].
The brain-to-blood efflux of glutamate can be intensified by increasing the concentration gradient between the CNS and the blood [32, 33]. To this end, we investigated a combined blood glutamate scavenging (cBGS) strategy designed to lower plasma glutamate levels and thereby amplify endogenous brain-to-blood glutamate efflux. (Fig. 1).
Fig. 1.
Scheme showing the Mechanism of action of combined blood glutamate scavenging treatment in spinal cord injury. The left panel illustrates the pathological glutamate excitotoxicity cascade following spinal cord injury. Excessive glutamate (Glu) accumulation in the synaptic cleft and extracellular space activates AMPA and NMDA receptors, leading to calcium influx and neuronal injury. Impaired EAAT1/2 transporter function in astrocytes and reverse transport from neurons exacerbate Glu accumulation. The elevated Glu concentration in both cerebrospinal fluid (CSF) and blood disrupts Glu homeostasis due to facilitated bidirectional transport (EAAT1-3) across the compromised blood–spinal cord barrier. The right panel depicts the effect of cBGS treatment, which involves intravenous administration of recombinant rGOT1 and rGPT1 enzymes together with their co-substrates (oxaloacetate and pyruvate) and co-factor (PLP). This enzymatic system reduces the peripheral Glu concentration, generating a concentration gradient that promotes brain-to-blood Glu efflux. The resulting normalization of Glu in the CSF restores synaptic balance and minimizes excitotoxicity. Treatment with cBGS reduces the concentration of Glu in the blood and CSF to ~ 20 µM and ~ 10–15 µM (near physiological level), respectively. Restoring Glu-mediated transport and suppressing excitotoxic receptor activation support neuronal survival and functional recovery
Here, we address a critical and previously underexploited therapeutic gap: whether enhancing physiological glutamate clearance from the CNS, rather than blocking glutamate signaling, can provide effective neuroprotection after SCI. By reducing total free glutamate independently of its cellular source and without directly interfering with synaptic transmission, cBGS represents a fundamentally different approach from prior glutamate-targeted therapies. We test the hypothesis that cBGS can attenuate glutamate-driven excitotoxicity and improve neurological outcomes in clinically relevant models of SCI. Our findings support the development of cBGS as a first-in-class, systemic therapeutic strategy for acute neurotrauma.
Material and methods
Sex as a biological variable
Our study examined male and female animals, and similar findings are reported for both sexes.
Mice
Adult (3–6 months) TgN (Thy1-EYFP) or their Bl6/C57 WT littermates were used. We routinely raise and genotype these mice in our lab. TgN (Thy1-EYFP) transgenic mice: mouse strain expressing neuron-specific yellow fluorescent protein (YFP) under the control of the Thy1 promoter. In this model, YFP is expressed in motor neurons of the cortex and in the corticospinal tract (CST) projections within the spinal cord, as well as in sensory neurons ascending from the dorsal root ganglia within the spinal white matter tracts. Additional Thy1-driven expression is observed in cervical ganglia, cortical layers II–VI, and the cerebellum. The Tel-Aviv University Animal Ethics Committee approved all procedures following the requirements of the National Health and Medical Research Council of Israel (Approval number 01–20-001).
Rats
The study included 24 female Sprague–Dawley rats, weighing 200–220 g. obtained from Harlan Laboratories (Israel). Females were nulliparous and non-pregnant. Each animal was tagged with a unique ear tag, and each cage was marked with a corresponding cage card, as per SOP-06–004, “Animal Identification”. Animals were handled in accordance with NIH guidelines. This includes housing in pairs, in solid-bottom polysulfone ventilated cages (IVCs) lined with bedding material in dedicated HVAC (heat, ventilation, air conditioning) in the SPF animal facility of VIVOX CRO, equipped with a pressurized climatic system (22 ± 3 °C and 50 ± 20% humidity). 22 ± 3 °C and 50 ± 20%. The facility had no exposure to outside light and was maintained on automatic alternating light cycles of 12L:12D. Water and commercial rodent food were supplied ad libitum throughout the acclimation and study periods.
rGOT1 and rGPT1
As previously described, His-tagged recombinant rat glutamate–oxaloacetate transaminase (rGOT1) cDNA was cloned from the human hepatoma cell line hepG2, expressed in Escherichia coli, and purified by Ni-agarose chromatography 58. Human rGPT1 enzyme was purchased from Abcam (ab206804). The baseline enzymatic activity (20 mg/ml enzyme in buffer) was assessed using a Reflotron automatic analyzer (Roche) with specific pre-coated test strips (10,745,120, 10,749,247, Roche). Increasing concentrations (10–50 µM) of pyridoxal 5′-phosphate (PLP, Sigma P9244) were titrated in to optimize performance.
In-vitro pharmacodynamic experiments
Adult male Sprague–Dawley rats, 250–300 g. were anesthetized, and 1 mL/rat of blood was collected from the left ventricle using 1 M tri-sodium citrate–dihydrate (pH 7.5) as an anticoagulant. Blood (1 mL/tube) was assigned to six groups: (1) untreated control, (2) rGOT1 (5 nM) + PLP (500 µM), (3) OxAc + rGOT1 (5 nM) + PLP (500 µM), (4) rGPT1 (8 µg/mL) + PLP (500 µM), (5) GPT + PLP (500 µM), and (6) pyruvic acid (0.2 mM) + rGPT (8 µg/mL) + PLP (500 µM). Reagents were prepared fresh: pyruvic acid (20 mM, ddH₂O), rGPT1 (600 µg/mL, PBS), citrate (1 M, ddH₂O), and rGOT1 (500 nM, 1:97 dilution, ddH₂O). Samples were incubated at 37 °C with agitation (100 rpm) for 30 min, and 150 µL aliquots were collected at 0, 15, and 30 min, treated with 1 M perchloric acid, centrifuged (14,000 × g, 10 min), and neutralized with 2 M K₂CO₃. Glutamate levels in the supernatant were quantified using a fluorometric glutamate assay (standard curve R2 = 0.9941) as described previously (refs).
Blood-glutamate scavenging experiment in-vitro
Blood was collected intracardially from naïve mice, and 5 µl of 5,000 U heparin was added to prevent blood coagulation. Glutamate concentration in the blood was increased to ± 250 µM by adding 30 µl of 1.5 mM glutamic acid solution to 270 µl of blood to imitate the rise in glutamate levels after SCI. Aliquots of the blood with glutamate (300 µl) were prepared, and various reagents were added: (1) 4.5 µg rGOT1 + OxAc 0.03 M (Sigma 4126); (2) 75 µg rGPT1 + Pyruvate 0.03 M; (3) rGOT1 + OxAc + rGPT1 + Pyr + PLP 0.08 µM (combined treatment). The blood samples (triplicates) were incubated in the shaker/incubator at 37 °C for up to 90 min. Glutamate levels were measured by HPLC.
Spinal cord injury moderate/severe compression model in mice
All mice were anesthetized by intraperitoneal injections (i.p.) of ketamine (60 mg/kg) and xylazine (10 mg/kg). We used a well-established blood-vessel clip compression model (AS Medizintechnik GmbH, Germany) to induce a compression injury by applying a closing force of 10 g and a 1 mm width. The laminal arches of the vertebrae at the T9-T11 level were removed, and the exposed dura mater was subjected to compression by a blood vessel clip for 5 s at the level of T10. For a sham procedure, the laminal arch of the vertebrates at the same thoracic level was removed without spinal cord injury.
Spinal cord injury severe contusion model in mice
All mice were anesthetized by intraperitoneal ketamine injections (60 mg/kg) and xylazine (10 mg/kg). The spinal cord tissue was exposed at the level of T9-T11, and the exposed dura mater was subjected to a severe contusive SCI on both sides of the spinal cord at the level of T10. Mice were attached to a stereotactic device of the impactor (RWD 68099 Precision Impactor Device) to hold the body stationary, and the spinal cord was exposed and aligned to the impact device to the desired location. The impact device (2 mm wide) was placed over the exposed spinal cord. The injury was induced with a specific depression of 1 mm depth, velocity 3 m/s, and dwell time 0.5.
Spinal cord injury severe compression model in rats
Rats were anesthetized with isoflurane (RWD system) and given subcutaneous buprenorphine LA (0.13 mg/200 g) for analgesia. After aseptic preparation, a T10 laminectomy was performed, and epidural lidocaine (0.1 mL of 0.5%) was applied. The spinal cord was gently elevated and compressed for 5 s using a vascular clip (50 g force) to induce injury. Wounds were closed in layers, treated with topical antibiotic ointment, and animals received 3 mL of saline for hydration. Postoperatively, rats were kept in a temperature-controlled chamber until full recovery.
Treatment protocols
Mice were randomly assigned to sham, vehicle-control, or treatment groups. Treated animals received either rGOT1 + OxAc + PLP or a combined formulation of rGOT1 + OxAc + rGPT1 + Pyr + PLP. Treatments were administered intravenously at 1-, 4-, or 8-h post-injury (1 mg/kg rGOT1 + 0.03 M OxAc, or 30 µg rGOT1 + 0.03 M OxAc + 1 mg/kg rGPT1 + 0.03 M Pyr + 0.08 µM PLP in 200 µL 0.9% saline, pH 6–7). Daily intraperitoneal injections of the same dose continued for four days or as specified. Vehicle groups received saline under identical conditions, and naïve mice were included for CSF glutamate measurement. OxAc and Pyr pH were adjusted with 0.5 M NaOH. Dosages were based on prior dose–response studies for rGOT1/OxAc and in vitro optimization for rGPT1/Pyr.
CRO validation experiment in rats
The external CRO study was conducted using a randomized and blinded experimental design. Animals were randomly assigned to treatment groups by personnel independent of the outcome assessment. Investigators responsible for surgical procedures, data acquisition, and outcome analyses were blinded to treatment allocation throughout the study. The experimental protocols used by the CRO were fully harmonized with the in-house studies. This included the same spinal cord injury model, injury severity, treatment regimen (dose, route, and timing of administration), post-operative care, outcome measures, and predefined inclusion and exclusion criteria. Prior to the initiation of the study, protocols were jointly reviewed and finalized to ensure consistency across all sites.
Treatment protocol in rats
The test and control formulations were prepared at the test facility immediately prior to dosing. Briefly, 60 mg of OxAc and 50 mg of pyruvate powders were dissolved in 15 mL of 0.9% NaCl to achieve a final concentration of 0.03 M for each compound. The pH was adjusted to 5.5–6.0 by adding 205 μL of 5 M NaOH. Recombinant GOT1 (81.25 µL) and rGPT1 (325 µL pre‑complexed with PLP) were added to 13 mL of OxAc/pyruvate solution. Each animal received an intravenous injection of 2 mL of the final formulation (0.03 M OxAc, 0.03 M pyruvate in 0.9% NaCl) containing 12.5 µL rGOT1 (2 mg/kg) and 50 µL GPT1 (4 mg/kg). The solution was kept on ice and administered daily within 1 h of preparation, for five consecutive days. The control group was injected with 2 mL of 0.9% NaCl.
Enzyme activity assay
Blood was collected from a submandibular vein into tubes containing 2 μL heparin. The tubes were centrifuged at + 4 °C and 16,000 g for 5 min, and the plasma was then separated and used immediately or stored at −80 °C. GOT1 and GPT1 levels and assessed using a Reflotron automatic analyzer (Roche) with specific pre-coated test strips (10,745,120, 10,749,247, Roche).
CSF sampling and analysis
CSF samples were collected by glass capillary from the cisterna magna of mice under isoflurane anesthesia at 28 h post-injury, (4 h after the second daily treatment). Glutamate levels were analyzed by reaction with o-phthalaldehyde (OPA) and separation on reversed-phase HPLC with a scanning fluorescence detector as previously described [34].
qPCR analysis of spinal cord tissue
Animals were transcardially perfused with ice-cold PBS, the spinal cord was exposed at the area of the lesion site, and the tissue (1 mm from each side of the lesion center) was dissected with a micro-knife, snap-frozen in liquid nitrogen, and stored at − 80 °C until use. Levels of Cx3cR1, TNF-α, IL-1β, IL-6, and IL-10 expression were analyzed using qPCR (qPCR Thermal Cycler, Quantabio). The RNA was extracted using the RNA Mini-Prep PLUS kit (Zymogen) and then reverse-transcribed into cDNA using the Qscript Reverse Transcription System kit (QuantaBio). Samples were analyzed in triplicate using an RT-PCR system (QuantStudio, Applied Biosystems) and quantified by the ΔΔCt method against an internal control gene, GAPDH.
Real-time PCR primers:
| Gene | Forward | Reverse |
|---|---|---|
| GAPDH | CCAGAACATCATCCCTGC | GGAAGGCCATGCCAGTGAGC |
| IL-1β | ACCCCAAAAGATGAAGGG CT | GATACTGCCTGCCTGAAGCT |
| IL-6 | GTCTCTACCACTTCACAAGTC | TGCATCATCGTTCATAC |
| TNF-α | GGTGCCTATGTCTCAGCCTCTT | GCCATAGAACTGATGAGAGGGAG |
| IL-10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| Cx3cr1 | CAGCATCGACCGGTACCTT | GCTGCACTGTCCGGTTGTT |
Immunohistochemistry
Mice were perfused with PBS followed by 4% paraformaldehyde (PFA). Spinal cords were removed and post-fixed for 1 h in cold 4% PFA, followed by 20% sucrose in PBS overnight at 4 °C. Cryostat longitudinal floating Sects. (60 µm) of fixed frozen tissue were stained using standard immunohistochemistry. Primary antibodies: rabbit anti-glial fibrillary acidic protein (GFAP; 1:1000, Dako); rabbit anti-Iba1 (1:500; Abcam); mouse anti-NeuN (1:1000; Millipore); rabbit anti-myelin basic protein (MBP; 1:500, Abcam); mouse Anti-active Caspase-3 (1:500, Abcam); Rabbit anti-Synaptophysin (1:1000, Abcam); and mouse anti-CS56 (1:2500, Abcam). Secondary antibodies: Alexa Fluor 488 or 568; 1:1000 (Invitrogen). Nuclei were visualized with DAPI (Sigma). DAPI staining was used to define the edge of the lesion, which was confirmed by GFAP immunostaining. Sections were visualized by an Olympus IX83 fluorescence microscope with CellSens Dimension software. Images were processed by ImageJ blindly.
Lysate preparation and immunoblot
Animals were perfused transcardially with ice-cold PBS, and spinal cord tissue (1 mm on each side of the lesion center) was dissected and homogenized in lysis buffer using a Polytron homogenizer (Kinematica, USA). Protein concentration was determined by the Bradford assay (Bio-Rad). Equal protein amounts were separated on 10% SDS-PAGE gels and transferred to nitrocellulose membranes. Membranes were blocked and probed with rabbit anti–cleaved caspase-3 (1:1000; Cell Signaling) and mouse anti–β-actin (1:10,000; MP Biomedicals), followed by HRP-conjugated secondary antibodies. Bands were visualized by chemiluminescence and quantified by densitometry using ImageJ software.
Horizontal grid walking test
Walking on a wire grid (1.2 × 1.2–cm grid spaces, 35 × 45–cm total area) was tested at intervals up to 4 weeks after SCI until a plateau was reached. Each mouse was tested for 3 min of free walking on the grid, and the total number of steps was counted. If a hindlimb paw (toe and heel) slipped through the grid, it was counted as a 1-foot miss. The results were expressed as the number of correct footsteps (total number of steps—missteps) as a percentage of the total number of steps taken during 3 min of free walking. The test was scored double blind by two independent examiners.
Basso Mouse Scale (BMS)
Mice were tested for functional deficits in the hindlimbs at periods up to 4 weeks after SCI, until a plateau was reached. Hindlimb locomotor recovery was assessed in an open field, where a score of 0 indicates complete paralysis and 10 indicates normal movement of the hindlimbs, with consistent plantar stepping and stability in locomotion, good weight support, and predominant paw position parallel to the body. Testing was double blind by two independent examiners, and the performance of the left and right hindlimbs was averaged in order to obtain the BMS score 69.
Noldus Catwalk XT—gait analysis system for rodents
Gait was analyzed using the CatWalk XT 10.6 system (Noldus Information Technology). Mice were placed on a darkened platform and encouraged to cross a platform at their maximum speed by gently blowing air onto their backs. Commonly analyzed variables include run duration, run average speed, hindpaw stand duration, hindpaw stride length, regularity index, front paw, and hindpaw base of support. The average of the parameter in three runs was taken.
Urinary retention test
A score of 0 in this test indicates that the mouse can urinate independently; a score of 1 indicates a slight need for assistance and gentle pressure to release urine. A score of 2 signifies a complete inability to urinate independently, requiring full assistance.
Statistical analysis
Primary outcome measures were predefined as lesion volume and functional recovery, while biochemical, histological, and dosing or timing analyses were considered secondary or exploratory outcomes. All statistical analyses were performed using GraphPad Prism (version 10.5.0). Data distribution was assessed using the Kolmogorov–Smirnov normality test, and homogeneity of variance was evaluated using the F test or Brown–Forsythe test, as appropriate. For comparisons among experimental groups, one-way analysis of variance (ANOVA) was used consistently across all experiments. When the assumptions of normality and equal variance were met, one-way ANOVA was followed by Tukey’s multiple-comparisons post hoc test. When data violated assumptions of normality or homogeneity of variance, the Kruskal–Wallis test was applied, followed by Dunn’s post hoc test for multiple comparisons. One-way analysis of variance (ANOVA) was used for group comparisons based on the experimental design, which involved simultaneous comparison of multiple predefined treatment conditions within a single independent factor. The study was conducted within a hypothesis-driven framework informed by our previously published spinal cord injury studies, which used an initial glutamate-scavenging formulation. These studies consistently demonstrated reductions in glutamate levels and tissue damage [11, 34]. This prior evidence informed the biological rationale for expected treatment effects but did not influence statistical directionality; accordingly, all ANOVA analyses were performed using two-tailed testing. Appropriate post hoc multiple-comparisons tests were applied following omnibus analyses, as described above. All statistical tests were two-tailed. Nonlinear relationships between PLP concentration and outcome measures were analyzed using a second-order polynomial nonlinear regression model. Statistical significance was defined as p < 0.05. Exploratory experiments with smaller sample sizes employed highly quantitative analytical methods (e.g., HPLC) and exhibited low inter-sample variability, supporting reliable detection of treatment-related differences. Exact p-values, sample sizes, and statistical tests used are reported in the corresponding figure legends.
Results
The therapeutic advantage of cBGS therapy in reducing plasma glutamate concentrations
To maximize the therapeutic potential of blood-glutamate scavenging, we developed a combination strategy using recombinant glutamate oxaloacetate transaminase 1 (rGOT1) and recombinant glutamate pyruvate transaminase 1 (rGPT1). rGOT1 exhibits high catalytic activity but a short half-life, providing rapid glutamate clearance, whereas rGPT1 has lower enzymatic activity but a more than twofold longer half-life, enabling sustained action. When used together, these complementary properties are expected to produce both immediate and prolonged reductions in blood glutamate levels. The activity of both enzymes depends on their respective co-substrates, oxaloacetate (OxAc) and pyruvate (Pyr), and is further enhanced by pyridoxal 5′-phosphate (PLP), the active form of vitamin B6, which serves as a cofactor for transaminase reactions. This combination was therefore designed to achieve synergistic efficacy, an extended therapeutic window, and a favorable safety profile.
In vitro pharmacodynamic experiments
First, we evaluated the activity of each recombinant enzyme before and after the addition of PLP (up to 500 µM), a cofactor known to enhance transaminase activity, in order to optimize the enzymes' efficacy (Fig. 2A). Using an enzymatic assay with a pre-coated strip for each enzyme, the baseline enzymatic activity, measured by an enzymatic assay with a pre-coated strip was 147 U/L and 100 U/L for rGOT1 and rGPT1, respectively. These rates increased significantly and, in a dose-dependent fashion, when PLP was added (100—400 µM), reaching a maximum of 936 U/L and 805 U/L for rGOT1 and rGPT1, respectively. This significant enhancement (r = 0.9984 and r = 0.9967 for rGOT1 and rGPT1, respectively) demonstrates the crucial role of PLP in optimizing transaminase activity.
Fig. 2.
A In-vitro, the enzymatic activity of each recombinant enzyme was evaluated before and after the addition of cofactor PLP to the stock buffer of each enzyme. Each sample was analyzed in duplicate. The activity was measured using the Reflotron system, and the results were presented as U/L activity for each enzyme separately (rGOT1, r = 0.9984; rGPT1, r = 0.99, mean ± 67). B In vitro time-course analysis of glutamate reduction in naïve rat blood following treatment with rGOT1 or rGPT1, with PLP and without their respective co-substrates. Both rGOT1 + OxAc and rGPT1 + Pyr significantly reduced glutamate levels in naïve rat blood compared to control at 30 min (p = 0.0053 and p = 0.0378, respectively). Two-way ANOVA test. C In vivo time-course analysis of blood glutamate reduction over 48 h following a single intravenous injection of either rGOT1 + OxAc + PLP or rGPT1 + pyruvate + PLP in naïve mice. Glutamate levels were normalized to each animal’s baseline and presented as a ratio over time. Each group included a minimum of n = 3 animals, with *p = 0.0492 at 24 h compared between groups, as indicated. *D In vitro time-course analysis of glutamate reduction in whole blood from naïve mice following treatment with the combined BGS formulation (rGOT1 + rGPT1 + OxAc + Pyr + PLP) versus individual enzyme treatments with their respective co-substrates. Data are presented as mean ± SD from five independent replicates per time point. Statistical significance was determined using one-way ANOVA followed by Tukey’s HSD post hoc test (α = 0.05). cBGS group at all time points was significant that rGPT (5’, p = 0.0004; 15’, p = 0.0281; 30’, p = 0.0156; 45’, p < 0.0001; 60’, p < 0.0001; 90’, p = 0.0016) and rGOT1 (5’, p = 0.0022; 15’, p = 0.0172; 45’, p < 0.0001; 60’, p < 0.0001). E rGOT1 enzymatic activity measured in blood samples 28 h after spinal cord compression injury, corresponding to 4 h post-injection of the second dose of rGOT1 + OxAc (p = 0.0012). F rGPT1 enzymatic activity measured in blood samples 28 h after injury, 4 h after the second administration of rGPT1 + pyruvate + PLP (***p = 0.0005). Data are presented as mean ± SEM (n = 6 mice per group). Statistical analysis was performed using one-way ANOVA followed by Tukey’s HSD post hoc test (α = 0.05)
Next, to maximize the enzymatic activity of the enzymes, we systematically evaluated the glutamate-lowering capacity of each enzyme, both alone and in combination with their respective co-substrates, using naïve rat whole blood ex vivo. Although neither rGOT1 nor rGPT1 reduced glutamate levels significantly alone (p = 0.112 and p = 0.099, respectively, after 30 min), adding the cofactor and PLP (500 µM) resulted in a significant reduction of glutamate levels (Fig. 2B). The combination of rGOT1 + PLP (500 µM) with OxAc reduced glutamate levels by up to 50% (p = 0.0053), while the reduction by rGPT1 + PLP (500 µM) with Pyr, although less dramatic, was also significant (p = 0.0378). In contrast, treatment with rGOT1 (p = 0.112) or rGPT1 (p = 0.099) alone resulted in only modest, non-significant reductions in glutamate levels at the same time point, supporting the importance of combining enzymes with co-substrate.
In the next step, based on the obtained PD data, we evaluated whether incorporating rGPT1, a second glutamate-scavenging enzyme administered together with its co-substrate and cofactor, could, due to its distinct pharmacokinetic properties and potentially longer half-life, produce an additive or prolonged glutamate-lowering effect. This approach aimed to leverage complementary enzymatic pathways to achieve rapid, robust, and prolonged clearance of elevated blood glutamate, conditions that closely model the acute glutamate surge observed in the early hours following spinal cord injury. Each enzyme was administered intravenously in naïve mice, along with its respective co-substrate and the cofactor PLP, and blood glutamate levels were monitored over a 48-h period. The rGPT1 + Pyr + PLP combination exhibited a prolonged effect, maintaining significantly reduced glutamate levels for up to 24 h (p = 0.0492). Moreover, it achieved a greater overall reduction in blood glutamate compared to the rGOT1 + OxAc + PLP group.
Finally, to define the final formulation, the effect of combining the enzymes (rGOT1 + rGPT1 + OxAc + Pyr + PLP) vs. each pair of enzymes with co-substrate and cofactor, was assessed by time-course analysis of naïve mouse blood samples supplemented with 200 µM glutamate, mimicking the elevated levels observed following neurotrauma in humans (Fig. 2D)[^52,^54]. Glutamate levels were significantly reduced in all treatment groups compared to a vehicle control, in which glutamate levels remained unchanged between 0 min (238 ± 8 µM) and 90 min (246 ± 12 µM). The most robust and sustained glutamate reduction across all time points was obtained with the five-component combination termed cBGS. This formulation was significantly stronger at reducing glutamate than the rGPT1 + Pyr + PLP combination at all time points (5’, p = 0.0004; 15’, p = 0.0281; 30’, p = 0.0156; 45’, p < 0.0001; 60’, p < 0.0001; 90’, p = 0.0016) and significantly greater than rGOT1 + OxAc + PLP at 5, 15, 45, and 60 min (p = 0.0022, p = 0.0172, p < 0.0001, p < 0.0001 respectively). The most pronounced reduction of glutamate (60%) was observed within 5 min of administering cBGS.
In contrast, treatment with rGOT1 (p = 0.112) or rGPT1 (p = 0.099) alone resulted in only modest, non-significant reductions in glutamate levels at the same time point, supporting the importance of combining enzymes with co-substrate.
To characterize the long-term PD parameters, the enzyme’s activity was measured 28 h post-SCI and four hours after the second treatment administration. rGOT1 activity was approximately 20-fold higher, and rGPT activity nearly 50-fold higher, compared to vehicle-control animals (Fig. 2E and F; p = 0.0012 and p = 0.0005, respectively).
These findings support the hypothesis that dual-enzyme glutamate scavenging provides a synergistic and highly efficient PD strategy for rapid and sustained reduction of elevated blood glutamate levels. The best results were obtained with the cBGS five-component combination. Therefore, PLP was included in all in vivo combinations of the enzymes with their co-substrates.
cBGS treatment reduces excitotoxicity, increases neuronal survival, and attenuates inflammation following moderate/severe compression SCI
The therapeutic efficacy of cBGS administered post-injury was assessed by its ability to lower glutamate levels in the CNS, as well as by examining neuronal survival and inflammatory response.
In in-vivo experiments, we used Thy1/YFP transgenic mice. A key advantage of this mouse strain is the sparse YFP labeling, which enables the clear visualization of individual axonal projections within the spinal cord’s white matter, allowing for the reliable assessment and quantification of axonal injury or survival at the lesion site. Moderate/severe compression SCI was induced in mice, which were randomly assigned to receive either an intravenous injection of cBGS (rGOT1 + OxAc + PLP + rGPT1 + Pyr) or vehicle 1 h post-injury (Fig. 3A), followed by a second intraperitoneal injection 23 h later. CSF samples were collected 28 h post-injury for glutamate quantification (Fig. 3B). Vehicle-treated SCI mice showed a significant elevation in CSF glutamate compared to naïve controls (p < 0.0001), but this increase was reduced by approximately 80% in mice treated with cBGS.
Fig. 3.
A Experimental design for panels B–L. B CSF glutamate concentrations 28 h post-injury (first injection 1 h post-SCI). p < 0.0001, *p < 0.019 vs. vehicle; n = 4/group. C Western blot of active caspase-3 at 24 h in sham, vehicle (con), and cBGS-treated animals (1 h or 4 h post-SCI). Sham vs control p < 0.0001, Sham vs T1 (cBGS injected 1 h after SCI) p = 0.017, Sham vs T4 (cBGS injected 4 h after SCI) p = 0.0038; con vs T1 p = 0.0042, con vs T4 p = 0.0187; n = 5/group. D Representative NeuN (neurons) and active caspase-3 (apoptosis) staining at 7 days post-SCI; apoptotic neurons indicated by white arrows. Scale bars: 500 μm (overview), 100 μm (high mag). E–F Quantification of NeuN + and active caspase-3/NeuN + cells, p = 0.0181; n = 8/group. G–I Axon (green) and GFAP (red) staining, axon counts, and GFAP density in vehicle, rGOT1 + OxAc + PLP, and cBGS groups. Control vs cBGS p < 0.0001, CON vs rGOT1 p = 0.0014, rGOT1 vs cBGS p = 0.0461; n = 7/group. Scale bar: 200 μm. J–K Axon (green) and Iba1 (red) staining and Iba1 density. CON vs cBGS p = 0.0123, rGOT1 vs cBGS p = 0.0461; n = 8/group. Scale bar: 200 μm. L Experimental design for panel L (M) qPCR of Cx3cr1, IL-1β, IL-6, TNFα, and IL-10 at 1- and 3-days post-SCI in sham, vehicle-control, and cBGS-treated mice after a single injection or after two injections (*p < 0.05, **p < 0.01; n = 4–10/group). All data are mean ± SEM; one-way ANOVA with Tukey’s HSD, α = 0.05
To determine whether this reduction in excitotoxicity is reflected by decreased apoptosis, we quantified active caspase-3 expression at the lesion site 24 h post-injury (Fig. 3C). Immunoblotting revealed significantly lower active caspase-3 levels in cBGS-treated animals, with comparable effects when treatment was initiated at 1 h or 4 h post-injury (p = 0.0042, p = 0.0187, respectively), indicating an extended therapeutic window for efficacy. Even at 7 days post-injury, active caspase-3 immunoreactivity in NeuN-positive neurons remained significantly higher in vehicle-treated controls compared to cBGS-treated mice (p = 0.0181), which also exhibited markedly fewer apoptotic neurons (p = 0.0281, Fig. 3D–F). In addition, cBGS preserved axons to a similar extent to that seen in our previous hemisection model studies with rGOT1 + OxAc + PLP but achieved a significantly greater reduction in glial scarring (p = 0.0379, Fig. 3G–I). This effect was accompanied by attenuated astrocyte (GFAP) and microglia/macrophage (Iba1) reactivity. Iba1 demonstrated a significantly greater reduction with cBGS treatment than rGOT1 + OxAc + PLP alone (p = 0.0461), which presented almost the same values as control (p = 0.0389, Fig. 3I–K). The expression of Cx3cr1 mRNA, a marker of activated microglia/macrophages, shows a trend of elevation in vehicle-treated mice at day 3, but reduced in cBGS-treated animals, particularly in those receiving four injections (p = 0.345, Fig. 3L). This supports the finding that cBGS attenuated microglia activation. Moreover, the anti-inflammatory effect of cBGS was observed in the pro- and anti-inflammatory cytokine profile. One day after the injury, a single cBGS dose significantly reduced IL-1β and IL-6, with a trend toward lower TNFα, while the levels of the anti-inflammatory cytokine, IL-10, remained unchanged at the injury site. By day 3, after four daily treatments, IL-1β and TNFα levels were significantly reduced, whereas IL-6 levels no longer differed between groups (*p < 0.05; **p < 0.01, Fig. 3M). IL10, an anti-inflammatory cytokine shows on the other hand increase in the cBGS treated group, which may suggest a better tissue healing.
To evaluate clinical feasibility, we extended the treatment window to 4 h post-injury. At 1 week post-injury, GFAP expression was significantly lower in the cBGS group compared with controls (61.4 ± 13.5 vs. 40.29 ± 5.11; p = 0.0025, n = 6) and was reduced more effectively than with rGOT1 alone (p = 0.0406). Axonal counts at the lesion site were also significantly higher in cBGS-treated animals compared with controls (27.14 ± 7.2 vs. 39.5 ± 6.75; p = 0.0468, n = 6). These results supported further investigation of an extended therapeutic window.
Combined BGS treatment enhances recovery following severe spinal cord contusion
Because clinically, SCI often involves both contusion and compression, we also evaluated the efficacy of cBGS therapy in a severe contusion model involving an impactor-based injury (Fig. 4A). This model is characterized by extensive neuronal and axonal damage, accompanied by markedly elevated CSF glutamate concentrations at 28 h post-injury, p = 0.0008 (Fig. 4B). All treatments were initiated 4 h post-injury to expand the treatment window. Administration of rGOT1 + OxAc + PLP alone reduced CSF glutamate levels only moderately (control 21.94 ± 3.91 vs rGOT1 15.16 + 2.93 mM; p = 0.3061), but cBGS therapy restored glutamate concentrations to near-normal values (4.29 + 1.07 mM; p = 0.0047, Fig. 4B). There was severe neurodegeneration at 7 days post-contusion in untreated animals, as evidenced by the presence of sparse axons (p = 0.0045, Fig. 4C, D). In contrast, cBGS-treatment resulted in significantly greater axonal preservation with less astrocyte and microglial activation, as evidenced by reduced GFAP and Iba1 immunostaining, respectively (p < 0.0001, p = 0.0076, Fig. 4E, F). Daily cBGS administration for 5 days, starting from 4 h post-injury, significantly improved motor function recovery (p = 0.0069, Fig. 4G). These findings support the compression SCI results, confirming that cBGS attenuates pro-inflammatory responses and promotes neuronal survival in the peri-lesional region, even after severe SCI and even when treatment initiation is delayed by 4 h.
Fig. 4.
A Experimental design for panels C–G. B CSF glutamate concentrations in naïve mice compared to control untreated mice, rGOT1 + OxAc + PLP-treated, and cBGS-treated mice 28 h post-compression SCI (first injection at 4 h post-SCI) *p = 0.0144, **p = 0.0047, ****p = 0.0008; n = 4/group; one-way ANOVA with Tukey’s HSD. C Representative images of Thy1-labeled axons at the lesion site in vehicle vs. 5-day cBGS-treated mice. Scale bar: 500 μm; white arrows indicate preserved axons in the cBGS group. D Quantification of Thy1-positive axons crossing the lesion. p = 0.0045; n = 8/group; one-way ANOVA. E Quantification of GFAP density p < 0.0001 and (F) Iba1 density in peri-lesional tissue, with representative images shown p = 0.0076. G Basso mouse scale (BMS) locomotor scores demonstrating significant hindlimb motor improvement in cBGS-treated mice vs. vehicle controls. (Mann–Whitney test); **p = 0069; n = 8/group; one-way ANOVA. Scale bar: 100 μm
Long-term neuroprotection following cBGS treatment in an extended therapeutic window after moderate/severe compression SCI in mice
Given the positive short-term outcomes of cBGS administration at 1- and 4-h post-injury, we next investigated long-term efficacy (Fig. 5A, n = 12/group). To reflect clinically relevant conditions, we evaluated a 5-day treatment regimen in which the first injection was administered 4 h after compression SCI (Fig. 5A). Histological analysis at 7 weeks post injury revealed significantly smaller lesions in cBGS treated mice compared to vehicle-treated controls (p = 0.0061, Fig. 5B, C), accompanied by a significantly higher number of axons in the lesion site (p = 0.0012, Fig. 5D), reduced glial scarring (p < 0.0001, Fig. 5E), and attenuated microglial activation (p = 0.0033, Fig. 5F), as indicated by decreased GFAP and Iba1 immunoreactivity, respectively. These findings indicate that cBGS treatment mitigates the activation of degenerative cascades and preserves the lesion-site improvements observed in acute SCI into the chronic stage.
Fig. 5.
Seven weeks after SCI (A) Experimental design. First cBGS injection given 4 h post-injury, followed by daily treatment for 5 days. B Representative images of Thy1-labeled axons (green) and GFAP (red) with DAPI (blue) marking lesion borders in vehicle vs. cBGS-treated mice. Scale bar: 100 μm. C Lesion size quantification based on DAPI-defined borders p = 0.0061. D Quantification of Thy1-positive axons across the lesion site p = 0.0012. E GFAP density and (F) Iba1 density in peri-lesional tissue (p = 0.00012, p = 0.0033, respectively). One-way ANOVA with Tukey’s HSD; p values as indicated
cBGS treatment improves motor function recovery after moderate/severe compression SCI in mice
Mice subjected to moderate/severe compression SCI typically plateau in recovery by 4 weeks. To assess cBGS efficacy, motor recovery was measured using the Basso Mouse Scale (BMS), grid-walking, and CatWalk gait analysis.
Mice treated with five daily administrations of cBGS, starting within either a 4- or 8-h window, showed significant functional recovery one-month post-injury (Fig. 6). Full-dose cBGS improved BMS (p < 0.0001), grid-walking (p = 0.0023), and CatWalk Regularity Index (p = 0.044) compared to vehicle controls. In contrast, half-dose cBGS produced no significant improvements (BMS, p = 0.092; grid-walking, p = 0.8299).
Fig. 6.
A BMS scores up to 4 weeks post-SCI for cBGS initiated at 4 h (pink), 8 h (green), half-dose (blue), and vehicle control (black). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. B Grid-walking test error rate for the same groups as in (A). C CatWalk gait analysis at 4 weeks post-SCI (first injection at 4 h, 5-day treatment) showing improvements in stride length (CON vs. cBGS, p = 0.0014), swing duration, swing speed, and regularity index (Sham vs. CON, p = 0.0024; CON vs. cBGS, p = 0.0044). *p < 0.05, **p < 0.01, ***p < 0.001; one-way ANOVA, cBGS 4 h vs. vehicle. D Urination score showing improved bladder control in cBGS-treated mice (first injection at 4 h, 5-day treatment) compared to vehicle; unpaired t-test; n = 11/group. All data are presented as mean ± SEM
Recovery was evident as early as 2 weeks, when cBGS-treated mice could move at least two joints per hindlimb with weight support, while controls and half-dose groups dragged hindlimbs with minimal movement (Fig. 6A). At 4 weeks, cBGS-treated animals achieved ~ 80% correct steps on grid-walking (p = 0.0003; p = 0.0349) versus < 15% in controls and ~ 30% in half-dose groups (Fig. 6B). CatWalk confirmed improved coordination, with a Regularity Index of 78.4 ± 8.4% (p = 0.0044) in treated animals, compared to only partial spontaneous recovery in controls. Stride length (p = 0.023) and swing speed (p = 0.0217) were also improved, while abnormal swing duration in controls was normalized by treatment (p = 0.0117, Fig. 6C).
Importantly, by week 2, cBGS-treated mice regained independent urination, while controls continued to require manual bladder stimulation (Fig. 6D).
Together, these data show that cBGS promotes consistent, dose-dependent recovery of motor, sensorimotor, and autonomic function after SCI.
cBGS initiated within an 8-h window mitigates lesion-site pathology, preserves neural tissue, and improves functional recovery
To assess the long-term impact of cBGS versus rGOT1 + OxAc + PLP (single day vs. 5-day regimens) on motor recovery, mice underwent locomotor testing over three weeks, after which most groups reached a performance plateau. When initiated 8 h post-injury, both single-day and 5-day cBGS produced the largest improvements in hindlimb motor function by week 3, as measured by BMS scores (Fig. 7A). Notably, functional gains were already detectable at 1-day post-injury with cBGS, consistent with a robust early effect of the combined treatment in attenuating the secondary injury cascade. In contrast, a single dose of rGOT1 + OxAc + PLP produced no measurable motor improvement. A 5-dose rGOT1 + OxAc + PLP regimen yielded significant benefits by week 1, but these were smaller than those achieved even with a single cBGS dose (Fig. 7A). Initiating cBGS within an 8-h therapeutic window attenuated lesion-site inflammation and scarring, as shown by reduced Iba1 (Fig. 7B; p = 0.0001) and GFAP (Fig. 7C; p = 0.0138). The 5-day cBGS regimen further preserved myelin, evidenced by higher MBP levels (Fig. 7D; p = 0.0218), and supported neural integrity, with increased NeuN (Fig. 7E, G; p = 0.0284) and synaptophysin (Fig. 7E, F; p = 0.0375) relative to controls. Collectively, these data indicate that cBGS limits tissue degeneration, reduces neuroinflammation, and preserves neurons and synapses even when treatment begins up to 8 h post-injury. Together, the results strengthen the biological rationale for early peripheral glutamate scavenging, inform dose/regimen selection for first-in-human trials, and provide a clear differentiation from prior monotherapy approaches.
Fig. 7.
A BMS time course (0–21 days post-SCI). Mice received one of five regimens starting 8 h after injury: vehicle, rGOT1 + OxAc + PLP (1 ×), rGOT1 + OxAc + PLP (5 ×, daily for 5 days), cBGS (1x), or cBGS (5 ×, daily for 5 days); **p < 0.01, ***p < 0.001, n = 11 in each group. B Quantification of Iba1 and (C) GFAP in peri-lesional tissue (p = 0.0001, p = 0.0138, respectively, compared to controls). D Demyelination of axonal tracts at the lesion site as detected by MBP immunostaining. A representative image of the spinal cord lesioned area is boxed, where densitometry measurements were performed. Scale bars are 5 μm. Quantitative analysis of MBP density in the white matter tracks of axons at the lesion site of treated and untreated animals. E Representative high magnification images proximal to the lesion site showing neurons (NeuN in red) and synaptophysin (purple); scale bar 100 μm. F Quantitative analysis of synaptophysin immunostaining around NeuN-positive cells. J Quantitative analysis of NeuN-positive cells at the lesion site from both sides of the spinal cord lesion center up to 1 mm. Results are presented as mean ± SEM. One-way ANOVA; n = 11 in each group
External validation by a CRO – cBGS treatment following severe compression SCI in rats decreases blood glutamate levels, increases neuronal survival and neurofilament density, and reduces glial scarring
Our results were validated by a Contract Research Organization (CRO) in a severe compression model in rats, where cBGS treatment was initiated 1 h after injury. Importantly, the study was randomized and blinded. The experimental protocol was fully harmonized with the in-house studies. There were no gross toxic effects of cBGS, with no differences in body weight compared to controls (Fig. 8A; p = 0.6985), and no gross anatomical findings were noted at the end of the study. As measured 3 h following a second treatment administration (i.e., 27 h after the injury), cBGS treatment significantly reduced plasma glutamate levels compared to controls (Fig. 8B; p = 0.0465). In addition, the lesion size in rats treated with cBGS was meaningfully smaller than that in vehicle-controls (Fig. 8C-D; p = 0.0087). Furthermore, glial scarring was significantly reduced with a 23% and 17% reduction in astrocytic and microglial activation (Fig. 8E-F; p = 0.0411 and p = 0.0260), respectively, compared to the control group. Notably, the region around the lesion area was characterized by hypertrophic astrocytes with multiple GFAP+ processes. Next, we quantified the expression of chondroitin sulfate proteoglycans (CSPGs), which are secreted by astrocytes around the lesion site and form a chemical barrier that inhibits axon regeneration and causes growth cone collapse. Indeed, the reduction in glial scarring was accompanied by an 18% decrease in CSPG expression in cBGS-treated animals (Fig. 8G-H; p = 0.0411), which may suggest a less chemical barrier of the astrogliosis, which inhibits any possible regeneration in the future. Importantly, these outcomes were accompanied by a significant functional improvement, as indicated by higher Basso-Beattie-Bresnahan (rat version of the BMS) scores of cBGS-treated vs vehicle-treated rats, at 14 days (p = 0.0012), 21 days (p = 0.0129), and 28 days (p = 0.0035) after the injury (Fig. 8I).
Fig. 8.
A No significant toxicity was observed, with comparable body weights (F(1,10) = 0.1590, p = 0.6985) and urination scores (ns) between groups. B Plasma glutamate was markedly reduced by cBGS vs. control (U = 0, p = 0.0095). C Representative DAPI (blue), GFAP (green), and Iba1 (red) staining in vehicle- and cBGS-treated animals. D Lesion size was smaller in cBGS-treated animals (U = 0, p = 0.0043). E–F Astrocytic (p = 0.0411) and microglial (p = 0.0260) activation were reduced. G–H CSPG expression around the lesion site was lower in cBGS-treated animals (p = 0.0411). White boxes in (G) indicate magnified regions. I The Basso-Beattie-Bresnahan scores were higher at days 14, 21, and 28 post-injury (p = 0.0012, p = 0.0129, p = 0.0035, respectively). Mean ± SEM; one-tailed Mann–Whitney U test or ANOVA with Tukey’s post hoc; n = 6/group. Scale bars: 50 μm
Discussion
In this study, we optimized a combined blood glutamate scavenging (cBGS) formulation through systematic evaluation of compound composition and dosing in vitro and in vivo, and subsequently examined its effects in clinically relevant models of spinal cord injury. Administration of cBGS during the acute phase following compression and contusion SCI was associated with neuroprotective outcomes across species, with additional validation obtained in an independent rat study. Our data indicate that cBGS administration within a 1–8 h post-injury window and repeated dosing over several days are associated with more favorable outcomes than single administration, suggesting that sustained modulation of glutamate homeostasis during the early secondary injury phase may be important. Consistent with this interpretation, cBGS treatment was associated with reduced lesion size and better functional recovery, supported by increased preservation of neuronal and axonal structures.
The translational relevance of therapeutic windows defined in rodent models must be interpreted cautiously, given species differences in metabolism, injury kinetics, and pharmacokinetics. Nevertheless, prior experience with glutamate-modulating therapies highlights that rodent timing may underestimate clinically relevant windows in humans. For example, in preclinical SCI models, Riluzole administration delayed to approximately 3 h post-injury demonstrated significant improvement in some functional parameters; however, it was less effective than administration one hour post-injury [35]. In preclinical studies, Riluzole has been reported to improve BBB scores by approximately 3 points. In contrast, cBGS treatment in the present study was associated with a 5.5–6 point improvement in a more severe compression model, relative to untreated controls. While these findings suggest a larger functional effect with cBGS, they should be interpreted cautiously given differences in injury severity and study design. However, in clinical trials of acute SCI, Riluzole initiated up to 12 h after injury was associated with significant improvements in secondary endpoints, including upper-extremity motor scores, total motor score recovery, and functional independence measures in predefined patient subgroups [25]. Importantly, delayed initiation of cBGS treatment, up to 8 h post-injury, was still associated with functional recovery comparable to that of earlier treatment. In parallel, human studies demonstrate that cerebrospinal fluid glutamate levels rise after severe neurotrauma, peak within 24–48 h, and remain elevated for up to 7 days, with levels correlating strongly with injury severity and outcome [36]. Although early human time points (< 24 h) have not been systematically examined, the delayed peak and prolonged elevation of glutamate suggest that excitotoxic processes persist well beyond the immediate post-injury period. Within this framework, the observation that cBGS remains effective when administered up to 8 h post-injury in mice should be viewed as evidence of an extended and potentially clinically actionable window for targeting glutamate clearance, rather than as a direct temporal extrapolation to humans. We expect that cBGS may achieve clinically meaningful motor improvements in SCI patients, which are at least within the range of effects previously reported for Riluzole, while potentially addressing known limitations of Riluzole related to its mechanism.
Importantly, cBGS operates through a peripheral, system-level mechanism by lowering circulating glutamate levels and thereby enhancing endogenous brain-to-blood glutamate clearance. This approach reduces the total extracellular glutamate burden, regardless of its cellular source, without directly affecting central synaptic transmission or ion channel function. As a result, cBGS is expected to be less constrained by the safety limitations inherent to centrally acting glutamate modulators. cBGS does not aim to replace neuronal signaling modulation but rather to complement physiological clearance mechanisms, which may explain its broader efficacy in preclinical models and its extended therapeutic window. Together, these features suggest that cBGS addresses key limitations of Riluzole by offering a mechanistically distinct strategy with the potential for improved efficacy and a more favorable safety profile, while recognizing that definitive confirmation will require clinical evaluation.
At the mechanistic level, cBGS was associated with a rapid reduction in glutamate concentrations in blood and cerebrospinal fluid, supporting the premise that peripheral glutamate scavenging can enhance endogenous brain-to-blood glutamate efflux. These biochemical changes were accompanied by reduced inflammatory responses and glial scarring at the lesion site, processes that are known to influence tissue preservation and functional outcome after SCI. Importantly, similar associations were observed in an independent study performed by an external CRO using a severe compression SCI rat model, corresponding to near-complete injury in humans.
Compared with our previous single-enzyme approach (rGOT1 + oxaloacetate) initiated one hour post-injury, the present study introduces a more potent cBGS therapy. Notably, cBGS was the only regimen to maintain significant efficacy when treatment was delayed up to 8 h after injury, a clinically relevant window that aligns with real-world emergency care. While individual enzyme–substrate combinations reduced glutamate levels in blood and cerebrospinal fluid, the combined cBGS formulation achieved a more robust effect, rapidly restoring CSF glutamate toward physiological levels even after severe spinal cord injury, underscoring its translational advantage for acute neurotrauma intervention.
Our findings are consistent with injury-induced alterations in EAAT expression and activity following neurotrauma. Emerging evidence suggests that EAAT transporters on capillary endothelial cells are upregulated under hypoxic conditions, preserving glutamate transport capacity despite elevated extracellular glutamate levels [37, 38]. At the same time, disruption of the blood–brain barrier after neurotrauma permits peripheral blood components, including glutamate, to directly influence the CNS extracellular milieu [39]. In this context, lowering plasma glutamate levels through cBGS treatment is expected to reduce both excitotoxic influx from the circulation and overall extracellular glutamate burden. Supporting this notion, elevated blood glutamate levels have been associated with worsened outcomes in experimental models and patients with ischemic stroke and subarachnoid hemorrhage [9, 40, 41]. Together with our data, these observations suggest that glutamate clearance is likely most effective within the lesion penumbra, where cBGS-induced reduction of systemic glutamate may enhance gradient-driven efflux, attenuate excitotoxicity, and potentially limit lesion expansion [37, 38].
cBGS treatment was associated with increased and organized MBP immunostaining, reflecting an increased number of axons crossing the lesion site. Given the early time point tested (i.e., 2 months post-injury), this is probably due to less demyelination of the axons at the injury area in treated animals rather than remyelination. However, as myelin debris is known to inhibit axonal regeneration [42], attenuating Wallerian degeneration may facilitate axonal repair and contribute to improved neural function at a later stage [43].
An additional key contributor to the propagation of secondary injury is the robust inflammatory response that occurs at the lesion site. Treatment with cBGS reduced pro-apoptotic signaling and significantly reduced inflammation after injury, with astrocytes and microglia appearing less reactive and secreting lower levels of pro-inflammatory cytokines. These combined effects may contribute to enhanced neuronal survival, as evidenced by increased numbers of NeuN-positive cells around the lesion site at both one week and two months post-SCI. Interestingly, IL-10 levels remained low in both treated and control groups at one day post-injury, which may reflect the timing of measurement rather than treatment efficacy. IL-10 is known to exhibit a delayed response, typically peaking around day seven post-SCI, suggesting that earlier time points may not fully capture its immunomodulatory role [44]. Collectively, these indicators support the conclusion that not only do more neurons survive following cBGS treatment, but they also maintain better functional integrity, probably due to a more favorable microenvironment that supports recovery.
Most importantly, our treatment not only demonstrates strong efficacy in reducing inflammation and preserving axonal integrity at both molecular and tissue levels, but these effects also translate into remarkable improvements in motor function. This functional recovery strongly supports the clinical potential of cBGS as an emergency intervention for spinal cord injury. Notably, the treatment improved overall motor coordination across multiple joints and significantly enhanced correct stepping, as evaluated by the grid walking test. These results suggest that neuronal preservation extended beyond motor neurons to include sensory and interneurons within the perilesional area, which is critical for proprioception and coordinated limb control. Complementary findings from CatWalk gait analysis, including improved stride length, swing duration, and speed, further support the presence of improved neuromuscular function. Together, these outcomes may reflect the restoration of more normalized muscle tone and proprioceptive feedback, contributing to superior motor recovery and highlighting the comprehensive therapeutic potential of cBGS.
Conclusions
In summary, this study supports the use of cBGS as a translationally relevant strategy for mitigating glutamate-driven secondary injury following spinal cord trauma. By lowering peripheral glutamate levels and enhancing endogenous brain-to-blood clearance, cBGS differs fundamentally from prior glutamate-targeted therapies that directly interfered with central synaptic signaling and demonstrated limited clinical efficacy. Importantly, the identification of a therapeutic window extending up to 8 h post-injury aligns with real-world emergency care scenarios, where immediate treatment is often delayed by transport and triage constraints. The observed benefit with repeated dosing, together with reproducibility across species and independent laboratories, supports the feasibility of cBGS as a systemically administered intervention during the early post-injury period. Collectively, these findings provide a strong rationale for further preclinical development and clinical evaluation of cBGS as a first-line emergency treatment for spinal cord injury. Moreover, robust functional recovery after neurotrauma is likely to depend on combination therapy, with cBGS serving as an early emergency intervention that can be seamlessly integrated with regenerative treatments, electrical stimulation, and rehabilitation, thereby improving long-term clinical outcomes.
Supplementary Information
Acknowledgements
Schematics created with BioRender.com and covered by a license for publication. This study was supported by the Wings for Life – Spinal Cord Research Foundation (WFL-IL-17/21) and by the Department of Defense, U.S. Army Medical Research and Development Command Congressionally Directed Medical Research Programs, Fiscal Year 2020 Spinal Cord Injury Research Program (CDMRP SC200132, Grant 13191833).
Abbreviations
- AMPA
α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (glutamate receptor)
- ANOVA
Analysis of variance
- AST (GOT1)
Aspartate aminotransferase (glutamate–oxaloacetate transaminase 1)
- ALT (GPT1)
Alanine aminotransferase (glutamate-pyruvate transaminase 1)
- BBB
Blood–brain barrier
- BGS
Blood-glutamate scavenging
- BMS
Basso Mouse Scale (hindlimb locomotion, mouse)
- cBGS
Combined blood-glutamate scavenging
- CNS
Central nervous system
- CRO
Contract Research Organization
- CSF
Cerebrospinal fluid
- CSPG(s)
Chondroitin sulfate proteoglycan(s)
- Cx3cr1 (CX3CR1)
Chemokine (C-X3-C motif) receptor 1
- DAPI
4′,6-Diamidino-2-phenylindole
- EAAT
Excitatory amino acid transporter
- eYFP
Enhanced yellow fluorescent protein
- GFAP
Glial fibrillary acidic protein
- HPLC
High-performance liquid chromatography
- HRP
Horseradish peroxidase
- Iba1
Ionized calcium-binding adaptor molecule 1
- IL-1β/IL-6/IL-10
Interleukin-1 beta / Interleukin-6 / Interleukin-10
- IP
Intraperitoneal
- IV
Intravenous
- MBP
Myelin basic protein
- MS
Mass spectrometry
- NMDA
N-Methyl-D-aspartate (glutamate receptor)
- OPA
O-Phthalaldehyde
- OxAc
Oxaloacetate
- PBS
Phosphate-buffered saline
- PCR/qPCR/RT-PCR
Polymerase chain reaction / Quantitative PCR / Reverse-transcription PCR
- PD
Pharmacodynamics
- PFA
Paraformaldehyde
- PLP
Pyridoxal 5′-phosphate
- Pyr
Pyruvate
- ROS
Reactive oxygen species
- rGOT1 (GOT1)
Recombinant glutamate–oxaloacetate transaminase 1
- rGPT1 (GPT1)
Recombinant glutamate-pyruvate transaminase 1
- SCI
Spinal cord injury
- SD/SEM
Standard deviation / Standard error of the mean
- SDS-PAGE
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis
- SOP
Standard operating procedure
- SPF
Specific pathogen-free (animal facility)
- TNF-α
Tumor necrosis factor alpha
- TBI
Traumatic brain injury
- WT
Wild type
Authors’ contributions
Y.G. and Y.L. contributed equally to this work by designing the research studies, conducting experiments, acquiring and analyzing data, and writing the manuscript; Y.G. contributed to the conceptualization of the study and revised the manuscript for intellectual content as wellR.L. designed the research studies, conducted experiments, and acquired and analyzed data; A.Y. conducted experiments, and acquired and analyzed data; E.B. conducted experiments; R.B. conducted experiments; A.B. designed the research study, acquired and analyzed data, and contributed to writing the manuscript; A.R. contributed to the design and conceptualization of the study; acquisition of data; interpretation of data; supervision; and revised the manuscript for intellectual content.
Data availability
All data supporting the findings of this study are included in the article. Processed qPCR data and other supporting datasets are available from the corresponding author upon reasonable request. The raw microscopy images on which the figures are based are available upon reasonable request.
Declarations
Ethics approval and consent to participate
The Tel-Aviv University Animal Ethics Committee approved all procedures following the requirements of the National Health and Medical Research Council of Israel (Approval number 01–20-001).
Not applicable.
Consent for publication
The authors hereby confirm that all data, images, figures, and materials included in this manuscript are original, were obtained in accordance with relevant ethical standards, and may be published in Inflammation and Regeneration.
All authors have reviewed the final version of the manuscript and consent to its publication in Inflammation and Regeneration.
Competing interests
Angela Ruban is a co-founder of NeuroHagana.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Josef Levin and Yona Goldshmit contributed equally to this work.
References
- 1.Shavelle R, Strauss D, Brooks J. Discrepancies in the estimates of life expectancy after SCI. Spinal Cord. 2013;51(12):937. 10.1038/sc.2013.93. [DOI] [PubMed] [Google Scholar]
- 2.Hachem LD, Ahuja CS, Fehlings MG. Assessment and management of acute spinal cord injury: from point of injury to rehabilitation. J Spinal Cord Med. 2017;40(6):665–75. 10.1080/10790268.2017.1329076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Fehlings MG, Vaccaro A, Wilson JR, et al. Early versus delayed decompression for traumatic cervical spinal cord injury: results of the Surgical Timing in Acute Spinal Cord Injury Study (STASCIS). PLoS ONE. 2012;7(2):e32037. 10.1371/journal.pone.0032037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wilson JR, Tetreault LA, Kwon BK, et al. Timing of decompression in patients with acute spinal cord injury: a systematic review. Glob Spine J. 2017;7(3 Suppl):95S-115S. 10.1177/2192568217701716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Mortazavi MM, Verma K, Harmon OA, et al. The microanatomy of spinal cord injury: a review. Clin Anat. 2015;28(1):27–36. 10.1002/ca.22432. [DOI] [PubMed] [Google Scholar]
- 6.Ahmed A, Patil AA, Agrawal DK. Immunobiology of spinal cord injuries and potential therapeutic approaches. Mol Cell Biochem. 2018;441(1–2):181–9. 10.1007/s11010-017-3184-9. [DOI] [PubMed] [Google Scholar]
- 7.Hu X, Xu W, Ren Y, et al. Spinal cord injury: molecular mechanisms and therapeutic interventions. Signal Transduct Target Ther. 2023;8(1):245. 10.1038/s41392-023-01477-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang Y, Qin ZH. Molecular and cellular mechanisms of excitotoxic neuronal death. Apoptosis. 2010;15(11):1382–402. 10.1007/s10495-010-0481-0. [DOI] [PubMed] [Google Scholar]
- 9.Xu GY, Hughes MG, Zhang L, Cain L, McAdoo DJ. Administration of glutamate into the spinal cord at extracellular concentrations reached post-injury causes functional impairments. Neurosci Lett. 2005;384(3):271–6. 10.1016/j.neulet.2005.04.100. [DOI] [PubMed] [Google Scholar]
- 10.Panter SS, Yum SW, Faden AI. Alteration in extracellular amino acids after traumatic spinal cord injury. Ann Neurol. 1990;27(1):96–9. 10.1002/ana.410270115. [DOI] [PubMed] [Google Scholar]
- 11.Goldshmit Y, Banyas E, Bens N, Yakovchuk A, Ruban A. Blood glutamate scavengers and exercises as an effective neuroprotective treatment in mice with spinal cord injury. J Neurosurg Spine. 2020:1-13. 10.3171/2020.4.SPINE20302. [DOI] [PubMed]
- 12.Dubey Tiwari K, Sharma G, Prakash MM, Parihar MS, Dawane V. Effects of high glutamate concentrations on mitochondria of human neuroblastoma SH-SY5Y cells. Ann Pharm Fr. 2023;81(3):457–65. 10.1016/j.pharma.2022.10.003. [DOI] [PubMed] [Google Scholar]
- 13.Mark LP, Prost RW, Ulmer JL, et al. Pictorial review of glutamate excitotoxicity: fundamental concepts for neuroimaging. AJNR Am J Neuroradiol Nov-Dec. 2001;22(10):1813–24. [PMC free article] [PubMed] [Google Scholar]
- 14.Baracaldo-Santamaria D, Ariza-Salamanca DF, Corrales-Hernandez MG, Pachon-Londono MJ, Hernandez-Duarte I, Calderon-Ospina CA. Revisiting excitotoxicity in traumatic brain injury: from bench to bedside. Pharmaceutics. 2022;14(1). 10.3390/pharmaceutics14010152. [DOI] [PMC free article] [PubMed]
- 15.Parri HR, Gould TM, Crunelli V. Spontaneous astrocytic Ca2+ oscillations in situ drive NMDAR-mediated neuronal excitation. Nat Neurosci. 2001;4(8):803–12. 10.1038/90507. [DOI] [PubMed] [Google Scholar]
- 16.Rossi DJ, Brady JD, Mohr C. Astrocyte metabolism and signaling during brain ischemia. Nat Neurosci. 2007;10(11):1377–86. 10.1038/nn2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Malarkey EB, Parpura V. Mechanisms of glutamate release from astrocytes. Neurochem Int. 2008;52(1–2):142–54. 10.1016/j.neuint.2007.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Parpura V, Scemes E, Spray DC. Mechanisms of glutamate release from astrocytes: gap junction “hemichannels”, purinergic receptors and exocytotic release. Neurochem Int. 2004;45(2–3):259–64. 10.1016/j.neuint.2003.12.011. [DOI] [PubMed] [Google Scholar]
- 19.Ikonomidou C, Turski L. Why did NMDA receptor antagonists fail clinical trials for stroke and traumatic brain injury? Lancet Neurol. 2002;1(6):383–6. 10.1016/S1474-4422(02)00164-3. [DOI] [PubMed] [Google Scholar]
- 20.Muir KW. Glutamate-based therapeutic approaches: clinical trials with NMDA antagonists. Curr Opin Pharmacol. 2006;6(1):53–60. 10.1016/j.coph.2005.12.002. [DOI] [PubMed] [Google Scholar]
- 21.Lees KR, Asplund K, Carolei A, et al. Glycine antagonist (gavestinel) in neuroprotection (GAIN International) in patients with acute stroke: a randomised controlled trial. Lancet. 2000;355(9219):1949–54. 10.1016/s0140-6736(00)02326-6. [DOI] [PubMed] [Google Scholar]
- 22.Bellingham MC. A review of the neural mechanisms of action and clinical efficiency of riluzole in treating amyotrophic lateral sclerosis: what have we learned in the last decade? CNS Neurosci Ther. 2011;17(1):4–31. 10.1111/j.1755-5949.2009.00116.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Fumagalli E, Funicello M, Rauen T, Gobbi M, Mennini T. Riluzole enhances the activity of glutamate transporters GLAST, GLT1 and EAAC1. Eur J Pharmacol. 2008;578(2–3):171–6. 10.1016/j.ejphar.2007.10.023. [DOI] [PubMed] [Google Scholar]
- 24.Fehlings MG, Moghaddamjou A, Harrop JS, et al. Safety and efficacy of Riluzole in acute spinal cord injury study (RISCIS): a multi-center, randomized, placebo-controlled, double-blinded trial. J Neurotrauma. 2023;40(17–18):1878–88. 10.1089/neu.2023.0163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Fehlings MG, Pedro KM, Alvi MA, et al. The sodium-glutamate antagonist riluzole improves outcome after acute spinal cord injury: results from the RISCIS randomised controlled trial analysed using a global statistical analytic technique. EBioMedicine. 2025;118:105863. 10.1016/j.ebiom.2025.105863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Svetlov SI, Prima V, Kirk DR, et al. Morphologic and biochemical characterization of brain injury in a model of controlled blast overpressure exposure. J Trauma. 2010;69(4):795–804. 10.1097/TA.0b013e3181bbd885. [DOI] [PubMed] [Google Scholar]
- 27.Cohen-Kashi-Malina K, Cooper I, Teichberg VI. Mechanisms of glutamate efflux at the blood-brain barrier: involvement of glial cells. J Cereb Blood Flow Metab. 2012;32(1):177–89. 10.1038/jcbfm.2011.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Danbolt NC. Glutamate uptake. Prog Neurobiol. 2001;65(1):1–105. 10.1016/S0301-0082(00)00067-8. [DOI] [PubMed] [Google Scholar]
- 29.O’Kane RL, Martinez-Lopez I, DeJoseph MR, Vina JR, Hawkins RA. Na+-dependent glutamate transporters (EAAT1, EAAT2, and EAAT3) of the blood-brain barrier - a mechanism for glutamate removal. J Biol Chem. 1999;274(45):31891–5. 10.1074/jbc.274.45.31891. [DOI] [PubMed] [Google Scholar]
- 30.Grewer C, Gameiro A, Zhang Z, Tao Z, Braams S, Rauen T. Glutamate forward and reverse transport: from molecular mechanism to transporter-mediated release after ischemia. IUBMB Life. 2008;60(9):609–19. 10.1002/iub.98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.van Putten M, Fahlke C, Kafitz KW, Hofmeijer J, Rose CR. Dysregulation of astrocyte ion homeostasis and its relevance for stroke-induced brain damage. Int J Mol Sci. 2021;22(11). 10.3390/ijms22115679. [DOI] [PMC free article] [PubMed]
- 32.Teichberg VI, Cohen-Kashi-Malina K, Cooper I, Zlotnik A. Homeostasis of glutamate in brain fluids: an accelerated brain-to-blood efflux of excess glutamate is produced by blood glutamate scavenging and offers protection from neuropathologies. Neuroscience. 2009;158(1):301–8. 10.1016/j.neuroscience.2008.02.075. [DOI] [PubMed] [Google Scholar]
- 33.Gottlieb M, Wang Y, Teichberg VI. Blood-mediated scavenging of cerebrospinal fluid glutamate. J Neurochem. 2003;87(1):119–26. [DOI] [PubMed] [Google Scholar]
- 34.Goldshmit Y, Jona G, Schmukler E, Solomon S, Pinkas-Kramarski R, Ruban A. Blood glutamate scavenger as a novel neuroprotective treatment in spinal cord injury. J Neurotrauma. 2018;35(21):2581–90. 10.1089/neu.2017.5524. [DOI] [PubMed] [Google Scholar]
- 35.Wu Y, Satkunendrarajah K, Teng Y, Chow DS, Buttigieg J, Fehlings MG. Delayed post-injury administration of riluzole is neuroprotective in a preclinical rodent model of cervical spinal cord injury. J Neurotrauma. 2013;30(6):441–52. 10.1089/neu.2012.2622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang H, Zhang X, Zhang T, Chen L. Excitatory amino acids in cerebrospinal fluid of patients with acute head injuries. Clin Chem. 2001;47(8):1458–62. [PubMed] [Google Scholar]
- 37.Koncekova J, Kotorova K, Gottlieb M, Bona M, Bonova P. Changes in excitatory amino acid transporters in response to remote ischaemic preconditioning and glutamate excitotoxicity. Neurochem Int. 2024;173:105658. 10.1016/j.neuint.2023.105658. [DOI] [PubMed] [Google Scholar]
- 38.Verkhratsky A, Butt A, Li B, et al. Astrocytes in human central nervous system diseases: a frontier for new therapies. Signal Transduct Target Ther. 2023;8(1):396. 10.1038/s41392-023-01628-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Boyko M, Gruenbaum BF, Frank D, et al. The integrity of the blood-brain barrier as a critical factor for regulating glutamate levels in traumatic brain injury. Int J Mol Sci. 2023;24(6). 10.3390/ijms24065897. [DOI] [PMC free article] [PubMed]
- 40.Snider S, Albano L, Gagliardi F, et al. Substantially elevated serum glutamate and CSF GOT-1 levels associated with cerebral ischemia and poor neurological outcomes in subarachnoid hemorrhage patients. Sci Rep. 2023;13(1):5246. 10.1038/s41598-023-32302-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Campos F, Sobrino T, Ramos-Cabrer P, et al. High blood glutamate oxaloacetate transaminase levels are associated with good functional outcome in acute ischemic stroke. J Cereb Blood Flow Metab. 2011;31(6):1387–93. 10.1038/jcbfm.2011.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Quraishe S, Forbes LH, Andrews MR. The extracellular environment of the CNS: influence on plasticity, sprouting, and axonal regeneration after spinal cord injury. Neural Plast. 2018;2018:2952386. 10.1155/2018/2952386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Filbin MT. Myelin-associated inhibitors of axonal regeneration in the adult mammalian CNS. Nat Rev Neurosci. 2003;4(9):703–13. 10.1038/nrn1195. [DOI] [PubMed] [Google Scholar]
- 44.Hellenbrand DJ, Quinn CM, Piper ZJ, Morehouse CN, Fixel JA, Hanna AS. Inflammation after spinal cord injury: a review of the critical timeline of signaling cues and cellular infiltration. J Neu [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data supporting the findings of this study are included in the article. Processed qPCR data and other supporting datasets are available from the corresponding author upon reasonable request. The raw microscopy images on which the figures are based are available upon reasonable request.








