Table 2.
Heat-responsive miRNAs identified in mango mesocarp and their predicted target genes.
| miRNA | Sequence | Locus | Chr | Genomic location | Differential expression (time/fold-change) | Putative Target ID | Putative targets | Inhibition | ΔG duplex formation (kcal/mol) | ΔG precursor hairpin (kcal/mol |
|---|---|---|---|---|---|---|---|---|---|---|
| miR168 | UCGCUUGGUGCAGGUCGGGAAC | NC_058144.1:10593810–10,594,012 | 8 | Intergenic | 6 h (1.9) | XM_044621157.1 | MiAGO1 | Cleavage | -37.41 | -75.5 |
| XM_044649578.1 | MiPUM2 | Cleavage | -31.67 | |||||||
| miR319 | UUGGACUGAAGGGAGCUCCCU | NC_058139.1:5004416–5,004,836 | 3 | Intergenic | 6 h (3.68) | XM_044606613.1 | MiGAMYB | Cleavage | -33.43 | -83.9 |
| NC_058140.1:1308917–1,309,337 | 4 | Mixed | XM_044656421.1 | MiMYB33 | Cleavage | -33.43 | ||||
| NC_058156.1:830778–830,982 | 20 | Intron | XM_044609727.1 | MiTCP4 | Cleavage | -37.7 | ||||
| NC_058142.1:10476063–10,476,275 | 6 | Intergenic | XM_044605661.1 | MiMNS3 | Traslation | -30.21 | ||||
| NC_058139.1:1054542–1,054,749 | 3 | Intergenic | ||||||||
| miR482 | UCUUGCCAACUCCGCCCAUACC | NC_058141.1:811685–811,830 | 5 | Exon | 24 h (-29.15) | c24640_g2_i10 | Milnc-1 | Cleavage | -40.13 | -111 |
| c11593_g1_i2 | Uncharacterized protein | Cleavage | -43.92 | |||||||
| NC_058141.1:843322–843,466 | 5 | Intergenic | XM_044641238.1 | MiRP | Cleavage | -37.35 | ||||
| XM_044634119.1 | MiRPP-13 | Cleavage | -61 | |||||||
| XM_044631012.1 | MiNIP6-1 | Cleavage | -33.91 | |||||||
| miR169 | UGUAGGCUUAGAAAGUAUCGUG | NC_058138.1:22168361–22,168,555 | 2 | - | 3 h (2.35) | - | - | - | - | -82.8 |
| 6 h (3.87) | ||||||||||
| 24 h (4.43) | ||||||||||
| miR319b | UGGACUGAAGGGAGCUCCUUC | NC_058146.1:5739952–5,740,168 | 10 | Intron | 6 h (-8.13) | XM_044616538.1 | MiMYB123 | Cleavage | -26.79 | -83.6 |
| 12 | Intergenic | 24 h (-5.14) |
AGO1: protein argonaute 1; APUM2: pumilio homolog 2; GAMYB: similar to transcription factor GAM1; MYB33 and MYB123: similar to transcription factor MYB33 or MYB123; TCP4: similar to transcription factor TCP4; MNS3: mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3; lnc-1, long non- coding-1; RP, disease resistance protein; RPP13: putative disease resistance RPP13-like protein 1; NIP6-1: aquaporin. Bold letters: miRNAs and targets selected to validate.