Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | Balb/c (CAnN.Cg-Foxn1nu/Crl) nude mice | Beijing Vital River Laboratory Animal Technology Co., Ltd. | 401 | |
| Genetic reagent (Drosophila melanogaster) | bam-GAL4-VP16 | Chen and McKearin, 2003 | ||
| Genetic reagent (D. melanogaster) | nos-GAL4-VP16 | Van Doren et al., 1998 | ||
| Genetic reagent (D. melanogaster) | nos-cas9 | Kondo and Ueda, 2013 | ||
| Genetic reagent (D. melanogaster) | FRT2A | BDSC | 1997 | |
| Genetic reagent (D. melanogaster) | puc-lacZ | Bloomington Drosophila Stock Center (BDSC) | 98329 | |
| Genetic reagent (D. melanogaster) | UAS-bam-RNAi | BDSC | 33631 | |
| Genetic reagent (D. melanogaster) | UASp-BicD-RNAi | TsingHua Fly Center (THFC) | THU4454 | |
| Genetic reagent (D. melanogaster) | UASp-cdc27-RNAi | THFC | TH201500102.S | |
| Genetic reagent (D. melanogaster) | UASp-Cdk1 | BDSC | 65396 | |
| Genetic reagent (D. melanogaster) | UASp-CycA | BDSC | 85308 | |
| Genetic reagent (D. melanogaster) | UASp-CycB | BDSC | 85312 | |
| Genetic reagent (D. melanogaster) | UASp-dsor1-RNAi | THFC | THU0677 | |
| Genetic reagent (D. melanogaster) | UASp-fzr-RNAi | THFC | TH201500745.S | |
| Genetic reagent (D. melanogaster) | UASp-GFP | Zhang et al., 2024a | ||
| Genetic reagent (D. melanogaster) | UASp-GFP-RNAi | BDSC | 44412, 44415 | |
| Genetic reagent (D. melanogaster) | UASz-lacZ | Zhang et al., 2024b | ||
| Genetic reagent (D. melanogaster) | UASp-lmgA-RNAi | THFC | THU4085 | |
| Genetic reagent (D. melanogaster) | UASp-lok-RNAi | THFC | TH01867.N | |
| Genetic reagent (D. melanogaster) | UASp-mr-RNAi | THFC | THU5250 | |
| Genetic reagent (D. melanogaster) | UASp-p53-RNAi | THFC | THU5318 | |
| Genetic reagent (D. melanogaster) | UASp-RasG12V | Zhang et al., 2024b | ||
| Genetic reagent (D. melanogaster) | UASp-rl-RNAi | THFC | THU3530 | |
| Genetic reagent (D. melanogaster) | UASp-shtd-RNAi | THFC | TH201500835.S | |
| Genetic reagent (D. melanogaster) | UASp-Stg | BDSC | 58439 | |
| Genetic reagent (D. melanogaster) | UASp-tefu-RNAi | THFC | THU5591 | |
| Genetic reagent (D. melanogaster) | UASp-uev1a-RNAi | BDSC | 66947 | |
| Genetic reagent (D. melanogaster) | UASz-flag-RasG12V | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | UASz-UBE2V1 | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | UASz-UBE2V2 | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | UASz-uev1a | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | UASz-Yki3SA | Zhang et al., 2024a | ||
| Genetic reagent (D. melanogaster) | nos-int; attP40 | BDSC | 79604 | |
| Genetic reagent (D. melanogaster) | uev1a Δ1 | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | uev1a Δ2 | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | uev1a-flag | This paper | Construction information described in the Materials and methods section |
|
| Genetic reagent (D. melanogaster) | All deficiency Drosophila strains (including 7584) | The Core Facility of Drosophila Resource and Technology (CEMCS), Chinese Academy of Sciences (CAS), China | The stock numbers are the same as in BDSC | |
| Cell line (D. melanogaster) | Schneider 2 (S2) cells | Beyotime Biotechnology | Cat# C7925, RRID:CVCL_Z232 | |
| Cell line (Homo sapiens) | 293T cells | The American Type Culture Collection (ATCC) | Cat# CRL-3216, RRID:CVCL_0063 | |
| Cell line (H. sapiens) | HCT116 cells | ATCC | Cat# CCL-247, RRID:CVCL_VU38 | |
| Cell line (H. sapiens) | SW480 cells | ATCC | Cat# CCL-228, RRID:CVCL_0546 | |
| Transfected construct (H. sapiens) | Control shRNA | This paper | CCTAAGGTTAAGTCGCCCTCG | |
| Transfected construct (H. sapiens) | UBE2V1 shRNA #1 | This paper | CTCGGGCAGATGACATGAAAT | |
| Transfected construct (H. sapiens) | UBE2V1 shRNA #2 | This paper | GCATCACCACAGGCTGGCTCA | |
| Transfected construct (H. sapiens) | UBE2V2 shRNA #1 | This paper | GTCTTAAATCAACAACCTTCT | |
| Transfected construct (H. sapiens) | UBE2V2 shRNA #2 | This paper | GCTCCTCCGTCAGTTAGATTT | |
| Antibody | Anti-α-Spectrin (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) | RRID:AB_528473 | IF (1:100) |
| Antibody | Anti-β-Actin (Mouse monoclonal) | Abmart | RRID:AB_2936240 | WB (1:5000) |
| Antibody | Anti-β-Actin (Mouse monoclonal) | Zenbio | Cat# 200068-8F10 | WB (1:5000) |
| Antibody | Anti-CycA (Rabbit polyclonal) | Whitfield et al., 1990 | IF (1:1000) | |
| Antibody | Anti-Flag (Mouse monoclonal) | Sigma | Cat# F1804, RRID:AB_262044 | IF (1:500) |
| Antibody | Anti-Flag (Mouse monoclonal) | Utibody | Cat# UM3009 | IP (1:200), WB (1:5000) |
| Antibody | Anti-γH2AV (Mouse monoclonal) | DSHB | PRID: AB_2618077 | IF (1:200) |
| Antibody | Anti-HA (Mouse monoclonal) | Utibody | Cat# UM3004 | IP (1:200), WB (1:3000) |
| Antibody | Anti-Myc (Mouse monoclonal) | Utibody | Cat# UM3011 | IP (1:200), WB (1:3000) |
| Antibody | Anti-UBE2V2 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-377254 | WB (1:2000) |
| Antibody | Anti-α-Tubulin (Rabbit polyclonal) | Proteintech | Cat# 14555-1-AP | WB (1:5000) |
| Antibody | Anti-β-Tubulin (Rabbit polyclonal) | Zenbio | Cat# 380628 | WB (1:5000) |
| Antibody | Anti-CycA (Rabbit polyclonal) | Immunoway | Cat# YT1167 | IF (1:200) |
| Antibody | Anti-Flag (Rabbit monoclonal) | Zenbio | Cat# R24091 | IP (1:200), WB (1:5000) |
| Antibody | Anti-HA (Rabbit monoclonal) | Zenbio | Cat# 301113 | IP (1:200), WB (1:3000) |
| Antibody | Anti-Ki67 (Rabbit polyclonal) | Proteintech | Cat# 27309-1-AP | IF (1:2000) |
| Antibody | Anti-Myc (Rabbit polyclonal) | ABclonal | Cat# AE009 | IP (1:200), WB (1:3000) |
| Antibody | Anti-UBE2V1 (Rabbit polyclonal) | Wanleibio | Cat# WL04482 | WB (1:2000) |
| Antibody | Alexa Fluor 546 goat anti-mouse | Invitrogen | Cat# A-11030 | IF (1:2000) |
| Antibody | HRP Goat anti-Mouse IgG(H+L) | SIMUBIOTECH | Cat# S2002 | IF (1:2000) |
| Antibody | HRP Goat anti-Rabbit IgG(H+L) | SIMUBIOTECH | Cat# S2001 | IF (1:2000) |
| Recombinant DNA reagent | pCDH-CMV | Addgene | RRID:Addgene_72265 | |
| Recombinant DNA reagent | pCDH-CMV-UBE2V1 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pCDH-CMV-UBE2V2 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pCFD3 | Addgene | RRID:Addgene_49410 | |
| Recombinant DNA reagent | pCFD3-uev1a-gRNA-1 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pLKO-CMV-puro | Addgene | RRID:Addgene_131700 | |
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shNC | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V1-#1 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V1-#2 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V2-#1 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V2-#2 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pMD2.G | Addgene | RRID:Addgene_12259 | |
| Recombinant DNA reagent | psPAX2 | Addgene | RRID:Addgene_12260 | |
| Recombinant DNA reagent | pU6-BbsI-chiRNA | Addgene | RRID:Addgene_45946 | |
| Recombinant DNA reagent | pU6-uev1a-gRNA-2 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-attB | Drosophila Genomics Resource Center (DGRC) | RRID:DGRC_1419 | |
| Recombinant DNA reagent | pUASt-APC7-Myc | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Flag-ben | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Flag-cycA | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-HA-Ub | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-HA-Ub7KR | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-HA-Ub6KR+K11 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-HA-Ub6KR+K48 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-HA-Ub6KR+K63 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-HA-uev1a | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-APC4 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Cdc16 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Cdc23 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Cdc27 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Fzr | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Fzy | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Ida | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASt-Myc-Mr | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASz1.0 | DGRC | RRID:DGRC_1431 | |
| Recombinant DNA reagent | pUASz-flag-RasG12V | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASz-UBE2V1 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASz-UBE2V2 | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASz-uev1a | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASz-uev1a-donor | This paper | Construction information described in the Materials and methods section |
|
| Recombinant DNA reagent | pUASz-Yki3SA | This paper | Construction information described in the Materials and methods section |
|
| Sequence-based reagent | uev1a#1_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAACGGAATTTCCGCTTACTG |
| Sequence-based reagent | uev1a#1_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACGGACCGATGATCATGCC |
| Sequence-based reagent | uev1a#2_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACACTAAAGATCGAGTGCG |
| Sequence-based reagent | uev1a#2_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATGCCAGCTTCAGGTTCTC |
| Sequence-based reagent | ben#1_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACCACGTCGCATCATCAAG |
| Sequence-based reagent | ben#1_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAAGTCTTCGACGGCATATTTC |
| Sequence-based reagent | ben#2_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACAGATCCGGACCATATTG |
| Sequence-based reagent | ben#2_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATCAGTCTTCGACGGCATATTTC |
| Sequence-based reagent | cdc27#1_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATCGCCCAGGATCTGATTAAC |
| Sequence-based reagent | cdc27#1_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAGCAGCGACAGATCCTTCTTC |
| Sequence-based reagent | cdc27#2_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAGATGATGGGCAAAAAGCTAAAG |
| Sequence-based reagent | cdc27#2_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACCATCGGCCGATTGTTTC |
| Sequence-based reagent | AcGFP-F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATGCACCACCGGCAAGCTGCCTG |
| Sequence-based reagent | AcGFP-R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAGGCCAGCTGCACGCTGCCATC |
| Sequence-based reagent | GAPDH-F | This paper | PCR primers | ACAACTTTGGTATCGTGGAAGG |
| Sequence-based reagent | GAPDH-R | This paper | PCR primers | GCCATCACGCCACAGTTTC |
| Sequence-based reagent | UBE2V1-F | This paper | PCR primers | CGGGCTCGGGAGTAAAAGTC |
| Sequence-based reagent | UBE2V1-R | This paper | PCR primers | AGGCCCAATTATCATCCCTGT |
| Sequence-based reagent | UBE2V2-F | This paper | PCR primers | TGGACAGGCATGATTATTGGGC |
| Sequence-based reagent | UBE2V2-R | This paper | PCR primers | CTAACACTGGTATGCTCCGGG |
| Commercial assay or kit | BCA Protein Assay Kit | Beyotime Biotechnology | Cat# P0012 | |
| Commercial assay or kit | CCK8 Kit | APExBIO | Cat# K1018 | |
| Commercial assay or kit | EdU Incorporation Assay Kit | Beyotime Biotechnology | Cat# C0075 | |
| Commercial assay or kit | SPARKscript II All-in-one RT SuperMix kit | SparkJade | Cat# AG0305-C | |
| Commercial assay or kit | SYBR Green Premix Pro Taq HS qPCR kit | ACCURATE BIOLOGY | Cat# AG11701-S | |
| Commercial assay or kit | T7 RiboMAX Express RNAi System | Promega | Cat# P1700 | |
| Commercial assay or kit | TriQuick Reagent kit | Solarbio | Cat# R1100 | |
| Chemical compound, drug | Chloroquine (CQ) | Selleck | Cat# S6999 | |
| Chemical compound, drug | Cycloheximide (CHX) | MCE | Cat# HY-12320 | |
| Chemical compound, drug | MG132 | Selleck | Cat# S2619 | |
| Chemical compound, drug | Protein G Sepharose | Cytiva | Cat# 17061801 | |
| Chemical compound, drug | Puromycin | Solarbio | Cat# P8230 | |
| Software, algorithm | Adobe Photoshop 2022 | San Jose, CA, USA | RRID:SCR_014199 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | |
| Software, algorithm | GraphPad Prism | GraphPad Software, Inc | RRID:SCR_002798 | |
| Other | DMSO | Macklin | Cat# D6258 | |
| Other | Dulbecco’s Modified Eagle Medium | Gibco | Cat# C11995500BT | |
| Other | Fetal Bovine Serum (FBS) | Lonsera | Cat# S711-001S | |
| Other | Insect Culture Medium | Union | Cat# UK1000 | |
| Other | Lipofectamine 2000 | Thermo Fisher | 11668027 |