Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
gRNA sequences for targeting the CRISPRa system to Col2a1 [33], ACAN [33], ZNF865, and a nontarget control (NTC).
| Gene Target | gRNA Sequence(s) |
|---|---|
| Col2a1 | gcggtagaaaggagcagcgg |
| ACAN | gaccgaggggcggccgacag |
| ZNF865 Guide 1 | ccgcacaaggatggatgagt |
| ZNF865 Guide 2 | gacgcccagagcgtgtcgcg |
| ZNF865 Guide 3 | gaggcgggcattcaaagcgc |
| ZNF865 Guide 4 | tcgcccaccggaatcggccc |
| ZNF865 Guide 5 | atcctccacgccggcgcctc |
| ZNF865 Guide 6 | acttccgcttccgggcgggc |
| ZNF865 Guide 7 | gcacttccggtcgggccctc |
| NTC | tttttaatacaaggtaatct |
