Reshaping psoriasis topical therapy: Continuous hydrogenation orchestrates ‘redox-metabolic homeostasis’ for efficient remission and relapse intervention

Abstract

Psoriasis represents a globally prevalent and chronic dermatological disorder, characterized by persistent hyperkeratosis, self-sustaining inflammatory cycles, and frequent relapse, posing substantial challenges for conventional therapies of compromised efficacy and biosafety. Here, we introduce a transformative strategy of hydrogen-mediated topical psoriasis therapy based on the construction of an in-situ formed, microbubble hydrogel that facilitates significant H₂ generation and subsequently prolonged delivery. By fabricating and incorporating MgH₂ nanoparticles into an amphiphilic, thermosensitive hydrogel via self-assembly in saline, the hydrogen evolution reaction, generated microbubble morphology and storage can be well controlled, reaching optimized H₂ release profile at saturated concentration (∼0.8 mM) over days. We demonstrate marked alleviation of psoriasis-like pathologies with this local hydrogen treatment in vitro and in vivo, revealing superior efficacy compared to both Imiquimod-induced mice model and clinical Calcipotriol drug. Mechanistically, we disclose continuous hydrogenation directly suppresses psoriatic keratinocyte hyperproliferation via anti-Warburg effect and energy metabolic reprogramming through the PKM2-mediated pathway, and meanwhile coordinating redox homeostasis restoration which further disrupts the inflammation-immune feedback loop. We also identify the potency of this H₂-regulated energy metabolism strategy in preventing psoriasis recurrence. Collectively, this work delivers a proof-of-concept of hydrogen-mediated psoriasis energy therapy (HPET) with translatable promise for potentiating long-term management.

Graphical abstract

Highlights

• •Engineered hydrogenated microbubble gel enables local, adequate, and durable H₂ release.
• •Mechanistic insights reveal H₂ selectively downregulates keratinocyte energy metabolism.
• •Topical hydrogen-mediated psoriasis energy therapy (HPET) mitigatesits onset and recurrence with high biocompatibility.

1. Introduction

Psoriasis is a common, lifelong, autoinflammatory disease affecting approximately 125 million people worldwide [1]. It is characterized by chronic, hard-to-cure, yet symmetrically distributed erythematous scales, papules, and plaques as its major manifestations. Psoriasis can cause joint deformities, erythrodermic and pustular psoriasis, and even leads to life-threatening disorders and complications [1]. Current severity-based treatments include conventional systemic therapies, biologics, and adjunctive topical medications [2]. While topical formulations—primarily glucocorticoids and vitamin D3 analogs like calcipotriol—remain the first-line pharmacotherapy for mild-to-moderate cases, their long-term use is severely limited by side effects such as skin irritation, atrophy, telangiectasia, and systemic calcium disturbance [3,4]. Worse still, despite the high efficacy of biological agents to eliminate the lesion, there appears to be an extremely high tendency for lesions to relapse after discontinuation of medication, making long-term psoriasis management more challenging. Hence, investigations into alternative therapeutic approaches for psoriasis and the prevention of its recurrence are encouraged, with improved biosafety and efficacy.

As far as the pathogenesis of psoriasis is concerned, the abnormal activation and hyperproliferation of keratinocytes (KC) drive psoriasis progression [5]. This hyperactivation is deeply intertwined with oxidative stress, abnormal glucose metabolism, and multifactorial inflammatory cytokine networks (e.g., TNF-α, IL-12/23, and IL-17) [1]. Elevated total oxidative stress, coupled with decreased antioxidant enzyme capacity (e.g., catalase(CAT) and superoxide dismutase(SOD)), exacerbates the disease [6]. With the presence of these cytokines, immune signaling pathways related to TNF-α, which are influenced by reactive oxygen species (ROS) [7], are recognized to be key candidates in modulating the keratinocyte proliferation in psoriasis [8]. Meanwhile, accumulating reports support the benefits of using antioxidant enzymes (CAT, SOD) to interrupt the formation of psoriatic lesions [9], suggesting that antioxidant stress medication may be promising for treating psoriasis vulgaris.

Among various emerging antioxidant agents, H₂ stands out as a biosafe modulator with selective scavenging effects of toxic ROS (·OH) and anti-inflammatory properties, as first discovered in Nature Medicine [9]. The therapeutic effect of H₂ on inflammatory diseases such as inflammatory bowel disease, pancreatitis, COVID-19, and tumors has been well documented, with increasing clinical trial reports recently[[10], [11], [12]]. Additionally, hydrogen bathing has been proven to alleviate skin lesions and pruritus in patients, improving flap survival rates [13]. Despite its potential, the low bioavailability of gaseous H₂, along with its uncovered therapeutic mechanisms, has largely hindered the widespread clinical applications of hydrogen medicine. Conventional approaches of systemic administration, such as inhaling high-pressure or drinking hydrogen water, have shown limited effectiveness due to the high diffusibility and low solubility of H₂ gas. Until lately researchers have started to lay focus on developing hydrogen-loading or -generating biomaterials for delivering H₂ gas in a more controlled fashion. Recent reported examples include the use of palladium hydride (PdH_0.2) nanocrystals [14], magnesium-modified microspheres (Mg@PLPE MSs) [15], and metallic magnesium bulk implant(MgG) [16] for H₂ gas therapy in combating cancers. Nevertheless, achieving safe, significant, and long-term H₂ delivery at the local lesion site remains an unresolved obstacle.

Bubbles present a natural form of gas-cored cavity surrounded by solid substances or bulk liquid. In the medical field and pharmaceutical industry, microbubbles, owing to the small size and unique structure, have been widely utilized as medical imaging agents and carrier systems designed for pharmaceutical, genetic, and gaseous delivery systems. Still, the generation and longevity of bulk tiny-sized bubbles could be problematic, as according to the Laplace theory, upon formation, they are subjected to a large additional pressure and thus may rapidly disappear even within seconds. Bubbles with high stability, uniform size, and good biocompatibility have been reported to successfully transport gaseous oxygen (O₂), nitric oxide (NO), and xenon (Xe)[[17], [18], [19], [20]], which nevertheless entails high cost and delicate production technology. Worse still, compared to other therapeutic gases, molecular hydrogen (H₂) exhibits one of the fastest diffusion because of its ultrasmall size and light weight, further aggravating the gas-escaping problem for efficient, long-lasting delivery.

In the present study, we develop an in-situ forming, microbubble hydrogel strategy enabling continuous hydrogenation for introducing a nascent, efficient modality of hydrogen-mediated psoriasis energy therapy (HPET) (Fig. 1), through the synthesis and employment of hydrogen-storage nanoparticles of MgH₂, which are subsequently incorporated into an amphiphilic, thermosensitive fast-gelling hydrogel. The obtained high-quality MgH₂ offers distinct advantages of good biocompatibility, and exceptional hydrogen loading capacity. Meanwhile, the amphiphilic, Pluronic-based gelator not only provides a moist environment to facilitate hydrolysis of MgH₂ for abundant production of H₂, but also serves as a stabilizing agent for the spontaneously generated gas bubble, preventing microbubble breakage and retarding H₂ gas escaping for realizing prolonged, localized hydrogen delivery. Noteworthily, the unique hydrogenated microbubble system of MgH₂-Gel can be facilely prepared by simple spraying/dip-casting at the skin lesion site via spontaneous self-assembly at the skin physiological temperature of 32°C-35 °C. With this system, we reveal the striking bioeffects of sustained hydrogenation on keratinocytes, the enhanced biosafety and therapeutic efficacy of the MgH₂-Gel in topical treatment of psoriasis vulgaris with compelling in vivo results. A systematic, previously unrecognized insight is gained into the underlying therapeutic mechanisms involving redox and energy regulation pathways. Notably, a shift of glucose metabolism from Warburg effect to tricarboxylic acid cycle is discovered, suggesting H₂-induced energy metabolic reprogramming plays a key role. Collectively, these findings, pioneering the proof-of-principle study of the hydrogen-mediated energy therapy, underscore the promise of an alternative management perspective focusing on psoriasis energy modulation by adopting an in-situ, long-acting hydrogenation design for combating psoriasis and its recurrence.

Fig. 1.

Schematic diagram of constructing the in-situ formed, long-acting hydrogen-release system (MgH₂-Gel) for topical hydrogen therapy in combating psoriasis (HPET therapy) in both occurrence and recurrence mice models. (A) MgH₂ nanoparticles with superior hydrogen loading are introduced into an amphiphilic, thermo-responsive hydrogel through simultaneous self-assembly at psoriasis lesion site. In contrast to the sol state with rapid gas escape, in situ generation and stabilization of bulk microbubbles in the gel network enables significant and sustained gaseous H₂ release for up to days. (B) In comparison with clinical drug calcipotriol, topical application of the as-prepared MgH₂-Gel is demonstrated of enhanced therapeutic efficacy and biosafety in psoriasis-like and relapse murine models, with insights into the H₂-mediated underlying mechanisms distinguished.

2. Results

2.1. Fabrication and characterization of the continuous H₂-releasing gel

It has been well demonstrated that Mg presents as a promising next-generation biodegradable metal of excellent biocompatibility, which offers high capacity of hydrogen storage with thermal stability, particularly in small size [21]. Herein, high-purity, submicron-scale magnesium hydride particles (MgH₂, denoted as HydroMg) were synthesized using the arc plasma evaporation method as we previously reported [22]. Transmission electron microscope (TEM) images of nano-MgH₂ revealed a spheroidal, polyhedron morphology, with an average size of ∼280 nm (Fig. 2B and C). The crystal structure of as-prepared MgH₂ was confirmed with XRD, as the characteristic peaks were consistent with the standard (JCPDS card no. 12-0697, Fig. 2D). Mg powders had almost completely transformed into MgH₂ hydride upon hydrogenation, barely leaving unreacted Mg or oxidized MgO. The thermal stability behavior of MgH₂ were characterized by TGA/DSC (Fig. S1–2). Meanwhile, the resultant powder was characterized with ca. 7.1 wt% hydrogen absorption at 450 °C, quite close to the maximum theoretical value of 7.6 wt%, which verified with an outstanding loading content of hydrogen. Of note, such a gas-phase synthesis approach could be scaled up to mass production of high-quality MgH₂ with controllable nanoscale size. To ensure long-term stability and batch-to-batch consistency, the MgH₂ nanoparticles are maintained in a dry, vacuum-sealed environment at room temperature prior to use.

Fig. 2.

Preparation, structure characterization, microbubble generation and hydrogen release profiles of MgH₂ and MgH₂-Gel. (A) Schematic illustrations of the evolution of H₂ gas in situ from MgH₂. (B) TEM image of MgH₂. (C) DLS measurement of MgH₂. (Insert image: photographs of MgH₂ particles. (D) XRD patterns of MgH₂. (E) Photographs of various gels at different temperatures and the stable microbubble MgH₂-gel at 12h after preparation. (F) The size distribution and micrographs of H₂ microbubbles generated by MgH₂-Gel at different times (Bar = 50 μm). (G) Local H₂ concentration profiles of H₂ gas released from the MgH₂-Gel with different concentrations of the amphiphilic gelators. (H) Cumulative Mg²⁺ release from the MgH₂ particles and MgH₂-Gel dispersed in 0.9% NaCl solution. (n = 3) (I) The change of pH value of the MgH₂ particles and MgH₂-Gel dispersed in 0.9% NaCl solution. (n = 3).

Subsequently, to deliver the as-synthesized hydrogen-storage MgH₂ particles to psoriasis lesions for continuous generation of H₂, a thermosensitive composite hydrogel with fast gelation was prepared by simply mixing MgH₂ nanoparticles at room temperature in normal saline (0.90% w/v NaCl). For this study, the gelator of polyoxyethylene–polyoxypropylene block copolymer (POE–POP–POE, Pluronic F-127) was prepared, as Pluronics are a class of non-toxic FDA-approved triblock copolymers with amphiphilic nature, which can undergo micellization and gelation with elevated temperature above its LCST (low critical solution temperature). The hydrogel fabrication, hydrogen generation and delivery process of the designated MgH₂-Gel system was schematically depicted in Fig. 2A, along with the resultant bubble gel displayed in Fig. 2E, revealing a distinct sol-gel phase transition between 22 °C and 35 °C, and exhibiting varied viscosity and thermal sensitivity depending on the various concentrations of the gelator (Fig. S3). The rheological data confirmed that the hydrogel transitioned from a low-viscosity liquid at 4 °C to gel at 25 °C and 35 °C (Fig. S4 and Table S1). The gel (25 wt%) exhibited rapid stabilization, reaching a firm gel state within 20 s at 35 °C. This rapid transition ensured that even if the formulation was applied in a semi-fluid state, it quickly set on the skin, enhancing the localized delivery of H₂ and improving patient compliance. The MgH₂ nanoparticles were then incorporated and uniformly distributed into the gel network through formation of large quantity of hydrogen bonding and ionic bonding with the ether groups in the Pluronic F-127 gelators. MgH₂-Gel was then obtained through a self-assembly, fast gelling process at skin physiological temperature. From infrared spectra data (Fig. S5), MgH₂-Gel was a mixture of MgH₂, and F127 gel, as indicated by their feature peaks at 500-850 cm⁻¹ (Mg‒H vibration of MgH₂), 945.97 cm⁻¹ (Mg-OH vibration of Mg(OH)₂) and 1083.15 cm⁻¹ (C-O-C vibration of F127). The gel matrix was exploited to play a dual role in this in situ hydrogenation system. In addition to supply aqueous environment for boosting MgH₂ hydrolysis for continuous hydrogen generation, the amphiphilic gelator also subsequently acted as a surfactant to stabilize the produced hydrogen microbubbles, according to the previously proposed skin theory [23]. Gas bubbles can be effectively covered with organic surfactants forming a skin or shell of the bubbles, which not only lowers the surface tension, but also protects the encapsulated gas from diffusion, thereby allowing for sustained release of hydrogen in this microbubble gel system.

Next, we investigated the effects of microbubble gel properties on gas loading capacities. Microbubble cavities in the as-prepared bubble gel system were immobilized with amphiphilic micelles, which reduced hydrogen bubble breakage and coalescence. Furthermore, a gel network encircling the bubble cavity served as a physical barrier, which slowed down gas diffusion further. The observed microscopic images of freshly-obtained bubbles in gel and its dynamic evolution are shown in Fig. 2F–S6, which clearly exhibited abundant microbubbles of nearly uniform distribution with an average diameter of 45 μm, indicating the designated gel system “locked” H₂ gas immediately and immensely. Moreover, even after 4 h and 12 h, the average bubble size only slightly changed to ca. 50 μm and 70 μm, respectively, and a significant number of intact gas microbubbles still retained and embedded in the gel. The presence of the unique H₂ peak in the microbubble-loaded hydrogel (Fig. S7), which provided direct evidence that the gas encapsulated and released by MgH₂-Gel was indeed hydrogen. In vitro hydrogen-release kinetics of different hydrogen delivery systems were determined by a hydrogen microsensor multimeter. As expected, MgH₂ nanoparticles placed in aqueous solution immediately brought about abundant hydrogen evolution in hydrolysis reaction, but with an undesirable, rapid burst release profile due to its high diffusibility and low solubility in solutions (Fig. S8). In contrast, as observed in Fig. 2G, a significant, continuous release of H₂ from an optimized formulation of MgH₂-Gel (25 wt/v %) could be well maintained for approximately 2 days, which was significantly prolonged as compared to that in aqueous solution. Moreover, the hydrogen release profile was facilely controlled by tuning the concentration of F-127 gelator, and sustained hydrogen release was obtained from a higher-concentration gelator (25 wt/v %) of adequate rheology to stabilize the self-generated bubbles, which was way more efficient than that of lower-concentration gelators (15 wt/v %). The results shown in Fig. 2H and I were in line with the trend of H₂ release, suggesting the optimized gel formulation also considerably restrained the excessive release of hydrolysis reaction byproducts (Mg²⁺ and OH⁻), which would be beneficial for improving biosafety and biocompatibility. To further validate this biosafety profile in vivo, we assessed the skin irritation potential of MgH₂-Gel in mouse models (Figs. S9–11), alongside histological analysis of major organs (Fig. S12). Moreover, human patch testing on a volunteer confirmed its non-irritating nature and safety for human skin (Fig. S13). Supported by these experimental and histological findings, the MgH₂-Gel met the criteria of the Chinese National Standard (GB/T 16886.23/ISO 10993-23) for the biological evaluation of medical devices with respect to skin irritation, as evidenced by a CMA (China Metrology Accreditation)-certified report (Supplementary Material_GB/T 16886.23 Report).

2.2. Hydrogenation suppresses hyperproliferation and glycolysis of HaCaT cells in vitro

In the etiopathogenesis of psoriasis, the abnormal activation and hyperproliferation of keratinocytes (KC) have long been recognized as a pivotal step in symptom manifestation. To assess the influence on the vitality and proliferation of keratinocytes, MgH₂ nanoparticles of different amounts were then co-cultured with keratinocytes (HaCaTs) by employing a transwell setup (Fig. 3A). As was revealed in Fig. 3B and C, the vitality of keratinocytes gradually diminished in parallel with the increment of MgH₂ concentrations. The intervention dose at which keratinocyte viability was inhibited by 50% in vitro was then determined as of 519.6 μg/ml.

Fig. 3.

Incubation with MgH₂ inhibits the proliferation, glucose metabolism, oxidative stress, and inflammatory response of HaCaTs. (A) Schematic representation of cells intervened by incubating with MgH₂. (B-C) The inhibition rates of HaCaTs after 24 h of treatment with different concentrations of magnesium hydride. Cell inhibition rate (%) = [1 - (OD _experiment - OD_blank)/(OD _control - OD _blank)] × 100. (D-E) Cell viability of HaCaTs by incubating with MgH₂. The Cell viability was calculated as (OD _experiment − OD _control)/(OD _control − OD _blank) × 100%) (F-G) Cells with EdU positive (%) were determined by EdU assay. (H-J) Representative Western blot and quantitative analysis of HIF-1α (I) and PKM2(J) expression in HaCaTs before and after MgH₂ inhibition. NC: Normal Control. (K-L) Changes of glucose and ATP content in HaCaTs treated with MgH₂ (n = 3). NC: Normal Control.

The optimal dose of MgH₂ nanoparticles for suppressing HaCaT proliferation was also tested at concentrations of 350 μg/ml, 500 μg/ml, and 700 μg/ml. Cell viability was assessed at 24 h, 48 h, and 72 h. With increased co-incubation periods (interfering time), a similar trend of markedly decreased viability was observed across all three concentrations (Fig. 3D and E). Specifically, the cellular capacity for DNA synthesis and proliferation was effectively inhibited at 500 μg/ml in HaCaTs (Fig. 3F–G and S14). The as-prepared MgH₂ nanoparticles was thus demonstrated with significant effectiveness in suppressing the vitalities and overproliferation of keratinocytes in vitro, presumably due to the long-term exposure to abundant hydrogen generated during reaction of MgH₂ in aqueous media, though may be coupled with the influence of other reaction byproducts.

Glycolysis and oxidative stress can synergistically interfere with keratinocyte proliferation. As reported, the hyperproliferation, abnormal differentiation, and metabolic hyperactivity of keratinocytes in psoriasis lesions are similar to that of tumor cells, relying on aerobic glycolysis, rather than tricarboxylic acid cycle to generate ATP, even when oxygen is available [24,25]. According to the evidence presented, the intervention in the KC glycolysis and its metabolic processes could be a potential therapeutic target for psoriasis. The specific inhibition of the glycolysis-related enzyme activity, such as the M2 isoform of the glycolytic enzyme pyruvate kinase (PKM2), may also impair KC proliferative capacity by promoting macrophage activation and increasing TNF-α secretion [26]. To explore the hypothesis of whether MgH₂ might exert an impact on the KC glycolysis, the expression of PKM2, an enzyme that serves as a pivotal rate-limiting factor in pro-inflammatory pathways, was measured via the Western blot assay. While a rise of PKM2 expression was found in the skin lesions of psoriasis, surprisingly, after exposed to MgH₂ (500 μg/ml) for 24 h, the expression of PKM2 drastically decreased to a great extent (Fig. 3H and I). To elucidate the targets of MgH₂ within this pathway, we utilized the STRING database to construct a protein-protein interaction (PPI) network for PKM2. This bioinformatic analysis identified HIF-1α (a key upstream regulator [27]) and LDHA (the enzyme responsible for the final conversion of pyruvate to lactate) as its closest interacting nodes (Fig. S15). Guided by these predictions, we subsequently evaluated their protein expression via Western blot. While MgH₂ significantly suppressed HIF-1α expression in HaCaT cells, LDHA protein levels remained largely unchanged (Fig. 3H and J, and Fig. S16). Despite stable LDHA expression, downstream lactate production, along with intracellular ATP and glucose utilization, markedly declined (Fig. 3K and L). This suggests that the reduction in glycolytic end-products is primarily driven by upstream substrate depletion—specifically, by a blockade at the PKM2 step—rather than by direct downregulation of LDHA protein. Collectively, these data indicate that MgH₂ specifically disrupts the hyperactive HIF-1α/PKM2 in keratinocytes.

To further corroborate the downstream metabolic consequences of PKM2 inhibition, untargeted LC-MS was performed to analyze the metabolites before and after MgH₂ intervention. As illustrated in the KEGG pathway classification (Fig. 4A), the differentially expressed metabolites were primarily clustered in “Carbohydrate metabolism” and “Energy metabolism”. Furthermore, KEGG enrichment analysis (Fig. 4B) highlighted significant alterations in specific pathways tightly linked to glucose utilization, including “Carbon metabolism”, the “TCA cycle”, and “Oxidative phosphorylation”. These downstream metabolomic shifts are highly consistent with our observed suppression of PKM2 and ATP production. Collectively, the LC-MS data provide metabolic evidence reinforcing our conclusion that MgH₂ restricts the hyperactive glycolytic flux in psoriatic keratinocytes.

Fig. 4.

Metabolic pathway analysis and the biological effects of MgH₂ in psoriasis models. (A–B) KEGG pathway classification and enrichment analysis of differential metabolites between MgH₂ and NC groups, highlighting significant alterations in energy and nucleotide metabolism. (C–D) Flow cytometric analysis and quantification of reactive oxygen species (ROS) levels in HaCaT cells treated with different concentrations of MgH₂. (E–G) RT-qPCR analysis of inflammatory cytokines TNF-alpha (E), CCL20 (F), and IL-1Beta(G) mRNA expression levels in HaCaT cells following MgH₂ treatment(n = 3).

2.3. ROS-scavenging and immunoinflammation remodelling in vitro

The pathological role of ROS and oxidative stress is attracting intensified attention during the formation and development of psoriasis, particularly in the step involving activation of transcription factors in keratinocytes [7]. To elucidate the antioxidative effects of MgH₂, we detected the quantification of ROS expression levels within HaCaTs upon subjected to co-incubation with MgH₂ nanoparticles of two concentrations (350 μg/ml and 500 μg/ml). ROS, which was inevitably generated as active free radicals (e.g. ·OH, ONOO⁻) during cellular metabolisms, are the primary substances causing oxidative damage to tissues upon excessive accumulation [28]. With the interference of MgH₂, the ROS levels declined substantially in HaCaTs, thus showing promise in restoring the intracellular redox homeostasis. Notably, with the treatment of 500 μg/ml MgH₂, a more striking decrease in the ROS expression was found when compared with that of the 350 μg/ml group (Fig. 4C and D).

It has been extensively acknowledged that elevated levels of ROS play a pivotal role in the onset, advancement, and resolution of inflammatory processes, accompanied by multifactorial inflammatory cytokines [1,29]. In an attempt to probe the potential inflammation modulatory effect, HaCaTs were pretreated with LPS. After a 30-min pretreatment, the cells were subsequently exposed to MgH₂ particles (500 μg/ml) and collected 24 h later. The RT-qPCR results of mRNA expressions of major pro-inflammatory cytokines, including TNF-α, IL-1β, and CCL20, key molecules in the formation of psoriasis lesion, indicated that MgH₂ pretreatment would lower their transcriptions under LPS stimuli (Fig. 4E–G). These results proved the potent ROS-scavenging and anti-inflammation characteristics of MgH₂ particles for HaCaTs.

2.4. The continuous H₂-releasing gel enables biosafe and remarkable lesion alleviation of IMQ-induced psoriatic mice

MgH₂-Gel, which was fabricated as above described with self-generation of bulk microbubbles “locking” hydrogen gas for sustained local release, had been identified as a non-skin irritant prior to the in vivo efficiency experiment. To explore the therapeutic effects on psoriasis administration, MgH₂-Gel was topically applied to the imiquimod (IMQ)-induced mice psoriasis model with different doses (1 mg/ml and 5 mg/ml), in comparison with the blank control group of IMQ (untreated) (Fig. 5A and B and S17). Apart from these, to further identify the contribution of local hydrogen supply from the MgH₂-Gel for psoriasis treatment, blank Gel, MgCl₂-Gel, and NaOH-Gel groups were also established as additional controls, and the release of reaction byproducts (namely, released Mg²⁺ and elevated alkalinity) during MgH₂-Gel application could be respectively distinguished in Fig. 5B and S18. The in vivo results clearly revealed that MgH₂-Gel of both concentrations improved the psoriasis-like lesion significantly. It is noteworthy that, in a short-term treatment regimen, magnesium hydrogen gel demonstrated a more rapid alleviation of psoriasis lesions compared to the clinical calcipotriol treatment. This finding indicates that magnesium hydrogen gel may offer a significant advantage in the expedited relief of psoriasis.

Fig. 5.

The therapeutic effect of MgH₂-Gel in topically treating psoriatic skin lesions of IMQ-induced mice. (A) A schematic illustration shows the therapeutic procedure of MgH₂-Gel in the psoriasis-like mouse model. (B) Morphological changes in psoriatic lesions of mice in different treatment groups at day 8 (n = 4-6). (C-F) PASI scores (C-E) and skin thickness (F) of mice in different treatment groups. MgH₂-Gel (L):1 mg/ml, MgH₂-Gel(H):5 mg/ml (G) H-E staining sections of mice in each group. CK-16, PCNA, and Ki-67 immunohistochemical sections of mice in each group were stained. Scale bar = 100 μm.

Moreover, even under low-dose MgH₂-Gel (1 mg/ml) intervention, the erythema (PASI: 3.16 vs 2.33) and scaling (PASI: 3.83 vs 1.16) of the psoriasis-like lesions were ameliorated, and meanwhile, the infiltration score of the lesions was reduced (PASI: 3.33 vs 1.33). Such desirable improvement in erythema (PASI: 3.16 vs 1.00), scaling (PASI: 3.83 vs 1.16), and lesion infiltration (PASI: 3.33 vs 1.00) of psoriasis-like lesions was more significant with high-dose MgH₂-Gel (5 mg/ml) intervention. The epidermal thickness significantly improved after MgH₂-Gel (1 mg/ml) and (5 mg/ml) treatment, respectively, as (0.735 vs 0.627 mm) and (0.735 vs 0.517 mm). For clear comparisons (Fig. 5C–F), a slight to mild amelioration of psoriasis-like lesions was achieved with the administration of calcipotriol therapy. No visible lesion changes were found in the blank Gel and NaOH-Gel groups, thus ruling out the possible impact of gel matrix and the alkaline pH. Intriguingly, the scale scores in the MgCl₂-Gel group were found slightly improved, which was presumably correlated to the anti-inflammatory effects of Mg²⁺ ions [30].

Hematoxylin-eosin (HE) and CK-16 immunohistochemical staining were used to assess the pathologic changes in different treatment groups. The HE staining results revealed that the skin tissues in the IMQ-induced mice presented typical psoriasis changes, which included hyperkeratinization accompanied with parakeratosis, acanthosis, elongated trochanterellus, and infiltrated inflammatory cells. These pathological manifestations thus demonstrated the successful establishment of the psoriasis mice model. CK-16 was recognized as the marker signifying the extent of hyperkeratinization of keratinocytes, of which low expression was usually found in normal skin [31]. In the IMQ group, a marked increase of CK-16 was observed. The treatment with MgH₂-Gel (5 mg/ml and 1 mg/ml) markedly led to a diminished hyperkeratinization, inflammatory infiltration, acanthosis, and CK-16 expression. The reduction extent was also positive correlated to the applied concentration of MgH₂-Gel. Meanwhile, the Calcipotriol group, as well as the blank Gel, MgCl₂-Gel, and NaOH-Gel groups, did not exhibit complete restoration despite the observed improvement (Fig. 5G and S19). All these findings manifested that MgH₂-Gel could effectively ameliorate the symptoms of psoriasis lesions. Furthermore, by comparison, it was clearly confirmed in vivo that the major therapeutic effects could be attributable to the continuous, local H₂ release, rather than blank hydrogel, or elevated pH, while Mg²⁺ might also play a slight, anti-inflammatory role in amelioration of skin lesions.

2.5. Local hydrogenation in vivo inhibits keratinocyte hyperproliferation and the Warburg effect via downregulating PKM2 expression

The bioeffects of MgH₂-Gel were further demonstrated via immunohistochemical staining of the skin lesions with PCNA and Ki-67. PCNA and Ki-67 are the cellular proliferation markers. As expected, these expressions of mouse keratinocytes were both greatly elevated in the IMQ-induced psoriasis group [32,33]. After the MgH₂-Gel treatment, we found a simultaneous reduction of both expressions in the keratinocytes (Fig. 5G). Notably, such changes in PCNA, and Ki-67 were not observed in the Calcipotriol, MgCl₂-Gel, NaOH-Gel groups, or blank Gel (Fig. 5G and S20), confirming the anti-hyperplasia capacity of MgH₂-Gel was only stemmed from sufficient hydrogen release.

Furthermore, MgH₂-Gel was found to down-regulate the nucleotide metabolism in psoriasis. Nucleotide metabolism is vital to cellular proliferation and differentiation, as it plays a crucial role in various physiological processes, including the regulation of carbohydrate metabolism. The increased demand for nucleotides by proliferating cells for the synthesis of ribosomal RNA, replication of the genome, and maintenance of the transcriptome puts nucleotide synthesis in a special position in proliferating cell metabolism [34]. LS/MS metabolomics was thus used for the analysis of the metabolite changes in the pre-and post-interference lesions with MgH₂-Gel (5 mg/ml) (Fig. 6A). As shown in Fig. 6B, the nucleotide metabolism-related metabolite levels in the IMQ-induced mice were elevated as compared with the normal controls, while a remarkable decrease of metabolite levels was revealing after MgH₂-Gel treatment, among which the change of Uracil/Adenine/dCMP/dAMP/UDP-GlcNAc metabolic levels achieved statistical significance. Taken together, it was reasonably speculated that the inhibition of KC growth activity by MgH₂-Gel was probably via the downregulation of nucleotide metabolism.

Fig. 6.

The underlying mechanism analyses of in vivo MgH_2-Gel treatment on inhibiting keratinocyte proliferation and regulating glucose metabolism, altered oxidative stress and inflammation levels in psoriatic lesions-like mice before and after treatment. (A) The changes in energy metabolites in psoriatic lesions pre and post MgH₂-gel intervention were analyzed by LC-MS/MS. (B) The level of nucleotide metabolism-related metabolite in psoriatic lesions treated with MgH₂-Gel was analyzed by LC-MS/MS. Unit: ng/g. (C-D) PKM2 protein expression levels in psoriatic lesions after MgH₂-Gel intervention. (E-F) Representative immunofluorescence images (E) and quantitative area percentage analysis (F) of HIF-1α in skin tissues from the IMQ-induced psoriasis model and MgH₂-Gel treated group. Scale bars = 100 μm. (G) The level of glycolysis in psoriatic lesions treated with MgH₂-gel was analyzed by LC-MS/MS. S-7-P: Sedoheptose-7-phosphate, D-R-5-P: D-Ribulose-5-phosphate, D-G-6-P: D-Glucose-6-phosphate, D-G-1-P: D-Glucose-1-phosphate, F-1,6-BP: Fructose-1,6-bisphosphate, P-A: Phosphoenolpyruvic-acid, S-A:succinic-acid. Unit: ng/g. (H) Differential abundance (DA) score analysis of KEGG pathways based on LC-MS/MS metabolomics data. (I) Schematic diagram of the role of KC inflammation feedback loop. (J) SOD and CAT in skin lesions after MgH₂-Gel intervention. (K-L) The expression of inflammatory factors in skin lesions treated with MgH₂-Gel.

The metabolic characteristics and activity are a pivotal determinant for the rate of keratinocyte proliferation [25].To investigate the effect of MgH₂-Gel on glycolysis in psoriatic lesions, PKM2 protein expression was detected with Western Blot assay. The expression of PKM2 was increased in psoriatic mice compared with normal controls, but could be greatly decreased after MgH₂-Gel treatment, which was consistent with the cellular results (Fig. 6C and D). Furthermore, we evaluated HIF-1α and LDHA expression. Mirroring the in vitro cellular findings, HIF-1α was significantly downregulated in the tissues of the MgH₂-Gel group, whereas the expression of LDHA remained largely unchanged (Fig. 6E and F, Fig. S21). These in vivo results align perfectly with our cellular experiments, further confirming that MgH₂-Gel modulates the glycolytic pathway.

To further elucidate the bioeffect of MgH2 on glucose metabolism, the group treated with MgH2-Gel (5 mg/mL) was used to investigate alterations in pertinent metabolites pre- and post-intervention. Metabolites associated with glucose metabolism in IMQ mice increased compared with normal control, and returned to homeostatic levels after MgH₂-Gel treatment.Metabolomic analysis revealed that succinic acid, a key tricarboxylic acid (TCA) cycle intermediate [35], was significantly decreased in IMQ-induced lesions but markedly upregulated following MgH₂-Gel treatment (Fig. 6G). α-ketoglutarate (AKG), another TCA cycle intermediate metabolite, showed a comparable restoration pattern. Conversely, lactic acid, the terminal glycolysis product, was upregulated after IMQ intervention and significantly downregulated by MgH₂-Gel treatment [36]. Differential abundance (DA) score analysis of KEGG pathways based on LC-MS/MS metabolomics data demonstrated significant enrichment of differential metabolites in the glycolysis pathway within psoriasis-like lesions compared to the MgH₂-Gel treatment group. In contrast, enrichment in other glucose metabolism pathways, including starch and sucrose metabolism and galactose metabolism, was reduced considerably (Fig. 6H). Notably, the galactose metabolism pathway can serve as an alternative to glycolysis with lower lactate yield [37]. Combined with the observed downregulation of the rate-limiting glycolytic enzyme PKM2, these findings indicate the presence of an aerobic Warburg effect—characterized by preferential glucose metabolism via glycolysis for proliferation despite oxygen availability—in IMQ-induced lesions. MgH₂ intervention effectively reprogrammed this metabolic phenotype.

2.6. Local hydrogenation in vivo evokes endogenous antioxidant expressions and disrupts the inflammation feedback cycle

The total oxidative stress levels in psoriasis are significantly elevated, accompanied by a decrease of CAT and SOD [6]. We found the expression of SOD (716.3 vs 538.4 U/mg) and CAT (26.55 vs 12.27 U/mg) in the skin lesions of IMQ mice was significantly reduced, but could return to the level of control after MgH₂-Gel treatment (Fig. 6J), indicating that MgH₂-Gel with continuous, controlled hydrogen delivery can effectively bring down oxidative stress levels in psoriatic lesions, in turn re-establishing endogenous redox homeostasis in vivo. To further corroborate these findings, we evaluated the levels of 4-hydroxynonenal (4-HNE), a well-established biomarker for tissue oxidative damage [38], in the skin lesions across the IMQ, MgCl₂-Gel, and MgH₂-Gel groups. As shown in Fig. S22, MgH₂-Gel intervention significantly reduced 4-HNE accumulation in tissues. In contrast, the MgCl₂-Gel treatment failed to exhibit a similar reduction, thereby underscoring the comprehensive superiority of the MgH₂ gel as a magnesium-based hydrogen-donating therapeutic system.

In response to oxidative stress, KC-derived cytokines (TNF-α, IL-1β, and IL-6) to stimulate DCs to secrete IL-23, which promotes TH17 cell differentiation and activation. As both initiators and amplifiers, KCs are activated and driven to hyperproliferate by inflammatory cytokines secreted from TH17 cells (IL-17 and IL-22) and inflammatory dendritic cells (DCs)(IL-23, nitric oxide (NO), and TNF), which thereby initiates and fuels a inflammation vicious cycle (Fig. 6I [6,39]. We applied high-throughput sequencing via a Quantibody mouse cytokine array to assess inflammation cytokines before and after the MgH₂-Gel intervention (Fig. 6K and L). The general expression of inflammatory cytokines experienced a sharp decline after the MgH₂-Gel intervention, verifying a potent anti-inflammatory effect in vivo. Notably, key cytokines central to the KC-driven inflammatory vicious cycle – including IL-6, IL-22, and IL-23 exhibited statistically significant reductions in expression following MgH₂-Gel treatment [40]. This comprehensive dampening of pro-inflammatory mediators underscores the potent anti-inflammatory efficacy of the localized hydrogen therapy.

2.7. The continuous H₂-releasing gel mitigates psoriatic mice relapse by targeting TRM residency and metabolic reprogramming

Following the schematic protocol provided in Fig. 7A and B, we identified the role of MgH₂-Gel in mitigating psoriasis relapse in a murine model of relapse. During the IMQ-induced phase, immunofluorescence staining revealed a remarkable reduction in the expression of CD69 and CD103—surface markers associated with the residency of tissue-resident memory T (TRM) cells, which play a key role in driving recurrence in situ (Fig. 7C–F). MgH₂-Gel treatment significantly attenuated the recurrence of psoriasis-like lesions, as evidenced by statistically improved PASI scores (Fig. 7G–I) and a reduction in epidermal thickness (Fig. 7J). Topical MgH₂-Gel administration notably attenuated key histopathological hallmarks of psoriasis in H&E-stained sections, including concomitant reductions in parakeratosis, acanthosis, and Munro microabscesses (Fig. 7K).

Fig. 7.

Long-term regulation of skin lesion severity to mitigate recurrence by MgH₂-Gel topical treatment in an IMQ-induced psoriasis-relapsed mice model. (A-B) Representative images showing skin appearance throughout the experimental timeline, from IMQ-induced inflammation (Days 1-7), the interval phase (Days 8-37), and relapse (Days 38-44), with MgH₂-Gel plus IMQ or IMQ as treatments (n = 6). (C-D) Immunofluorescence staining of CD69 (C) and CD103 (D) expression between IMQ-relapsed and MgH₂-Gel-treated groups. Bar = 1 mm; Enlarged image bar = 100 μm; (E-F) Quantification of CD69 (E) and CD103 (F) positive area percentages, showing decreased expression in the MgH₂-Gel group. (G-I) Quantification of erythema (G), scales (H), and infiltration (I) in IMQ-induced and MgH₂-Gel groups. (J) Measurement of skin thickness at Day 40. (K) H&E staining of skin at Day 40. Bar = 1 mm; Enlarged image bar = 100 μm; (L) Gene ontology (GO) enrichment analysis showing the rich ratio and gene number for various activities, highlighting key biological pathways. (M) Term candidate gene analysis for relevant metabolic processes, with significant association to keratinization pathways.

To elucidate the molecular mechanisms underlying the sustained therapeutic effect and potential prevention of relapse, we conducted RNA sequencing on skin lesions from the Relapse and Relapse + MgH₂ groups. Gene Ontology(GO)enrichment analysis of differentially expressed genes revealed robust enrichment in biological processes specifically related to mitochondrial proton-transporting ATP synthase activity and NADH dehydrogenase activity (Fig. 7L). Consistently, reactome enrichment analysis further demonstrated significant and coordinated regulation of pathways governing the tricarboxylic acid (TCA) cycle, mitochondrial respiratory electron transport, and keratinization (Fig. 7M). Collectively, MgH₂-Gel simultaneously targets TRM residency and metabolic regulation in psoriasis relapse.

3. Discussion and conclusion

Psoriasis is a chronic, immune-mediated disease driven by a dysregulated keratinocyte (KC) immune-inflammatory axis. Disrupting this pathogenetic vicious cycle is critical for achieving sustained remission [1]. Oxidative stress, inflammatory cytokines, and energy metabolism play a significant pathogenic role in the occurrence of psoriasis [6,24,25,39]. Despite advances in biologic agents and small molecular medicine therapies, disease relapse still frequently occurs at prior lesion sites. TRM residency is strongly related with psoriatic recurrence in situ as indicated by surface markers CD69 and CD103 expression [41,42]. Consequently, an unmet need remains for topical agents that concurrently target these tripartite pathogenic mechanisms while demonstrating high efficacy, safety, and tolerability to achieve lesion clearance and prevent recurrence.

In a recent clinical report, Ping et al. first demonstrated that the hydrogen generated during water electrolysis, combined with bathing therapy, effectively ameliorated the itching symptoms and lesions of psoriasis patients [39]. Nevertheless, the high expenses, complicated preparation procedures, and inconvenience to medication compliance largely hampered the further application of such hydrogen-water bathing treatment. Realizing sufficient and long-term H₂ delivery is vital to therapeutic efficacy and essential for clinical translation. However, traditional administration routes are hampered by the high diffusibility and low solubility of gaseous H₂. Despite the very recent progress in developing hydrogen-delivery biomaterials, their feasibility often suffers from inadequate local hydrogen supply or bearing biosafety concerns, thus imposing an unresolved obstacle at present. In this work, we came up with an innovative hydrogen microbubble gel imparting abundant and prolonged local delivery of H₂ for psoriasis treatment, along with the underlying therapeutic mechanisms clarified. Upon continuous generation of H₂ by spontaneous hydrolysis of MgH₂ in the saline-containing hydrogel, this light-weight, easy-escaping gas could be immediately “stored” and “locked” via amounts of stabilized microbubble formation within the gel matrix, thus restraining the burst release of H₂. It should be noted that the pathological environment of psoriasis is characterized by a slightly acidic condition. While our in vitro results in physiological saline provide a baseline for H₂ release, the localized acidic environment might slightly accelerate the initial hydrolysis of MgH₂. Moreover, the high diffusivity of H₂ ensures that it can bypass the thickened skin barrier to exert anti-inflammatory effects in the deeper dermis. However, in vivo direct quantification of hydrogen distribution across skin was difficult in the present study. This is primarily due to the intrinsic properties of hydrogen, including its extremely high diffusivity and optical invisibility, which preclude real-time detection in living skin using currently available technologies. As a result, assessment of hydrogen retention in gas-based therapies commonly relies on indirect evidence, such as sustained release kinetics and durable biological responses. The prolonged therapeutic efficacy observed in vivo in our study supports the biological relevance of localized hydrogen availability, while acknowledging that hydrogen spatial distribution awaits future technical advances. Moreover, hydrogel delivery represents a mature and highly biocompatible technology; it is non-invasive, causes no trauma to the skin, and ensures an excellent safety profile for topical application [43,44].

Mechanistically, this localized hydrogen treatment exerts its profound bioeffects not through a single pathway but through coordinated modulation of the oxidative, inflammatory, and metabolic microenvironments. First, we identified that MgH₂-Gel effectively disrupts the hyperactive metabolic state of psoriatic keratinocytes. Guided by STRING database predictions, we observed that MgH₂ intervention significantly downregulated the HIF-1α and PKM2. Interestingly, although the downstream enzyme LDHA expression remained unchanged, intracellular lactate and ATP production markedly declined, indicating that the reduction in glycolytic end-products is primarily driven by upstream substrate depletion following PKM2 blockade. Furthermore, our LC-MS and KEGG enrichment analyses confirmed that this intervention triggers a broader systemic metabolic shift that affects central carbon metabolism and the TCA cycle, thereby counteracting the Warburg-like metabolic reprogramming characteristic of psoriasis.

Concurrently, MgH₂-Gel robustly suppressed epidermal hyperproliferation (indicated by decreased PCNA and Ki67) and re-established endogenous redox homeostasis (evidenced by reduced 4-HNE). While the baseline anti-inflammatory properties of magnesium ions (Mg²⁺) are well evidenced [45,46], parallel evaluation of the MgCl₂-Gel control group revealed that Mg²⁺ alone failed to achieve significant reductions in PCNA, Ki67, or 4-HNE, nor did it drive extensive metabolic corrections. This distinct contrast suggests that the profound therapeutic efficacy observed is fundamentally driven by the synergistic integration of sustained H₂ release within the magnesium-based platform. Beyond acute lesion clearance, the MgH₂-Gel also exhibited significant potential in relapse intervention. It alleviates recurrence and downregulates T-cell residency, which plays a key role in recurrence.

Despite these highly encouraging outcomes, we acknowledge certain limitations in the present study. First, while our multi-omics and in vitro data demonstrate a strong association between H₂ intervention, glycolytic downregulation, and phenotypic improvement, these findings mainly demonstrate correlation rather than strict causality. Therefore, the underlying molecular causality regarding the specific mechanisms of MgH₂-Gel intervention in the occurrence and recurrence of psoriasis-like lesions (e.g., via genetic perturbation) remains to be further investigated. Second, our exploratory comparison against calcipotriol monotherapy demonstrated pronounced short-term amelioration of lesion severity; however, longer-term comparative studies with regimens aligned to clinical maintenance dosing are necessary to comprehensively evaluate overall long-term superiority. Importantly, standard chronic dermal irritation tests (GB/T 16886.23/ISO 10993-23) and organ histological analyses have confirmed the biosafety of the formulation, supporting its translational potential.

Taken together, we herein present a local, sustained H₂-generation and -delivery system with great biosafety that substantially ameliorate psoriasis-like symptoms and reduce psoriasis relapse in mice models. In conjunction of advantages of facile, cost-effective fabrication and ease of application, this in-situ hydrogenated microbubble gel treatment strategy holds great promise as a superior candidate for topical management of psoriasis, while comprehensive investigations of large-scale clinical trials for long-term use are required prior to its translation into clinical practice. Our proof-of-concept study not only reinforces the therapeutic potential of MgH₂-based biomaterials but also paves the way for diverse applications of hydrogen medicine in treating a variety of inflammatory skin diseases and oxidative stress-related disorders.

4. Materials and methods

4.1. Preparation of MgH₂ particles

MgH₂ powders of uniform sub-microscale dispersion (termed as HydroMg) were prepared using an Arc Plasma Evaporation apparatus. A procedure involving arc evaporation of pure Mg along with in-situ hydrogenation was employed as we reported previously [47]. In detail, commercially available pure Mg powders with 99.9 % in purity were first compressed at room temperature to construct cylinders by a uniaxial compressor under a pressure of 25 MPa. Then, these cylinders, as anode materials, were put into a reaction chamber filled with mixed Ar (0.75 atm) and H₂ gas (0.05 atm) after the chamber was evacuated to below 5 × 10⁻² Pa. The direct current is set at 140 A during arc evaporation. Finally, before being taken out from the reaction chamber, the as-prepared HydroMg particles were subjected to passivation in air.

4.2. Particle characterizations

The morphologies of MgH₂ were investigated by TEM (120 KV, Talos L120C G2, USA). The size distribution of MgH₂ was analyzed by the Nano ZS90 Series particle size analyzer. XRD data was measured by using a D8 DaVinci diffractometer (Bruker, Germany) operated at 40 kV.

4.3. Preparation of MgH₂-Gel system

15g, 20g, and 25 g of F127 (15 wt%, 20 wt%, 25 wt%) was added in physiological saline solution (0.9% NaCl, 100 mL) at 4 °C to fully dissolve to obtain temperature-sensitive hydrogel precursor solutions. The tube tilting method was performed to determine the GFT of gels. The sample solution (1 mL) was added to the sample tube and observed while slowly heating the tube in the water bath at the range of 20 °C-37 °C. At each temperature, samples were equilibrated for a moment and visually observed by tilting the tube. The MgH₂-Gel was prepared through a facile mixing and self-assembly method. Briefly, a blank gel was prepared by adding different amounts of F127 (Sigma-Aldrich, USA) into a physiological saline solution (0.9% NaCl). The mixture was stirred with a magnetic stirrer in a 4 °C refrigerator until a clear sol solution was formed. Then, it underwent gelling by mixing the MgH₂ particles, or MgSO₄ solution, or NaOH solution, and the blank gel solution was stored at 4 °C before use according to the designated concentration.

4.4. In vitro release kinetics of H₂, Mg²⁺ and alkalinity

The measurement was conducted in a wide-mouth cylindrical bottle where the hydrogel (1 mL, Concentration of MgH₂:1 mg/ml) was cast to completely cover the bottom, then adding 2 mL 0.9% NaCl solution. A calibrated hydrogen microsensor multimeter (MMS-903995, UNISENSE, Denmark) was vertically inserted through the bottle opening and positioned above gel (1 cm) precisely using a micromanipulator (Fig. S23). To examine the gas composition entrapped in the hydrogel, we conducted Gas Chromatography (GC) analysis using gas chromatograph (Nexi GC 2030, SHIMADZU, Japan) equipped with a Barrier Discharge Ionization Detector (BID). The values of H₂ concentration dissolved in saline, pH, and the concentration of Mg²⁺ were recorded at different time points using a hydrogen measurement meter (ENH-2000, TRUSTLEX, Japan), compact pH meter (LAQUAtwin-pH-22, HORIBA Advanced Techno, Japan) and Inductively Coupled Plasma analysis (iCAP6300, Thermo Fisher, USA), respectively.

4.5. Cell viability assay

Human immortalized keratinocytes (HaCaT) cell lines were obtained from the American Type Culture Collection (Manassas, MD, USA) and were cultured in Dulbecco's modified Eagle's medium (Gibco, Waltham, USA) supplemented with 10% FBS (Gibco, USA), penicillin (100 U/mL) and streptomycin (100 U/ml) (Gibco, USA). The cells were incubated in an atmosphere containing 5% CO2 and 37 °C humidified at 37 °C. The CCK8 kit (Dojindo, Japan) was used to evaluate cell viability following the manufacturer's instructions. After inoculating HaCaT cells into 96-well plates and cultured until reaching 40-50% confluence, the cells were treated with MgH₂ particles for periods of 8, 12, 24, 48, and 72 h, respectively. Each well was placed with 10 μL of CCK-8 solutions, followed by 90 μL of fresh medium, and the plates were incubated for 1 h at 37 °C. An enzyme marker (Multiskan GO, Thermo Fisher, USA) with a wavelength of 450 nm was used in the experiment.

4.6. Edu assay

Ribobio of China provided the EdU (5-ethynyl-2′-deoxyuridine) 488, Imaging Kit. The cells were treated with 50 M EdU at 37 °C for a duration of 2 h. Cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, USA) for 15 min before being permeabilized with 0.5% Triton X100 for 10 min. The Apollo 488 solution and Hoechst 33342 were then used to stain the cells. The ratio of EdU-positive cells (green cells) to total Hoechst-positive cells (blue cells) represents the cells' ability to synthesize DNA.

4.7. ATP production assay

The ATP content was assessed using the Enhanced ATP Assay Kit (Beyotime, China). After compression treatment, NPSCs were lysed with the ATP lysis buffer. Subsequently, the supernatant was harvested through centrifugation and subjected to a reaction with the ATP detection working dilution. (12,000 g, 5 min). The luminescence activity was detected by luminescence spectrometry (EnSpire, United States). The ATP level was normalized to cellular protein concentration.

4.8. ROS assay

The generation of ROS was measured by flow cytometry and 2′, 7′-dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma-Aldrich). For 24 h, media with varying doses of MgH₂ (350 μg/ml; 500 μg/ml) was treated with HaCaT (10⁵ cells/well). Prior to the treatment with DCFH-DA, cells were collected, centrifuged (at 1000 rpm for 5 min), and washed with 1 mL of PBS (20 M). After 20 min of incubation, the fluorescence was detected by flow cytometry (BD LSRFortessa, USA): excitation/emission wavelengths: 488 nm/525 nm.

4.9. Protein extraction and western blots

The separated epidermis or the pretreatment cells were subjected to total protein extraction using RIPA Lysis Buffer (Beyotime, China), which was enhanced with phenylmethanesulfonyl fluoride (1 mM) (Beyotime). BCA protein assay reagents were used to measure the protein concentration (Beyotime). The protein samples obtained were subjected to electrophoretic separation using a precast gel provided by Tanon (China). Following this, they were transferred onto a polyvinylidene fluoride (PVDF) membrane after the assessment of their concentration. β-actin and PKM2 primary antibodies (1:1000 each) and secondary antibodies (1:1000, Beyotime) were incubated on the membranes at 4 °C overnight, and for 50 min, respectively. The membrane was detected using an improved chemiluminescence technique following three washes with Tris-buffered saline with Tween (TBST) solution.

4.10. qPCR

The PCR primers were produced by BioTNT (Shanghai, China). Amplification reactions were carried out using SYBR Premix EX TaqII (Takara) on the 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The β-actin housekeeping gene was used to normalize gene expression, while the data were represented as fold differences by the 2^−ΔΔCt method, with ΔCt = Ct_{target gene} − Ct_β-actin, and ΔΔCt = ΔCt_induced − ΔCt_reference.

The primer sequences are as follows:

β-actin: forward primer 5′ TAAGGTGACAGCAGTCGGTT 3′, reverse primer 5′ TGTGTGGACTTGGGAGAGG 3’;

TNF-alpha: forward primer 5′ CAG GAC TTG AGA AGA CCT CAC 3′, reverse primer 5′ GTC TGG AAA CAT CTG GAG AGA 3';

CCL20: forward primer 5′ GAC ATA GCC CAA GAA CAG AAA 3′, reverse primer 5′ CCA GTG AGG CAC AAA TTA GAT 3';

IL1Beta: forward primer 5′ GAT ATG GAG CAA CAA GTG GT 3′, reverse primer 5′ AGG ACA GGT ACA GAT TCT TTT C 3';

CD69: forward primer 5′ GTA CGA GAA GTT GGA ATC ATC TG 3’, reverse primer 5′ GTT GTG GTG GAG AAG AAG TAA CAT 3';

CD103: forward primer 5′ TCT CCA GAT GTT CAG TGT GAT G 3’, reverse primer 5′ CTT GAG TAT GGG GTG ACC AAT 3'.

4.11. Psoriasis-like murine model induced by IMQ

Male BALB/c mice (7-weeks old) were acquired from Shanghai Jihui Laboratory Animal Care Co., Ltd. (Shanghai, China) and maintained under specific pathogen-free conditions in a controlled environment provided by the Department of Laboratory Animal Science, Fudan University (Shanghai, China). All animal experiments were meticulously executed in stringent adherence to the protocols outlined in the Guide for the Care and Use of Laboratory Animals, as mandated by Fudan University. The protocol was approved by the Animal Welfare and Ethics Group, Department of Laboratory Animal Science, Fudan University (Permit No. 2020-Huashan hospital-JS-294). The ethical principles of experimental animal welfare were followed throughout the entirety of the experimental protocols, and every effort was made to minimize animal suffering.

Each mouse was shaved on the back after 1 week of acclimatization feeding with an area of 2∗3 cm to induce skin inflammation. Every 24 h for 7 days, IMQ cream (5%) was applied to the shaved area on the back of the experimented mouse (50 mg/mouse), and the induced skin lesion was photographed and observed on day 8 to obtain the PASI score, and the dorsal skin thickness was measured using a digital micrometer (Mitutoyo) as well (randomly take measurements at three different locations on the skin and calculate the average). To be specific, all the mice in this study were divided into eight groups: group 1 (normal mice), group 2 (mice treated with IMQ only and induced psoriasis), group 3 (mice with psoriasis treated with 1 mg/ml MgH₂-Gel), group 4 (mice with psoriasis treated with 5 mg/ml MgH₂-Gel), group 5 (mice wihth psoriasis with calcipotriol), group 6 (mice with psoriasis with Gel intervention), group 7 (mice with psoriasis and with MgCL₂-Gel/intervention as a control) and group 8 (mice with psoriasis and NaOH-Gel intervention as a control). Groups 2, 6, 7, and 8 were designated as the negative control groups.

The murine model of psoriasis relapse was established as described by Shi et al. [48]. Imiquimod (IMQ; MedShine, Sichuan, China) at a dose of 62.5 mg was applied topically to the shaved area on the back of the mice for 7 consecutive days. Following a 30-day rest interval, IMQ (20.8 mg) was reapplied for 7 consecutive days to induce psoriasis relapse.

4.12. PASI scores

An objective scoring system was developed to assess the extent and severity of inflammation in the dorsal lesions in mice with psoriasis according to the PASI clinical criteria. Erythema and scale were graded on a scale of 0 to 4 (0, none; 1, mild; 2, moderate; 3, severe; 4, extremely severe).

4.13. Histopathology and immunofluorescence

The dorsal skin lesion samples in each group were collected on day 8 (occurrence)/day 48 (recurrence) and immobilized using a paraformaldehyde solution (4%). Subsequently, the paraffin-embedded fixed samples were dehydrated, dewaxed, rehydrated, and stained with hematoxylin and eosin (H&E). Besides, histopathological sections were examined with CK-16 (GB12804), PCNA (GB13010-1), and Ki67 (GB111141) antibodies. After reaction with these primary antibodies, the section samples were probed with appropriate secondary antibodies conjugated with horseradish peroxidase (HRP), followed by color development with diaminobenzidine (Dako, CA, USA), and restained with hematoxylin (Si).

4.14. Immunohistochemistry

Tissue samples were fixed in 4% paraformaldehyde and incubated with primary antibodies including rabbit anti-CD69 (Absinbio, abs136297), rabbit anti-CD103(Absinbio, abs118732). Following overnight incubation at 4 °C, samples were stained with secondary antibodies (Alexa Fluor 555 anti-rabbit IgG and Alexa Fluor 488 anti-mouse IgG, both 1:2000, Cell Signaling Technology) at room temperature. DAPI (Dako, Glostrup, Denmark) served as a nuclear counterstain. Slides were examined using a confocal laser scanning microscope (FV-1000, Olympus, Tokyo, Japan).

4.15. Liquid chromatography-tandem mass spectrometry (LC-MS/MS)

The meticulously thawed sample was accurately weighed to 50 mg and transferred into a 2 mL EP tube, with the addition of 500 μL of pre-cooled extractant (70% methanol aqueous solution). A small steel ball was also added to the EP tube. Following this procedure, the EP tube was homogenized 4 times at 30 Hz, for 30 s each time. After homogenization, the tube was shaken at 1500 r/min for 5 min, then stood for 15 min on ice, and subsequently centrifuged with 12000 r/min at 4 °C for 10 min. Finally, 200 μL of supernatant was put into the vial designated for subsequent LC-MS/MS analysis.

4.16. RNA sequencing analysis

Total RNA was extracted from full-thickness mouse skin samples using TRIzol reagent. RNA was extracted from PBMCs and prepared for transcriptomic analysis. mRNA was purified using oligo(dT)-coated magnetic beads and libraries were constructed for sequencing on the Illumina HiSeq 2000 platform, generating 50-nt single-end reads. Library quality was assessed using the Agilent 2100 Bioanalyzer, and raw reads were processed with Trimmomatic software for further analysis.

4.17. Measurement of glucose production and the SOD and CAT activities

SOD and CAT assay kits (Beyotime Biotechnology) were used for the evaluation of SOD and CAT activity, respectively. The glucose production was quantitatively analyzed utilizing the Glucose Assay Kit (Njjcbio, China), following the detailed protocol provided by the manufacturer.

4.18. Quantification of inflammation cytokine levels

Skin lesions from psoriatic mice, normal mice, and mice in the MgH₂-Gel group were processed and proteins were extracted according to the manual of Protein Array (Ray Biotech, Inc, USA). The custom Quantibody mouse cytokine array was used. This assay utilizes a multiplex sandwich enzyme-linked immunosorbent assay (ELISA) system featuring a membrane embedded with antibodies targeting specific cytokines or chemokines. The procedure followed the detailed protocol provided in the operation manual. Each cytokine-specific antibody was methodically arrayed in quadruplicate, with positive controls, negative controls, and internal controls similarly arranged. Data were extracted and analyzed using the RayBio QAM-TH17-1 software (RayBiotech, Inc.). For the cytokine levels below the assay sensitivity threshold, a value of 0 was used instead when comparing the levels.

4.19. Skin irritation test and in vivo biosafety evaluation

Four Balb/c mice were used to assess the skin irritation potential of MgH₂. The dorsal region was depilated using hair clippers 24 h prior to the initiation of the irritation experiment. MgH₂ was applied uniformly to the hairless skin regions (area A and D for 5 days, while the hairless skin regions (area B and C) were left untreated for the sake of comparisons (Fig. S10). After the application of MgH₂, the hairless skin was observed for any possible reactions, mostly redness, and erythema. During this skin irritation test, we referred to the scoring criteria (irritation index) in ISO-10993-10, in which a score of erythema and edema (ranging from 0 to 4) was recorded to reflect the extent of irritation. As illustrated, an irritation index lower than 0.4 indicated negligible irritation.

To further evaluate the systemic biosafety, histological analysis of major organs was also conducted. The mice were assigned into three groups: the control group, the Gel group (treated with blank gel), and the MgH₂-Gel group. Major organs including the heart, liver, spleen, lung, and kidney were harvested, sectioned, and subjected to standard histological examination (H&E staining) to observe any potential systemic toxicity or pathological tissue damage.

4.20. KEGG pathway enrichment analysis

The KEGG database is a useful tool for comprehending the important roles and uses of the biological system. We tested the statistical enrichment of differentially expressed genes in KEGG pathways utilizing the KOBAS software platform. The KEGG pathways that were highly enriched in comparison to the background of the entire genome were discovered using the Cluster Profiler R tools. Pathways that were highly enriched in differentially expressed genes were those having a Q value of 0.05.

4.21. Statistical analyses

Data are presented as the mean ± standard deviation (SD). Statistical analysis was performed using SPSS software (version 18.0; IBM, USA). Comparisons between two groups were analyzed using the unpaired two-tailed Student's t-test. For comparisons among multiple groups, one-way analysis of variance (ANOVA) was applied. Importantly, to correct for multiple comparisons, Tukey's test was applied post hoc to assess the statistical significance of specific group pairs. A P-value of less than 0.05 was considered statistically significant.

CRediT authorship contribution statement

Lanmei Lin: Writing – review & editing, Writing – original draft, Methodology, Conceptualization. Qingqing Guan: Writing – original draft, Methodology, Data curation. Zhiguang Ding: Methodology, Data curation. Jianxin Zou: Methodology, Data curation. Canbin Dong: Visualization. Xinyi Zhu: Visualization. Weijian Fan: Data curation. Han Li: Methodology. Jinhua Xu: Supervision. Jinyun Tan: Methodology. Wenjiang Ding: Supervision. Jia Pei: Writing – review & editing, Supervision. Juan Du: Writing – review & editing, Supervision, Methodology.

Ethics approval and consent to participate

All animal experiments were approved by the Ethics Committee of Huashan Hospital (approval no. 2020 JS-294), and carried out in line with the guidelines outlined in the Declaration of Helsinki. As this study did not involve human participants, consent to participate was not applicable.

Funding sources

National Natural Science Foundation of China: 82573961,52222108.

National Key Research and Development Program of China: 2023YFC2508103, 2024YFB4610100.

The Scientific Research Project of Shanghai Science and Technology Commission (Shanghai Natural Science Foundation): 24ZR1407800,22ZR1432000, 23JC1402400.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article.

Data availability

The data are included in the article and its Supporting Information. Further inquiries may be directed to the corresponding author.