TABLE 1.
PCR primers for detection of oral treponemes
Specificitya | Sequences (5′ to 3′) | Orientation | Position (bp)b | Product size (bp)c | MgCl2 (mM) | Annealing temp (°C) |
---|---|---|---|---|---|---|
T. denticola | TAATACCGAATGTGCTCATTTACAT | Forward | 131-155 | 860 | 1.5 | 62 |
CTGCCATATCTCTATGTCATTGCTCTT | Reverse | 964-990 | ||||
T. vincentiid | GTCTCAATGGTTCATAAGAA | Forward | 202-221 | 851 | 2.0 | 62 |
CAAGCCTTATCTCTAAGACT | Reverse | 1033-1052 | ||||
T. mediumd | CACTCAGTGCTTCATAAGGG | Forward | 145-164 | 851 | 1.5 | 62 |
CCGGCCTTATCTCTAAGACC | Reverse | 976-995 | ||||
TTe | TTACGTGCCAGCAGCCGCGGTAAC | Forward | 657 | 1.5 | 69.5 | |
GTCRYMGGCAGTTCCGCCWGAGTCf | Reverse | |||||
Ubiquitousg | GATTAGATACCCTGGTAGTCCAC | Forward | 733 | 1.5 | 52 | |
TACCTTGTTACGACTT | Reverse |
GenBank accession numbers are as follows: T. denticola, D85438; T. vincentii, AF033309; and T. medium, D85437.
Forward primer for total treponemes: T. denticola, 479 to 502 bp; forward primer for T. vincentii, 540 to 563 bp; and forward primer for T. medium, 483 to 506 bp. Reverse primer for total treponemes: T. denticola, 1113 to 1136 bp; reverse primer for T. vincentii, 1174 to 1197 bp; and reverse primer for T. medium, 1117 to 1140 bp. Forward primers for ubiquitous are as follows: for T. denticola, 754 to 776 bp; for T. vincentii, 815 to 837 bp; and for T. medium, 758 to 780 bp. The reverse primer for ubiquitous is designed in the region between the 16S and 23S gene.
Expected size of PCR product.
These primer sequences are indicated in reference 24.
TT, total treponemes.
International Union of Biochemistry code: R, A+G; Y, C+T; M, A+C; and W, A+T.
This primer sequence is indicated in reference 15.