Abstract
OBJECTIVE:
To investigate the role and potential molecular mechanisms of transcutaneous auricular vagus nerve stimulation (taVNS) in post-traumatic stress disorder (PTSD).
METHODS:
A single prolonged stress (SPS) model of PTSD was used to conduct behavioral tests and evaluate the effects of taVNS on the emotion-cognitive function in PTSD animals. Focusing on the prefrontal cortex-hippocampus brain region, we systematically evaluated the growth status of neurons and astrocytes, as well as the level of microglial-mediated neuroinflammation. Key indicators of the nuclear factor erythroid 2-related (NRF2)-heme oxygenase-1 (HO-1)-glutathione peroxidase 4 (GPX4) signaling pathway were detected and analyzed. Additionally, immune and oxidative stress levels in peripheral plasma were also assessed.
RESULTS:
Two weeks of taVNS significantly improved the abnormal emotion-cognitive function in PTSD animals and partially inhibited peripheral oxidative stress injury and immune-inflammatory responses. Compared with the prefrontal cortex, taVNS markedly alleviated hippocampal neuron loss, microglial activation, and astrocyte dysfunction in PTSD rats, suggesting that the NRF2-HO-1-GPX4 signaling pathway may play a critical role in this process.
CONCLUSION:
taVNS extensively modulates the functions of neurons and glial cells by regulating both central and peripheral oxidative stress and immune-inflammatory responses, thereby ameliorating the abnormal emotional and cognitive functions observed in PTSD animals.
Keywords: post-traumatic stress disorder, oxidative stress, immune-inflammatory responses, transcutaneous auricular vagus nerve stimulation
1. INTRODUCTION
Post-traumatic stress disorder (PTSD) is a complex psychiatric condition that is frequently triggered by exposure to catastrophic events that elicit acute stress responses.1 According to the World Health Organization, approximately 25% of individuals exposed to major societal upheavals or natural disasters are diagnosed with PTSD.2-5 Current therapeutic approaches primarily involve psychotherapy and pharmacological interventions. However, the efficacy of psychological treatments remains suboptimal, and pharmacological therapies have significant limitations.6,7 To date, the U.S. Food and Drug Administration (FDA) has approved only two selective serotonin reuptake inhibitors (SSRIs), paroxetine and sertraline, for treatment of PTSD. Notably, these medications may be ineffective for approximately 50% of patients.8,9 In light of the limitations of conventional treatments in clinical practice, the development of safe, effective, and non-invasive alternative interventions holds profound scientific and clinical significance.
Clinical studies have revealed significant alterations in both brain structure and functional connectivity in PTSD patients relative to healthy controls.10 Structurally, reduced hippocampal volume has been consistently observed in PTSD populations compared with healthy participants, and this reduction correlates strongly with emotional dysregulation and cognitive impairment.11,12 Concurrently, diminished activation in the prefrontal cortex (PFC)-anterior cingulate cortex (ACC) circuitry has been documented, suggesting that these regions mediate hyperactive fear and threat responses.13 Functionally, aberrant activity patterns in the PFC, hippocampus (HIP), and insular cortices characterize PTSD patients.14 Notably, reduced PFC and subcallosal cortex activity in trauma survivors correlates inversely with symptom severity during trauma recall, while optogenetic studies demonstrate that direct activation of these regions accelerates fear extinction.15,16 These converging lines of evidence identify the PFC and HIP as pivotal pathological substrates in PTSD pathophysiology.
The neuropathological mechanisms of PTSD involve intertwined oxidative stress and neuroinflammatory pathways. Excessive reactive oxygen species (ROS) production generates oxidative mediators that disrupt lipids, proteins, and nucleic acids, precipitating ferroptosis, neuronal apoptosis and necrosis.17,18 In parallel, neuroinflammatory processes involve microglial activation; inflammatory activation triggers microglia to release pro-apoptotic cytokines that suppress hippocampal neurogenesis while promoting dentate gyrus neuronal death.19 Clinically, PTSD patients exhibit elevated systemic oxidative stress biomarkers and inflammatory cytokines.20,21 Animal models corroborate these findings, demonstrating increased ROS production and neuroinflammation within the PFC and HIP regions, accompanied by neuronal degeneration in these key circuits.22,23 Therefore, the prevailing view current consensus identifies oxidative stress and neuroinflammation as dual early drivers of PTSD progression.24
As a master regulator of cellular redox homeostasis, nuclear factor erythroid 2-related factor 2 (NRF2) orchestrates oxidative stress responses and neuroinflammatory pathways, functioning through its downstream target heme oxygenase-1 (HO-1).25 Glutathione peroxidase 4 (GPX4), a lipid repair enzyme and stress-inducible protein acting as a downstream target of HO-1, plays a critical role in the regulation of ferroptosis. Prolonged stress activates both central and peripheral immune cells, inducing Nucleotide-binding oligomerization domain, leucine-rich repeat and pyrin domain-containing 3 (NLRP3) inflammasome-mediated inflammatory responses.26,27 Accumulating evidence positions the NRF2-HO-1 axis as a convergence point for oxidative stress and inflammatory signaling, where NRF2 dependent upregulation of HO-1 serves as a negative regulator of NLRP3 activation.28 Experimental evidence reveals that conditional fear-based PTSD modeling induces significant downregulation of NRF2-HO-1 protein expression, suggesting an impaired antioxidant defense system.29 Given that oxidative stress and neuroinflammation represent two interdependent pathological hallmarks of PTSD, targeted modulation of these pathways may represent a rational therapeutic strategy.30
As a somatic treatment approved by FDA, vagus nerve stimulation has been widely used for mental disease.31 Given that the auricular branch of the vagus nerve comprises fibers projecting to the solitary tract nucleus and plays a role in modulating the functions of multiple emotion-related brain regions, including the PFC, hypothalamus, hippocampus, and amygdala.32 Our research group initially concentrated on the application of transcutaneous auricular vagus nerve stimulation (taVNS) for treating brain-related diseases. A series of published studies have demonstrated that taVNS therapy exhibits significant therapeutic effects on central nervous system disorders such as depression, insomnia, and mild cognitive impairment.33-36 In preclinical studies, certain investigations have also revealed that taVNS therapy exerts a substantial regulatory influence on the brain immune system of animal models with depression.18,35 Given the substantial overlap in the pathophysiological mechanisms between depression and PTSD, taVNS may also hold promise for modulating PTSD-related dysfunctions.37 Preliminary clinical evidence supports this hypothesis, with reports of vagus nerve stimulation (VNS) alleviating core PTSD symptoms, such as hyperarousal and fear memory retention.38 Accordingly, we observed the effect of taVNS on emotion-cognitive integration in animal models of post-traumatic stress disorder, with a focus on clarifying its underlying mechanisms, especially its anti-inflammatory and antioxidant properties.
In this study, we induced PTSD-like behaviors in rats using the single prolonged stress (SPS) model and administered a 14-d course of taVNS. Behavioral analyses demonstrated that taVNS significantly enhanced emotional regulation and cognitive function. Biochemically, taVNS reduced hippocampal neuronal apoptosis, suppressed microglial activation, alleviated oxidative stress, and restored astrocytic integrity. Mechanistically, taVNS upregulated the NRF2-HO-1-GPX4 axis, which inhibited NLRP3 inflammasome activation, thereby orchestrating anti-inflammatory and antioxidant effects within prefrontal-hippocampal regions. These findings indicate that taVNS represents a promising neuromodulatory strategy for managing PTSD via NRF2-HO-1-mediated redox-neuroinflammatory regulation.
2. MATERIALS AND METHODS
2.1. Experimental animals
A total of 40 male Sprague-Dawley (SD) rats weighing 70-90 g [postnatal days (PND) 21] were purchased from Vital River Laboratory Animal Technology Co., Ltd., Beijing, China. Animals were maintained at a temperature of (22 ± 2) ℃, humidity of 65% ± 5%, and housed under a 12-h light-dark cycle with ad libitum access to food and water. This study was approved by the Ethics Committee of the institute of Basic Theory for Chinese Medicine, China Academy of Chinese Medical Sciences (No. IBTCMCACMS-2505003). All animal procedures were performed in accordance with the regulations of the Institutional Animal Care and Use Committee.
2.2. Experimental design
In our experiment, rats were randomly divided into four groups (10 each group): Control (Con), SPS (Mod), SPS + isoflurane (Iso), SPS + isoflurane + taVNS (taVNS). Animals were acclimated from PND 21 to 28. Excepted Group Con, all the rats would be exposed to SPS at PND 28 d and followed by a one-week “no-touch” sensitization period from PND 29 to 36, during which animals were left undisturbed except for routine husbandry. Behavioral tests were performed on PND 36 to verify successful establishment of PTSD-like phenotypes. After model validation, from PND 42 to 55, rats in the taVNS group received taVNS once daily under isoflurane anesthesia for 30 min/d for 14 consecutive days, while rats in the Iso group received matched isoflurane anesthesia exposure (30 min/d for 14 d) without taVNS. During the intervention period, rats in the Iso and taVNS groups were co-housed under identical environmental and husbandry conditions and were distinguished by tail marking to minimize cage and environment-related confounders. Con and Mod groups were maintained under standard housing conditions during this period. Behavioral tests were repeated on PND 55 to evaluate treatment-related effects. Finally, animals were euthanized on PND 60 for tissue collection, followed by biochemical analyses.
2.3. Animal models
Animal modeling was performed as previously described:14,15 the rats were restrained for 2 h and then immediately forced to swim for 20 min. Subsequently, the rats were placed in an anesthesia chamber and anesthetized with isoflurane for 15 min and followed by a one-week “no-touch” sensitization period.
2.4. taVNS treatment
The taVNS group was administered taVNS for 14 consecutive days. An electroacupuncture apparatus (HANS-200A, Nanjing Jisheng Medical Technology Co., Ltd., Nanjing, China) was used for stimulation. During the intervention, the rats were continuously anesthetized with 2% isoflurane inhalant (Hebei Nine Sent Pharmaceutical Co., Ltd., Shijiazhuang, China). Subsequently, two opposite magnetic electrodes (±) were merged with a homemade metal ear splint (20 mm in length, 5 mm in width, and 1 mm in thickness) and connected to the auricular concha to form an electronic circuit 37. The stimulation parameters are as follows: (a) stimulation frequency: 2/15 Hz (2 and 15 Hz, switched every second); (b) stimulus intensity: 2 mA; (c) stimulation duration: 30 min per day.
2.5. Behavioral testing
All rats in each group were selected for behavioral testing. Rats were placed in the test chamber for 1 h prior to testing to allow acclimatization to the environment. The whole experiment process was recorded by a camera and analyzed by the SMART v3.0 (Panlab, Barcelona, Spain).
Open field test (OFT). A plain, 80 cm × 80 cm × 50 cm open field arena was used to assess the locomotor activity and anxiety-like behavior. The arena was placed under an overhead camera, and the tracking software was configured to define the arena boundaries and the central zone (48 cm ×48 cm). Gently place the rat in the center of the arena, facing a consistent direction to minimize bias. Immediately initiate video recording and tracking. Allow the subject to explore freely for the predetermined duration without interference. Monitor remotely to ensure safety, avoiding any presence that could influence behavior. After a 5-min recording, gently remove the rodent and return it to a home cage.
Elevated plus maze test (EPM). Anxiety-like behavior was measured using the elevated plus maze (100 cm length, 10 cm width, 50 cm height). The closed arms were enclosed by a black wall 20 cm in height. Gently place the rat in the central platform, facing a closed arm. Initiate video recording immediately. Allow free exploration without interference; the experimenter should remain out of sight, minimizing movement and noise. Conduct trials during the light phase of the cycle. After a 5-min recording, gently remove the rodent and return it to a home cage.
Novel object recognition (NOR). The NOR test was performed according to previous protocols.38 Briefly, the test was performed in an open field arena (80 cm × 80 cm × 50 cm). Objects were fixed to the open field arena and had different shapes, sizes and textures. The NOR test consists of two stages. During a 5 min acquisition phase, the animals were placed at the center of the arena in the presence of two identical objects (height: 10 cm; base diameter: 10 cm). After 2 h, a 5 min retrieval phase was conducted and one of the two familiar objects was replaced by a novel object (10 cm × 10 cm × 10 cm). The time spent exploring familiar and novel objects was recorded and analyzed. The apparatus was cleaned with 75% ethanol after each test. The “discrimination index” was calculated by the following [(novel object time)/(novel object time + familiar object time)]. Object exploration was defined when the rats touch the object with its head within 2 cm or less, and actively explore the objects.
Passive avoidance test. The passive avoidance test comprised two equally sized and shaped compartments (20 cm × 20 cm × 50 cm) with distinct illumination levels: a light chamber (295 lux) and a dark chamber (0 lux). The compartments were separated by a Plexiglas wall (20 cm × 50 cm), featuring a 3 cm × 5 cm aperture at the base to facilitate movement between the chambers. Electric shocks were delivered to the grid floor in dark chamber with a stimulator (50 Hz, 2 s, 1 mA intensity). This test has two stages, instruction and memory test. In stage one, each rat was placed in the larger illuminated compartment and after 5 s, the door was opened and the rats were allowed to move freely between the light and dark chamber. Upon entry into the dark chamber, the door was closed and the rat was given 2 mA electrical shock in 3 s. After 300 s, the rat was returned to its home cage. If the rats did not enter the dark compartment during 300 s, it would be removed from the test. In stage 2, which was performed 24 h after stage one, each rat was re-tested in the same way, without stimulation, based on instruction in stage one and the delay in entering the dark compartment was recorded to a maximum of 300 s.
2.6. Enzyme-linked immunosorbent assay (ELISA)
On postnatal day 60, rats were humanely euthanized under deep isoflurane anesthesia. The abdominal blood collection from rats was placed overnight at 4 ℃ and separated by centrifugation at 3000 r/min, 10min for the collection of the upper serum. ELISA kits for interleukin (IL)-1β(KQ112342), IL-4 (KQ112352), IL-6 (KQ112354), IL-10 (KQ105587), IL-12 (KQ112332), tumor necrosis factor-α (TNF-α) (KQ105392), malondialdehyde (MDA) (KQ105475), glutathione (GSH) (KQ112457), superoxide dismutase (SOD) (KQ114167), catalase (CAT) (KQ112470) and ROS (KQ141838) proteins were purchased from Shanghai Keqiao Industrial Co., Ltd., Shanghai, China. The test was in accordance with the kit instructions. Absorbance was measured at 450 nm using an enzyme marker (Thermo Fisher, Waltham, MA, USA).
2.7. Nissl staining
The PFC and HIP were precisely dissected according to the anatomical coordinates defined in the Paxinos and Watson’s rat brain atlas. 4-μm coronal cryosections were stained with Nissl staining solution (Beyotime, C0117, Shanghai, China) for 5 min at 37 ℃. Then samples were washed using 95% ethyl alcohol for 5 min and dried. Sections were then washed twice in xylene for 5 min. After being sealed with neutral balsam, the slides were observed under an optical microscope (Axio Image A2; Carl Zeiss, Germany) by a blinded investigator.
2.8. Western blotting (WB)
Proteins were extracted from the PFC and HIP regions of rat brains. The samples were incubated overnight at 4 ℃ with primary antibodies against NRF2 (1∶1000, 33649S, CST, Danvers, MA, USA), HO-1 (1∶1000, ab189491, Abcam, Cambridge, UK), NLRP3 (1∶1000, ab263899, Abcam, Cambridge, UK), IL-1β (1∶1000, ab283818, Abcam, Cambridge, UK), GPX4 (1∶1000, ab125066, Abcam, Cambridge, UK), and β-actin (1∶3000, GB15001, Servicebio, Wuhan, China). Subsequently, the samples were incubated with horseradish peroxidase-conjugated anti-rabbit (1∶10000, GB23303, Servicebio, Wuhan, China) or anti-mouse (1∶10000, GB23301, Servicebio, Wuhan, China) secondary antibodies for 1 h at room temperature (22-25 ℃). Protein bands were visualized using an enhanced chemiluminescence kit (ChemiDoc Touch V3 Western Blot Workflow Bio-Rad Life Science, Hercules, CA, USA) and quantified with ImageJ software (National Institutes of Health, Bethesda, MD, USA). Band intensities were normalized to β-actin levels.
2.9. Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA from the tissue samples was isolated using TRIZOL reagent (G3013 Servicebio, Wuhan, China). Reverse transcription was performed using the MonScript RT Ⅲ Kit (Monad, Suzhou, China). Gene expression was determined using SYBR Green reagents (Shanghai Yeasen BioTechnologies, Shanghai, China) on a PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Gene expression levels were normalized to β-actin mRNA using the 2-ΔΔCt method. All designed primers were described in previous literature and checked using Primer-BLAST for specificity binding. The primer sequences used are listed. For β-actin, the forward primer is “CCCGCGAGTACAACCTTCTTG” and the reverse primer is “TCATCCATGGCGAAC-TGGTGG”. For NRF2, the forward primer is “CCACTGCTCCGACTAGCCAT” and the reverse primer is “AATCAAATCCATGTCCTGCTGGG”. For HO-1, the forward primer is “AGGGAAGGCTTT-AAGCTGGTG” and the reverse primer is “GGGCA-TAGACTGGGTTCTGC”. For NLRP3, the forward primer is “CTGCAGAGCCTACAGTTGGG” and the reverse primer is “ACCCTACACTAAAAGCGCCC”. For GPX4, the forward primer is “CCGGCTACAA-TGTCAGGTTT” and the reverse primer is “ACGCAG-CCGTTCTTATCAAT”.
2.10. Immunofluorescence and image analysis
Brains were paraffin-embedded to investigate the localization of Connexin 43 (Cx43) and Ionized calcium binding adapter molecule 1 (Iba-1) using immun-ofluorescence (IF) staining. The brain sections were incubated with rabbit anti‐Cx43 (1∶250, 83649S, CST, Danvers, MA, USA) and rabbit anti‐Iba-1 antibodies (1∶250, 17198S, CST, Danvers, MA, USA, Danvers, MA, USA) at 4 ℃ overnight. The sections were then incubated with goat anti-rabbit (1∶500, 8889S, CST, Danvers, MA, USA) and goat anti-rabbit (1∶500, 4412S, CST, Danvers, MA, USA) secondary antibodies at room temperature for 1 h. Finally, the sections were incubated with DAPI (1 ng/μL, Solarbio, Wuhan, China) for 5 min at room temperature. Fluorescent signals were detected using a confocal fluorescence microscope (FLUOVIEW FV1200 Olympus, Tokyo, Japan). Images were analyzed using standardized settings across groups.
2.11. Statistical analysis
Data were presented as mean ± standard error of the mean (SEM) and analyzed with GraphPad Prism 10.0 (GraphPad Software, San Diego, CA, USA). Data were expressed as mean ± SEM in the experiments of behavioral tests, ELISA, Nissl staining, qRT-PCR and western blot, which were analyzed by one-way analysis of variance for repeated measurements. Once F ratios were significant, post hoc comparisons were made with the Tukey post hoc test. Differences between individual means were tested for significance according to Fisher’s least significant difference procedure. GraphPad Prism 10.0 (GraphPad Software, LLC, San Diego, CA,USA) was also used to perform correlation analysis between biochemical indicators and behavioral parameters. P < 0.05 was considered statistically significant.
3. RESULTS
3.1. TaVNS ameliorates anxiety-related and cognitive behaviors after SPS exposure
The experimental results revealed that rats in the Mod group exhibited significantly reduced total locomotor activity, decreased time spent in the central zone during the OFT (Figures 1A,1B), and diminished exploration time in the open arms of the EPM (Figure 1C) compared to the Con group (all P < 0.01). In the NOR test, model rats demonstrated a significant reduction in time spent exploring novel objects relative to the Con group (P < 0.01) (Figure 1D). Furthermore, in the passive avoidance test, rats in the Mod group showed a marked increase in errors and prolonged time in the dark compartment (all P < 0.01) (Figures 1E, 1F).
Figure 1. Effect of taVNS on emotional and cognitive functions.
A: travel distance of OFT; B: time in centre zone of OFT; C: time in open arms of EPM; D: discrimination index of novel object; E: mistake times of passive avoidance; F: time spent in dark box; H: travel distance of OFT; H: time in centre zone of OFT; I: time in open arms of EPM; J: discrimination index of novel object; K: mistake times of passive avoidance. L: time spent in dark box. Con: drink freely and eat freely; Mod: Con+ SPS model; Iso: Con + SPS model + 14-d of anesthesia by isoflurane (30 min/d); taVNS: Con + SPS model + 14-d of taVNS anesthesia by isoflurane (30 min/d). taVNS: transcutaneous auricular vagus nerve stimulation; SPS: single prolonged stress. Iso: isoflurane; OFT: open field test; EPM: elevated plus maze; NOR: novel object recognition; SEM: standard error of the mean. Data are presented as mean ± SEM (n = 10 per group). Data were analyzed using one-way repeated-measures analysis of variance, followed by Tukey’s post hoc test when significant F ratios were obtained. aP < 0.01, versus the Con group; bP < 0.01 versus the Mod group.
Rats receiving taVNS exhibited marked improvements in these behavioral parameters relative to the Mod group (all P < 0.05) (Figures 1G-1H). In contrast, rats in the Iso group showed no statistically significant differences compared to the Mod group (Figures 1G-1I). Furthermore, rats in the taVNS group demonstrated a substantially improved discrimination index relative to the Mod group (P < 0.01) (Figure 1J), whereas those in the Iso group displayed no significant differences compared to the Mod group. Additionally, rats in the taVNS group showed significant reductions in error frequency and dark compartment retention time compared to the Mod group (all P < 0.01) (Figures 1K, 1L). In contrast, rats in the Iso group exhibited no statistically significant differences in these parameters versus the Mod group.
3.2. Effect of taVNS on oxidative stress and immune dysregulation in the peripheral blood
The concentrations of proinflammatory cytokines (IL-1β, IL-6, IL-12, and TNF-α) in the Mod group were notably higher than those in the Con group (all P < 0.01). In contrast, the concentrations of anti-inflammatory cytokines (IL-4 and IL-10) were significantly decreased in the Mod group (all P < 0.01). However, taVNS completely reversed these alterations, with blood concentrations of IL-1β, IL-4, IL-6, IL-10, IL-12, and TNF-α restored in the taVNS group (Table 1) (all P < 0.01).
Table 1.
The concentration of the immune-related and oxidative stress-related cytokines in serum, including IL-1β, IL-6, IL-12, TNF-α, IL-4, IL-10, CAT, GSH, SOD, ROS and MDA
| Biomarker | Con (n = 10) | Mod (n = 10) | Iso (n = 10) | taVNS (n = 10) |
|---|---|---|---|---|
| IL-1β (pg/mL) | 88.16±11.33 | 319.00±11.73a | 247.30±6.94b | 188.80±15.66b |
| IL-6 (pg/mL) | 68.23±11.04 | 215.80±5.67a | 158.20±7.52b | 137.00±6.19b |
| IL-12 (pg/mL) | 105.00±7.37 | 296.4±8.99a | 231.40±10.42b | 184.20±11.45b |
| TNF-α (pg/mL) | 340.80±40.75 | 1035.00±19.21a | 765.40±30.64b | 623.50±40.98b |
| IL-4 (pg/mL) | 561.50±15.68 | 165.50±21.38a | 310.60±14.07b | 400.20±26.43b |
| IL-10 (pg/mL) | 54.73±1.75 | 15.93±2.43a | 32.76±1.85b | 39.68±1.89b |
| CAT (pg/mL) | 780.30±40.90 | 462.10±52.86a | 594.00±50.12b | 604.40±33.01b |
| GSH (pg/mL) | 6.14±0.50 | 3.58±0.28a | 4.489±0.59b | 5.01±0.32b |
| SOD (pg/mL) | 72.35±5.90 | 42.60±3.84a | 54.45±3.18b | 60.72±3.89b |
| ROS (U/mL) | 36.72±4.78 | 60.62±2.95a | 49.91±5.03b | 48.87±3.62b |
| MDA(nmol/mL) | 4.08±0.22 | 5.993±0.45a | 5.01±0.23b | 4.55±0.47b |
Notes: Con: drink freely and eat freely; Mod: Con + SPS model; Iso: Con + SPS model + 14-d of anesthesia by isoflurane (30 min/d); taVNS: Con + SPS model + 14-d of taVNS anesthesia by isoflurane (30 min/d). taVNS: transcutaneous auricular vagus nerve stimulation; SPS: single prolonged stress. Iso: isoflurane; IL: interleukin; TNF: tumor necrosis factor; MDA: malondialdehyde; GSH: glutathione; SOD: superoxide dismutase; CAT: catalase; ROS: reactive oxygen species. Data are presented as mean ± standard error of the mean. Data were analyzed using one-way repeated-measures analysis of variance, followed by Tukey’s post hoc test when significant F ratios were obtained. aP < 0.01 versus the Con group; bP < 0.01 versus the Mod group.
As shown, the concentrations of CAT, GSH, and SOD were significantly decreased in the Mod group (all P < 0.01). In contrast, the concentrations of MDA and ROS in the Mod group were notably higher than those in the Con group (all P < 0.01). Following taVNS intervention, rats in the taVNS group exhibited restored blood concentrations of MDA, SOD, GSH, CAT, and ROS (all P < 0.01) (Table 1). Interestingly, the blood concentrations in the Iso group were intermediate between those of the Mod group and the taVNS group.
3.3. TaVNS treatment significantly alleviates neuronal injury
Nissl staining was employed to observe neuronal morphological changes in the HIP and PFC. In the Con group, neurons in the hippocampal CA1, CA3, and DG regions were regularly arranged and compact, with clear Nissl bodies (Figure 2A). In contrast, SPS-induced rats exhibited an increased number of damaged neurons, which were irregularly and sparsely distributed, accompanied by loss of Nissl bodies, compared to the Con group. The number of Nissl-positive cells was significantly reduced compared to the Con group in the CA1, CA2, CA3, and DG regions (all P < 0.05) (Figures 2B-2E). Accordingly, the number of Nissl-positive cells was significantly increased compared to the Con group in the PFC (all P < 0.05) (Figure 2F). Following taVNS administration, the reduction in Nissl-positive neurons and the extent of neuronal damage were ameliorated in the CA1, CA3, and DG regions (all P < 0.05). After isoflurane administration, the reduction in Nissl-positive neurons and neuronal damage were ameliorated in the CA2 region (all P < 0.05).
Figure 2. Effect of taVNS on the HIP and PFC in a rat model of PTSD.
A: Nissl staining in the hippocampal CA1, CA2, CA3, DG and PFC subregion; A1: hippocampal CA1 of Con group; A2: hippocampal CA1 of Mod group; A3: hippocampal CA1 of Iso group; A4: hippocampal CA1 of taVNS group; A5: hippocampal CA2 of Con group; A6: hippocampal CA2 of Mod group; A7: hippocampal CA2 of Iso group; A8: hippocampal CA2 of taVNS group; A9: hippocampal CA3 of Con group; A10: hippocampal CA3 of Mod group; A11: hippocampal CA3 of Iso group; A12: hippocampal CA3 of taVNS group; A13: hippocampal DG of Con group; A14: hippocampal DG of Mod group; A15: hippocampal DG of Iso group; A16: hippocampal DG of taVNS group; A17: PFC of Con group; A18: PFC of Mod group; A19: PFC of Iso group; A20: PFC of taVNS group; B: Nissl staining statistical analysis in the hippocampal CA1, subregion; C: Nissl staining statistical analysis in the hippocampal CA2 subregion; D: Nissl staining statistical analysis in the hippocampal CA3 subregion; E: Nissl staining statistical analysis in the hippocampal DG subregion; F: Nissl staining statistical analysis in the PFC region. Con: drink freely and eat freely; Mod: Con + SPS model; Iso: Con + SPS model + 14-d of anesthesia by isoflurane (30 min/d); taVNS: Con + SPS model + 14-d of taVNS anesthesia by isoflurane (30 min/d). taVNS: transcutaneous auricular vagus nerve stimulation; SPS: single prolonged stress; Iso: isoflurane; CA: cornu ammonis; DG: dentate gyrus; PFC: prefrontal cortex; HIP: hippocampal; SEM: standard error of the mean. Data are presented as mean ± SEM (n = 3 per group). Data were analyzed using one-way repeated-measures analysis of variance, followed by Tukey’s post hoc test when significant F ratios were obtained. aP < 0.05, cP < 0.01 versus the Con group; bP < 0.05, dP < 0.01 versus the Mod group.
3.4. taVNS inhibits microglial activation and attenuates astrocyte dysfunction
We investigated the effects of taVNS on the distribution and morphology of microglia in the Hip and PFC using Iba-1 staining (Figure 3A). Microglia in the HIP and PFC exhibited an activated phenotype following SPS exposure (all P < 0.05) (Figures 3B, 3C). These alterations were significantly ameliorated by taVNS administration (all P < 0.05). Furthermore, we observed downregulation of the astrocytic network marker Cx43 in SPS-exposed rats. TaVNS significantly upregulated the expression of Cx43 in the Hip and PFC (all P < 0.05) (Figures 3E, 3F).
Figure 3. Effect of taVNS on microglial morphology and connexins in the HIP and PFC of a rat model of PTSD.

A: representative images of Iba-1 immunofluorescence. A1: Iba-1 immunofluorescence of Con group in PFC; A2: dapi of Con group in PFC; A3: merge of Con group in PFC; A4: Iba-1 immunofluorescence of Mod group in PFC; A5: dapi of Mod group in PFC; A6:merge of Mod group in PFC; A7: Iba-1 immunofluorescence of Iso group in PFC; A8: dapi of Iso group in PFC; A9: merge of Iso group in PFC; A10: Iba-1 immunofluorescence of taVNS group in PFC; A11: dapi of taVNS group in PFC; A12: merge of taVNS group in PFC; A13: Iba-1 immunofluorescence of Con group in HIP; A14: dapi of Con group in HIP; A15: merge of Con group in HIP; A16: Iba-1 immunofluorescence of Mod group in HIP; A17: dapi of Mod group in HIP; A18: merge of Mod group in HIP; A19: Iba-1 immunofluorescence of Iso group in HIP; A20: dapi of Iso group in HIP; A21: merge of Iso group in HIP; A22: Iba-1 immunofluorescence of taVNS group in HIP; A23: dapi of taVNS group in HIP; A24: merge of taVNS group in HIP; B: quantification of Iba-1-positive cells (fold of control) in the PFC; C: quantification of Iba-1-positive cells (fold of control) in the Hip; D: representative images of Cx43 immunofluorescence; D1: Cx43 immunofluorescence of Con group in PFC; D2: merge of Con group in PFC; D3: Cx43 immunofluorescence of Mod group in PFC; D4: merge of Mod group in PFC; D5: Cx43 immunofluorescence of Iso group in PFC; D6: merge of Iso group in PFC; D7: Cx43 immunofluorescence of taVNS group in PFC; D8: merge of taVNS group in PFC; E: quantification of Cx43 area (fold of control) in the PFC; F: quantification of Cx43 area (fold of control) in the Hip. Con: drink freely and eat freely; Mod: Con + SPS model; Iso: Con + SPS model + 14-d of anesthesia by isoflurane (30 min/d); taVNS: Con + SPS model + 14-d of taVNS anesthesia by isoflurane (30 min/d). taVNS: transcutaneous auricular vagus nerve stimulation; SPS: single prolonged stress; Iso: isoflurane; Iba-1: ionized calcium-binding adapter molecule 1; Cx43: connexin43; PFC: prefrontal cortex; HIP: hippocampal; SEM: standard error of the mean. Data are presented as mean ± SEM (n = 3 per group). Data were analyzed using one-way repeated-measures analysis of variance, followed by Tukey’s post hoc test when significant F ratios were obtained. aP < 0.05 versus the Con group; bP < 0.05 versus the Mod group.
3.5. TaVNS reverses NRF2-HO-1 pathway and prevents SPS-induced neuroinflammation
As the result of qRT-PCR showed in the PFC, the expression level of NRF2 in the Mod group was markedly higher than that in the Con group, whereas it was significantly lower in the taVNS group than in the Mod group (P < 0.05) (Figure 4A). There were no significant differences between the Con and Mod groups in HO-1 or GPX4 expression (Figures 4B, 4C). The expression level of NLRP3 in the Mod group was significantly altered than that in the Con group, with no significant difference between the Mod and taVNS groups (Figure 4D).
Figure 4. Effect of taVNS on Nrf2-HO-1 and its downstream proteins, mRNA, and protein expression in the PFC and HIP of a rat model of post-traumatic stress disorder.
A: analysis of mRNA levels of NRF2 in PFC; B: analysis of mRNA levels of HO-1 in PFC; C: analysis of mRNA levels of GPX4 in PFC; D: analysis of mRNA levels of NLRP3 in PFC; E: analysis of mRNA levels of NRF2 in HIP; F: analysis of mRNA levels of HO-1 in HIP; G: analysis of mRNA levels of GPX4 in HIP; H: analysis of mRNA levels of NLRP3 in HIP; I: representative WB bands of PFC; J: representative WB bands of HIP; K: analysis of protein levels of NRF2 in PFC; L: analysis of protein levels of HO-1 in PFC; M: analysis of protein levels of GPX4 in PFC; N: analysis of protein levels of NLRP3 in PFC; O: analysis of protein levels of NRF2 in HIP; P: analysis of protein levels of HO-1 in HIP; Q: analysis of protein levels of GPX4 in HIP; R: analysis of protein levels of NLRP3 in HIP. Mod: Con + SPS model; Iso: Con + SPS model + 14-d of anesthesia by isoflurane (30 min/d); taVNS: Con + SPS model + 14-d of taVNS anesthesia by isoflurane (30 min/d). taVNS: transcutaneous auricular vagus nerve stimulation; SPS: single prolonged stress; Iso: isoflurane; PFC: prefrontal cortex; HIP: hippocampal; WB: Western blot; NRF2: nuclear factor erythroid 2-related factor 2; HO-1: heme oxygenase-1; GPX4: glutathione peroxidase 4; NLRP3: NLR family pyrin domain containing 3; SEM: standard error of the mean. Data are presented as mean ± SEM (n = 6 per group). Data were analyzed using one-way repeated-measures analysis of variance, followed by Tukey’s post hoc test when significant F ratios were obtained. aP < 0.05, dP < 0.01 versus the Con group; bP < 0.05, cP < 0.01 versus the Mod group.
In the HIP, there was no pronounced difference between the Con and Mod groups in NRF2 expression (Figure 4E). The expression levels of HO-1 and GPX4 in the Mod group were significantly decreased compared to the Con group, whereas the expression level of NLRP3 was notably increased compared to the Con group (all P < 0.05) (Figures 4F-4H). The expression levels of HO-1 and GPX4 in the taVNS group were significantly increased compared to the Mod group, whereas the expression level of NLRP3 was decreased compared to the Mod group (all P < 0.05) (Figures 4F-4H). There were no differences between the Mod and Iso groups in any indicators (Figures 4E-4H).
Western blot analysis further confirmed these findings (Figures 4K-4R). In the PFC, NRF2 expression in the Mod group was significantly higher than that in the Con group but lower in the taVNS group than in the Mod group (P < 0.05) (Figure 4K) There were no significant differences between the Con and Mod groups in HO-1 or GPX4 expression (Figures 4L, 4M). Compared to the Con group, NLRP3 expression in the Mod group was reduced, whereas it was elevated in the taVNS group (P < 0.05) (Figure 4N). There were no pronounced differences in any indicators between the Mod and Iso groups (Figures 4K-4N).
In the HIP, the expression levels of HO-1, NRF2, and GPX4 in the Mod group were lower than those in the Con group and were recovered by taVNS treatment (all P < 0.05) (Figures 4O-4Q). NLRP3 levels in the Mod group were notably increased compared to the Con group but decreased in the taVNS group (P < 0.05) (Figure 4R). There were no significant differences between the Mod and Iso groups in any indicators (Figures 4O-4R).
3.6. Correlation analysis between protein level in HIP and behavioral parameters
In our study, we investigated the relationship between protein expression levels in the HIP and emotional and cognitive behaviors. The NRF2 protein level was positively correlated with the time spent in the central zone of the OFT (r = 0.6260, P = 0.0011). Similarly, the HO-1 protein level was positively correlated with the time spent in the open arms of the EPM (r = 0.5097, P = 0.0110). NRF2 expression also showed a positive correlation with the discrimination index in the NOR (r = 0.5792, P = 0.0030; Figure 4C), as did HO-1 (r = 0.6430, P = 0.0007).
Furthermore, NLRP3 protein expression was negatively correlated with the time spent in the central zone of the OFT (r = -0.5326, P = 0.0074; Figure 4E) and with the time spent in the open arms of the EPM (r = -0.6161, P = 0.0013). GPX4 expression was positively correlated with the discrimination index in the NOR (r = 0.5934, P = 0.0022) and negatively correlated with the time spent in the dark box during passive avoidance testing (r = -0.8395, P < 0.0001).
4. DISCUSSION
PTSD is a heterogeneous neuropsychiatric syndrome characterized by maladaptive emotional responses to traumatic memories and concomitant cognitive dysfunction.2-5 Current preclinical evaluation of therapeutic efficacy predominantly relies on behavioral assays: anxiety-related behaviors assess affective states, while cognitive performance tasks evaluate neuronal integrity in PFC and HIP circuits. To comprehensively evaluate the effects of taVNS, this study implemented a combined behavioral battery: OFT and EPM quantified anxiety-like behavior, whereas NOR and passive avoidance paradigms examined cognitive function. TaVNS treatment improved affective and cognitive deficits in SPS-exposed rats. Biochemical assays revealed concurrent immunomodulatory effects and redox balance restoration, evidenced by rebalanced pro-inflammatory cytokine profiles and enhanced antioxidant enzyme activities together with improved neuronal and glial integrity. Correlation analysis also revealed associations between protein expression levels in the HIP region and behavioral performance. These findings establish taVNS as a promising neuromodulatory intervention, providing novel experimental and theoretical evidence for developing therapeutic strategies targeting PTSD-associated neural circuit dysregulation.
Emerging evidence indicates that the PTSD is closely associated with the intricate interplay between oxidative stress and neuroinflammation.38 Therefore, we simultaneously examined oxidative stress and inflammatory biomarkers in peripheral blood. Consistent with this framework, SPS exposure was associated with significantly elevated levels of pro-inflammatory cytokines and oxidative stress markers, which were attenuated following taVNS treatment. This profile mirrors clinical findings in PTSD patients, where peripheral inflammation and peroxidative damage are consistently observed.20,21
As a master regulator of cellular redox homeostasis, NRF2 serves as a key transcriptional regulator that coordinates these pathological processes through its complex regulatory network with multiple signaling pathways.39 To elucidate the underlying molecular mechanisms underlying taVNS therapeutic effects, we assess activation of the NRF2-HO-1 pathway and its downstream molecular targets GPX4 and NLRP3.
Previous studies have shown that electroacupuncture can activate the HIP NRF2-HO-1 pathway, thereby attenuating neuronal apoptosis and ameliorating emotional dysregulation in SPS-induced PTSD model animals.18 Yang et al 40 have demonstrated that activation of the NRF2-HO-1 pathway not only elevates GPX4 concentrations within tissues and mitigates tissue injury but also potently reduces ROS levels in damaged tissues—observations that align with the patterns observed in our study. Similarly, Xie et al 41 demonstrated that Polygonatum cyrtonema Hua-mediated activation of the HIP NRF2-HO-1 pathway reduced NLRP3 inflammasome expression, protected hippocampal neurons, and improved emotional outcomes in PTSD model animals. Moreover, pellitorine has been reported to prevent chronic restraint stress-induced cognitive deficits by inhibiting NLRP3 expression and upregulating GPX4 expression.42 It is indicated that NRF2 not only transcriptionally induces HO-1 to degrade pro-oxidant heme and attenuate inflammation, but also upregulates GPX4 to eliminate lipid peroxides and prevent inflammasome activation. In line with this concept, our data indicate that taVNS improves the hippocampal metabolic and immune environment by upregulating NRF2-HO-1 and GPX4, while simultaneously downregulating NLRP3.
Furthermore, we conducted a focused assessment of neurons and glial cells in the anterior HIP and PFC. Wang et al 43 demonstrated that the pathological basis of PTSD involves neuronal apoptosis and glial cell activation, and that evodiamine, a bioactive alkaloid can alleviate neuronal apoptosis in the HIP of mice. Dang et al 44 emphasized that cognitive improvement is closely associated with the functional recovery of the PFC and HIP as well as the reduction of neuroinflammation. These findings collectively underscore that the pathophysiology of mental disorders, including major depressive disorder, is intricately linked to neuronal apoptosis and inflammatory processes. In our study, taVNS attenuated microglial activation and morphological alterations induced by SPS, thereby reducing neuronal death across distinct subregions of the hippocampus. Additionally, Pasillo et al 45 reported that increased expression of inflammatory markers and altered connexin levels may disrupt microglial-astrocytic network homeostasis. In our study, taVNS reversed neuroinflammation-associated downregulation of astrocytic Cx43, suggesting restored glia-neuron communication. Together, these findings support a broad central effect of taVNS, particularly on glial activation states and neuroinflammatory regulation.
Moreover, the two brain regions (HIP-PFC) exhibited opposite trends across NRF2-HO-1 related readouts and downstream markers. Notably, studies exploring the modulation of NRF2 activation across distinct brain regions have revealed region-specific divergence. Romero-Miguel et al 46 demonstrated that Minocycline administration in a schizophrenia rat model selectively activated NRF2 in HIP while suppressing its activity in the PFC. Similarly, Lu et al 47 reported analogous regional specificity following hydrogen-rich water intervention in traumatic brain injury models, with enhanced NRF2 activation observed in the HIP but inhibited in the PFC post-treatment. Beyond interventions directly targeting NRF2, independent evidence from analyses of regions related to Alzheimer disease and systemic inflammatory models further supports an intrinsic heterogeneity between the hippocampus and prefrontal cortex in their stress-regulatory baseline, manifested as molecular stress and inflammatory signatures.48,49
Together, these findings underscore the context-dependent and region-specific regulation of the NRF2-HO-1 pathway and its downstream molecular networks in the brain, which may be influenced by disease models, therapeutic modalities, and regional metabolic or cellular characteristics. Consistent with this notion, prior studies have suggested differential vulnerability and adaptive capacity to oxidative stress between the hippocampus and prefrontal cortex, with evidence of divergent metabolic responses during stress and recovery phases.50,51 Within this framework, the coherent yet opposite regulation of the NRF2-HO-1 axis and its downstream effectors observed in the hippocampus and prefrontal cortex of taVNS-treated animals likely reflects region-dependent redox and inflammatory regulation rather than experimental inconsistency, while both regional responses ultimately converge at the behavioral level.
Given that taVNS was administered under isoflurane anesthesia, an independent isoflurane-anesthesia group was established alongside the taVNS group to exclude anesthesia-related confounders and objectively evaluate the specific effects of taVNS. Isoflurane anesthesia attenuated oxidative stress and inflammatory markers in peripheral blood, but produced minimal changes in central readouts in our study.52 This aligns with prior findings where isoflurane effectively mitigated oxidative stress and inflammatory responses in myocardial cells under ischemic conditions. We observed that blood-brain barrier restriction, physically impeding isoflurane permeation achieved therapeutically relevant central nervous system concentrations. Our findings suggested that the central anti-oxidative and anti-neuroinflammatory benefits observed in the taVNS group are attributable to taVNS-specific neuromodulatory mechanisms rather than secondary anesthesia effects, highlighting its therapeutic potential for central nervous system disorders.
Although this study focused on the emotional and cognitive dimensions — using a series of behavioral tests to comprehensively assess these aspects — it did not incorporate the fear extinction paradigm, which remains the gold standard for evaluating core PTSD symptoms in preclinical models.53,54 Additionally, while our study simultaneously examined changes in both the HIP and the PFC during mechanistic investigations and observed opposing effects of NRF2-HO-1-GPX4 signaling in the HIP and PFC regions, the mechanisms underlying this regional divergence were not directly interrogated. Taken together, these considerations highlight several avenues for future work that may help further refine the interpretation of the behavioral and mechanistic findings. For example, including a sham stimulation group would be informative for better accounting for potential nonspecific effects related to handling or somatosensory stimulation in the taVNS group. Moreover, complementary approaches, such as gene knockout models or pharmacological inhibition targeting the NRF2-HO-1-GPX4 pathway may help determine whether modulation of this pathway is necessary for the beneficial effects of taVNS. Incorporating these elements in future studies would strengthen causal inference and provide a more robust mechanistic framework.
In summary, the present study demonstrates that taVNS improves emotional- and cognitive-related outcomes in a rat model of post-traumatic stress disorder. TaVNS treatment was accompanied by region-dependent alterations in NRF2-HO-1-GPX4 related redox signaling in the hippocampus and prefrontal cortex, together with coherent but divergent changes in downstream molecular readouts, including NLRP3 inflammasome-related markers. These central molecular changes coincided with reduced oxidative stress and peripheral inflammatory responses.
While our findings support an association between taVNS-induced behavioral improvements and modulation of central and peripheral redox/inflammatory pathways, they do not establish a definitive causal mechanism. Future studies incorporating region or gene knockout models or pharmacological blockade approaches will be required to clarify causality. Nevertheless, our results provide preliminary evidence supporting the translational potential of taVNS as a neuromodulatory intervention for PTSD and related neuropsychiatric disorders.
Funding Statement
Supported by Scientific and Technological Innovation Project of China Academy of Chinese Medical Sciences Neurobiophysical Investigation on the Amelioration of Post-traumatic Stress Disorder through Transcutaneous Auricular Electromagnetic Stimulation in the THz Frequency Range (No. CI2023C017YL); National Natural Science Foundation of China Explore the Mechanism by which Transcutaneous Auricular Vagus Nerve Stimulation Improves Depressive Behaviors Based on the Sirtuin 1/Nuclear Factor Erythroid 2-related Factor 2/Glutathione Peroxidase 4 Signaling Pathway (No. 82304914)
Contributor Information
Lan SUN, Email: sunlan462@163.com.
Peijing RONG, Email: drrongpj@163.com.
REFERENCES
- 1. Maercker A, Cloitre M, Bachem R, et al. . Complex post-traumatic stress disorder. Lancet 2022; 400: 60-72. [DOI] [PubMed] [Google Scholar]
- 2. Morina N, Ford JD, Risch AK, Morina B, Stangier U. . Somatic distress among Kosovar civilian war survivors: relationship to trauma exposure and the mediating role of experiential avoidance. Soc Psychiatry Psychiatr Epidemiol 2010; 45: 1167-77. [DOI] [PubMed] [Google Scholar]
- 3. Morina N, Ford JD. . Complex sequelae of psychological trauma among Kosovar civilian war victims. Int J Soc Psychiatry 2008; 54: 425-36. [DOI] [PubMed] [Google Scholar]
- 4. Cao C, Wang L, Fang R, et al. . Anxiety, depression, and PTSD symptoms among high school students in china in response to the COVID-19 pandemic and lockdown. J Affect Disord 2022; 296: 126-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. McLaughlin KA, Koenen KC, Friedman MJ, et al. . Subthreshold posttraumatic stress disorder in the world health organization world mental health surveys. Biol Psychiatry 2015; 77: 375-84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Steenkamp MM, Litz BT, Hoge CW, Marmar CR. . Psychotherapy for military-related PTSD: a review of randomized clinical trials. JAMA 2015; 314: 489-500. [DOI] [PubMed] [Google Scholar]
- 7. Shalev A, Liberzon I, Marmar C. . Post-traumatic stress disorder. N Engl J Med 2017; 376: 2459-69. [DOI] [PubMed] [Google Scholar]
- 8. Innamorato NG, Rojo AI, García-Yagüe AJ, Yamamoto M, de Ceballos ML, Cuadrado A. . The transcription factor Nrf2 is a therapeutic target against brain inflammation. J Immunol 2008; 181: 680-9. [DOI] [PubMed] [Google Scholar]
- 9. Grasser LR, Javanbakht A. . Treatments of posttraumatic stress disorder in civilian populations. Curr Psychiatry Rep 2019; 21: 11. [DOI] [PubMed] [Google Scholar]
- 10. Santhanam P, Teslovich T, Wilson SH, Yeh PH, Oakes TR, Weaver LK. . Decreases in white matter integrity of ventro-limbic pathway linked to post-traumatic stress disorder in mild traumatic brain injury. J Neurotrauma 2019; 36: 1093-8. [DOI] [PubMed] [Google Scholar]
- 11. Kasai K, Yamasue H, Gilbertson MW, Shenton ME, Rauch SL, Pitman RK. . Evidence for acquired pregenual anterior cingulate gray matter loss from a twin study of combat-related posttraumatic stress disorder. Biol Psychiatry 2008; 63: 550-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Bremner JD. . Traumatic stress: effects on the brain. Dialogues Clin Neurosci 2006; 8: 445-61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Ressler KJ, Berretta S, Bolshakov VY, et al. . Post-traumatic stress disorder: clinical and translational neuroscience from cells to circuits. Nat Rev Neurol 2022; 18: 273-88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Pitman RK, Rasmusson AM, Koenen KC, et al. . Biological studies of post-traumatic stress disorder. Nat Rev Neurosci 2012; 13: 769-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Shin LM, McNally RJ, Kosslyn SM, et al. . Regional cerebral blood flow during script-driven imagery in childhood sexual abuse-related PTSD: a PET investigation. Am J Psychiatry 1999; 156: 575-84. [DOI] [PubMed] [Google Scholar]
- 16. Gold AL, Shin LM, Orr SP, et al. . Decreased regional cerebral blood flow in medial prefrontal cortex during trauma-unrelated stressful imagery in Vietnam veterans with post-traumatic stress disorder. Psychol Med 2011; 41: 2563-72. [DOI] [PubMed] [Google Scholar]
- 17. Rojo AI, McBean G, Cindric M, et al. . Redox control of microglial function: molecular mechanisms and functional significance. Antioxid Redox Signal 2014; 21: 1766-801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Wishart DS, Tzur D, Knox C, et al. . HMDB: the Human Metabolome Database. Nucleic Acids Res 2007; 35: D521-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Miller MW, Sadeh N. . Traumatic stress, oxidative stress and post-traumatic stress disorder: neurodegeneration and the accelerated-aging hypothesis. Mol Psychiatry 2014; 19: 1156-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Katrinli S, Maihofer AX, Wani AH, et al. . Epigenome-wide Meta-analysis of PTSD symptom severity in three military cohorts implicates DNA methylation changes in genes involved in immune system and oxidative stress. Mol Psychiatry 2022; 27: 1720-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Peruzzolo TL, Pinto JV, Roza TH, et al. . Inflammatory and oxidative stress markers in post-traumatic stress disorder: a systematic review and Meta-analysis. Mol Psychiatry 2022; 27: 3150-63. [DOI] [PubMed] [Google Scholar]
- 22. Tang C, Gao J, Li S, et al. . Chlorogenic acid improves SPS-induced PTSD-like behaviors in rats by regulating the crosstalk between Nrf2 and NF-κB signaling pathway. Free Radic Biol Med 2025; 231: 136-52. [DOI] [PubMed] [Google Scholar]
- 23. Jîtcă G, Stoicescu R, Májai E. . Cannabidiol Treatment in a predator-based animal model of PTSD: assessing oxidative stress and memory performance. Int J Mol Sci 2025; 26: 4491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Liu J, Litt L, Segal MR, Kelly MJ, Pelton JG, Kim M. . Metabolomics of oxidative stress in recent studies of endogenous and exogenously administered intermediate metabolites. Int J Mol Sci 2011; 12: 6469-501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Taira J, Ogi T. . Induction of antioxidant protein HO-1 through Nrf2-ARE signaling due to pteryxin in peucedanum japonicum thunb in RAW264.7 macrophage cells. Antioxidants (Basel) 2019; 8: 621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Richter-Levin G, Stork O, Schmidt MV. . Animal models of PTSD: a challenge to be met. Mol Psychiatry 2019; 24: 1135-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Koo JW, Duman RS. . IL-1beta is an essential mediator of the antineurogenic and anhedonic effects of stress. Proc Natl Acad Sci U S A 2008; 105: 751-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Maier SF, Watkins LR. . Cytokines for psychologists: implications of bidirectional immune-to-brain communication for understanding behavior, mood, and cognition. Psychol Rev 1998; 105: 83-107. [DOI] [PubMed] [Google Scholar]
- 29. Faborode OS, Dalle E, Mabandla MV. . Exposure to footshock stress downregulates antioxidant genes and increases neuronal apoptosis in an Aβ(1-42) rat model of Alzheimer’s disease. Neurochem Int 2021; 150: 105170. [DOI] [PubMed] [Google Scholar]
- 30. Muhie S, Gautam A, Yang R, et al. . Molecular signatures of post-traumatic stress disorder in war-zone-exposed veteran and active-duty soldiers. Cell Rep Med 2023; 4: 101045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Austelle CW, O’Leary GH, Thompson S, et al. . A comprehensive review of vagus nerve stimulation for depression. Neuromodulation 2022; 25: 309-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Badran BW, Dowdle LT, Mithoefer OJ, et al. . Neurophysiologic effects of transcutaneous auricular vagus nerve stimulation (taVNS) via electrical stimulation of the tragus: a concurrent taVNS/fMRI study and review. Brain Stimul 2018; 11: 492-500. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Chen Y, Zhang Y, Wang J, et al. . Anti-neuroinflammation effects of transcutaneous auricular vagus nerve stimulation against depression-like behaviors via hypothalamic α7nAchR/JAK2/STAT3/NF-κB pathway in rats exposed to chronic unpredictable mild stress. CNS Neurosci Ther 2023; 29: 2634-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Wang L, Zhang J, Guo C, et al. . The efficacy and safety of transcutaneous auricular vagus nerve stimulation in patients with mild cognitive impairment: a double blinded randomized clinical trial. Brain Stimul 2022; 15: 1405-14. [DOI] [PubMed] [Google Scholar]
- 35. Zhang S, Zhao Y, Qin Z, et al. . Transcutaneous auricular vagus nerve stimulation for chronic insomnia disorder: a randomized clinical trial. JAMA Netw Open 2024; 7: e2451217. [Google Scholar]
- 36. Wang JY, Zhang Y, Chen Y, et al. . Mechanisms underlying antidepressant effect of transcutaneous auricular vagus nerve stimulation on CUMS model rats based on hippocampal α7nAchR/NF-κB signal pathway. J Neuroinflammation 2021; 18: 291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Siracusa R, Paola RD, Cuzzocrea S, Impellizzeri D. . Fibromyalgia: pathogenesis, mechanisms, diagnosis and treatment options update. Int J Mol Sci 2021; 22: 3891. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Daskalakis NP, Iatrou A, Chatzinakos C, et al. . Systems biology dissection of PTSD and MDD across brain regions, cell types, and blood. Science 2024; 384: eadh3707. [Google Scholar]
- 39. Cai M, Tong L, Dong B, Hou W, Shi L, Dong H. . Kelch-like ECH-associated protein 1-dependent nuclear factor-E2-related factor 2 activation in relation to antioxidation induced by sevoflurane preconditioning. Anesthesiology 2017; 126: 507-21. [DOI] [PubMed] [Google Scholar]
- 40. Yang W, Wang Y, Zhang C, et al. . Maresin1 protect against ferroptosis-induced liver injury through ROS inhibition and Nrf2/HO-1/GPX4 activation. Front Pharmacol 2022; 13: 865689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Xie P, Chen L, Wang J, Wang X, Yang S, Zhu G. . Polysaccharides from polygonatum cyrtonema Hua prevent post-traumatic stress disorder behaviors in mice: mechanisms from the perspective of synaptic injury, oxidative stress, and neuroinflammation. J Ethnopharmacol 2024; 319: 117165. [DOI] [PubMed] [Google Scholar]
- 42. Zhang JB, Lu GD, Sun DN, et al. . Pellitorine protects chronic restraint stress-induced cognitive deficits via inhibiting neural inflammation and ferroptosis. Int Immunopharmacol 2025; 162: 115166. [DOI] [PubMed] [Google Scholar]
- 43. Wang Z, Lai C, Shen B, et al. . Effects of evodiamine on behavior and hippocampal neurons through inhibition of angiotensin-converting enzyme and modulation of the renin angiotensin pathway in a mouse model of post-traumatic stress disorder. Nutrients 2024; 16: 1957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Dang R, Wang M, Li X, et al. . Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/Gpx 4 pathway. J Neuroinflammation 2022; 19: 41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Paciello F, Pisani A, Rolesi R, et al. . Oxidative stress and inflammation cause auditory system damage via glial cell activation and dysregulated expression of gap junction proteins in an experimental model of styrene-induced oto/neurotoxicity. J Neuroinflammation 2024; 21: 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Romero-Miguel D, Casquero-Veiga M, MacDowell KS, et al. . A Characterization of the effects of minocycline treatment during adolescence on structural, metabolic, and oxidative stress parameters in a maternal immune stimulation model of neurodevelopmental brain disorders. Int J Neuropsychopharmacol 2021; 24: 734-48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Lu S, Ge Q, Yang M, et al. . Decoupling the mutual promotion of inflammation and oxidative stress mitigates cognitive decline and depression-like behavior in rmTBI mice by promoting myelin renewal and neuronal survival. Biomed Pharmacother 2024; 173: 116419. [DOI] [PubMed] [Google Scholar]
- 48. Jiang M, Zhang C, Chen J, et al. . Unveiling aging and Alzheimer’s disease-associated dynamics of LINE1 DNA content and protein expression in mouse brains. Aging Cell 2025; 24: e70296. [Google Scholar]
- 49. Morera PMA, Beserra-Filho JIA, Soares-Silva B, et al. . Mixed granulocytic airway inflammation impairs aversive learning and alters neuroimmune biomarkers in mice. Sci Rep 2025; 15: 39804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Dionisie V, Ciobanu AM, Toma VA, et al. . Escitalopram targets oxidative stress, Caspase-3, BDNF and MeCP2 in the hippocampus and frontal cortex of a rat model of depression induced by chronic unpredictable mild stress. Int J Mol Sci 2021; 22: 7483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Li Y, Li L, Wang Y, et al. . Cholinergic signaling to CA1 astrocytes controls fear extinction. Sci Adv 2025; 11: eads7191. [Google Scholar]
- 52. Jamnicki-Abegg M, Weihrauch D, Pagel PS, et al. . Isoflurane inhibits cardiac myocyte apoptosis during oxidative and inflammatory stress by activating Akt and enhancing Bcl-2 expression. Anesthesiology 2005; 103: 1006-14. [DOI] [PubMed] [Google Scholar]
- 53. Qi YF, Liu Y, Liu YY, Li YY, et al. . Therapeutic potential of Traditional Chinese Medicine Yisui Shengxue pills to inhibit hypoxia-inducible factor-1alpha and general control nonderepressible 2 to regulate the post-chemotherapy immune response: integrating network pharmacology and experimental validation. J Tradit Chin Med 2025; 45: 1087-97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Wang RQ, Hao LY, Lu Y, et al. . Mechanism analysis of Tongqiao Yizhi decoction in treating vascular dementia rats by brain tissue untargeted metabonomics and fecal 16S rRNA gene sequencing. J Tradit Chin Med 2025; 45: 759-69. [DOI] [PMC free article] [PubMed] [Google Scholar]



