Identification of a novel mitovirus in Colocasia esculenta through high‑throughput sequencing and in-silico miRNA prediction for sequence-specific gene silencing

Abstract

Mitoviruses are simple RNA viruses typically associated with fungal mitochondria, although recent studies suggest their presence in plant transcriptomes. In this study, we report the identification and molecular characterization of a novel mitovirus from Colocasia esculenta using high-throughput sequencing (HTS). Analysis of symptomatic leaf tissues revealed a 2,644 nucleotide-long viral genome encoding a single open reading frame (ORF) for an RNA-dependent RNA polymerase (RdRp) of 544 amino acids. The viral sequence, tentatively named Colocasia esculenta associated mitovirus 2 (CeaMV2), showed 60.76% amino acid identity with known mitoviruses, supporting its classification as a novel species within the family Mitoviridae. Phylogenetic analysis showed that CeaMV2 clustered within the family Mitoviridae, grouped with other plant-associated mitoviruses, supporting its placement within the family Mitoviridae. The conserved domain searches confirmed the presence of the mitovirus-specific RdRp domain (Pfam: PF05919). RT-PCR and Sanger sequencing further validated the presence of CeaMV2 in C. esculenta leaf samples. The relatively short RdRp and its expression in plant transcriptome suggest possible association with plant mitochondria. Furthermore, in-silico analysis identified several plant-derived mature miRNAs, such as sbi-miR6231-3p, with high binding affinity to the CeaMV2 RdRp gene, suggesting a potential role for RNA interference in the host-virus interaction. This finding expands the known diversity of mitoviruses and highlights the utility of HTS in uncovering cryptic viral infections and potential RNAi-based defense mechanisms in economically important crops.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10123-026-00787-3.

Introduction

Mitoviruses are members of the family Mitoviridae within the order Cryppavirales, are characterized by non-enveloped, non-segmented, positive-sense single-stranded RNA [(+) ssRNA] genomes that typically encode a single open reading frame (ORF) for an RNA-dependent RNA polymerase (RdRp) (Hillman and Cai 2013; Nibert et al. 2018; Jacquat et al. 2022). These viruses replicate in the mitochondria of their eukaryotic hosts and are considered among the most structurally and functionally reduced RNA viruses, often possessing adenine-uracil-rich genomes ranging from approximately 2.5 to 4.5 kilobases in length (Nibert 2017; Nerva et al. 2019a, b).

Previously, mitoviruses were primarily associated with fungi, including both saprophytic and phytopathogenic taxa. However, advances in high-throughput sequencing (HTS) have led to the incidental discovery of mitovirus-like sequences within plant transcriptomes, initially raising questions regarding their host range. Subsequent studies have provided compelling biological and molecular evidence demonstrating that plants can serve as hosts for mitoviruses (Shi et al. 2016; Nibert et al. 2018; Nerva et al. 2019a, b; Fonseca et al. 2020).

Studies provided the first evidence of plant-infecting mitoviruses, including biological characterization, mitochondrial localization, and analysis of host proteomic responses (Nibert et al. 2018; Nerva et al. 2019a, b.). These studies demonstrated that plant-associated mitoviruses form a distinct evolutionary lineage within the family Mitoviridae, enabling partial host inference based on phylogenetic placement. Together, these findings revised the long-standing view that mitoviruses are restricted to fungi and established plants as confirmed hosts. Recent evidence has supported the existence of mitoviruses infecting plants, with experimental confirmation of active mitovirus replication in plant mitochondria and measurable effects on host cellular processes (Nibert et al. 2018; Chen et al. 2021; Prajapati et al. 2025a, b). These discoveries have significantly expanded our understanding of mitoviral diversity and evolution, prompting revisions to their taxonomy, including the establishment of new genera such as Unuamitovirus, Duamitovirus, Triamitovirus, and Kvaramitovirus by the International Committee on Taxonomy of Viruse (ICTV) (Jacquat et al. 2022).

Taro (Colocasia esculenta), a staple root crop widely cultivated in tropical and subtropical regions, has recently emerged as a novel host for mitoviruses. A previous study from China reported the presence of Colocasia esculenta associated mitovirus 1 (CeaMV1), representing the first mitovirus associated with this crop (Wu et al. 2023). Despite this initial discovery, data on mitoviruses diversity in taro from other geographical regions, especially from India remains unexplored.

In this study, we report a novel mitovirus infecting Colocasia esculenta using high-throughput sequencing. The assembled virus contig having mitoviral features, including a single ORF encoding a putative RNA-dependent RNA polymerase (RdRp), and phylogenetic analysis supports its classification as a distinct species within the family Mitoviridae. This finding enhances our understanding of mitovirus diversity and expands the known virosphere of economically important root crops.

Materials and methods

Sample collection, RNA extraction, library preparation and sequencing

Two Colocasia esculenta plants displaying severe virus-like symptoms such as marginal chlorosis and feathery chlorotic mottling (Fig. 1), were procured from Bihar and maintained at Advanced Centre for Plant Virology, Indian Agricultural Research Institute (IARI), New Delhi, India. Symptomatic leaves (~ 100 mg) of C. esculenta were subjected to total RNA extraction using Spectrum Plant total RNA kit (Sigma, USA) as per manufacturer’s instructions. The isolated RNAs were quantified and processed for library preparation with ribo-depletion as per mentioned in Thapa et al. 2024; Prajapati et al. 2025a, b. Further, NovaSeq 6000 (Illumina, USA) platform was used for paired-end sequencing (2 × 150 bp) of the prepared libraries. Raw reads were submitted to National Centre for Biotechnology Information (NCBI) under Sequence Read Archive (SRA) with accession number SRR36996674.

Fig. 1.

Virus-like symptoms on Colocasia esculenta, (a) & (c): feathery chlorotic mottling, (b) marginal chlorosis

HTS data processing and identification of virus genome

In order to eliminate low-quality and adaptor sequences, the HTS raw reads were imported into CLC Genomic Workbench (version 24.0.4) and quality trimming was done. Then filtered reads were mapped to reference genome of Colocasia esculenta (GCA_014218235.1) and un-mapped reads were subjected to de novo assembly using CLC Genomics Workbench (version 24.0.4) as described previously by Prajapati et al. (2023). The generated contigs were compared against NCBI databases: the viral reference genome database (accessible at https://www.ncbi.nlm.nih.gov/genome/viruses/) and non-redundant database. The homology analysis was carried out using BLASTX algorithm in OmicsBox 3.0.

For annotation of identified virus, the NCBI Conserved Domain-Search tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and Pfam database (http://pfam.xfam.org) were employed for the prediction of conserved domain within the virus proteins and identification of RdRp motif sequences respectively.

Sequence homology and phylogenetic analyses

The phylogenetic tree was constructed with novel and known viruses employing MEGA-X and best fit model (Kumar et al. 2018), using 1000 bootstrap replications. The complete coding sequence of recovered virus was compared with the other classified mitoviruses for homology analysis using ClustalW2 algorithm under SDT 5.4 tool (Muhire et al. 2014).

Validation for the presence of virus using RT-PCR

The mitovirus identified by HTS in the present study was confirmed by reverse transcription-Polymerase chain reaction (RT-PCR). In order to amplify the genomic region of the virus, primer pair was designed using assembled sequences of the identified virus (Table 1). For RT-PCR, the first-strand cDNA synthesis was done using Revert aid™ First-strand cDNA synthesis kit (Thermo Fisher Scientific, USA) as per manufacturer’s instructions. In brief, the reaction mixture (20 µl) containing 1 µl (10 pmol/µl) of downstream primers viz. random hexamer, 5X reaction buffer (4 µl), total RNA template extracted from symptomatic leaf samples (1 µg), RiboLock RNase inhibitor (20 U/µl) (1 µl), 10 mM dNTP mix (2 µl) and 1 µl of Revert Aid M-MuLV RT (200 U/µl) was prepared. The reaction mixture was incubated at 25 °C for 5 min, followed by 42 °C for 60 min and 70 °C for 5 min (enzyme inactivation) and stored at -20 °C till further use.

Table 1.

Primers for the detection of Mitovirus in RT-PCR

Primer code	Primer sequence	Annealing temperature	Amplicon size
mito_F	5’-CAGCGTCACCTACGTCACAA-3’	53 °C	~525 bp
mito_R	5’-CATAACAGTAGGCAGATCCA-3’

The cDNA (1 µl) synthesized above was subjected to PCR for which total 20 µl of reaction mixture comprising of 10X reaction buffer (2 µl), 1 µl dNTP mix (2.5 mM each), 10 pmol each of mito_F: 5’-CAGCGTCACCTACGTCACAA-3’ and mito_R: 5’-CATAACAGTAGGCAGATCCA-3’ primer pair, 0.2 µl of Takara Taq™ DNA Polymerase enzyme (5U/µl) (Takara, Japan) was prepared. The PCR conditions used were as follows: Initial denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 40 s, annealing temperature 53 °C for 30 s, primer extension at 72 °C for 1 min and final extension at 72 °C for 10 min. The amplified amplicons were analysed on 1.5% agarose gel, visualized using gel documentation system (BIO-RAD, USA), cloned in pGEM^®-T Easy vector and confirmed through sequencing.

Identification of mature microRNA and their potential target prediction in CeaMV2 genome

In order to predict and validate microRNAs (miRNA) against CeaMV2 (PV943332) genome, three computational algorithms (psRNATarget, miRanda and RNA22) were employed. The most effective miRNA target sites of plant mature miRNAs (available at miRbase; https://www.mirbase.org/) were predicted by screening CeaMV2 genome using psRNATarget algorithm. The prediction was done using FASTA format of plant mature miRNA sequences and CeaMV2 genome-predicted transcripts with default settings of the psRNATarget, miRanda, and RNA22 algorithms.

Results

Identification and characterization of a novel mitovirus

Two Colocasia esculenta plants showing marginal chlorosis and feathery chlorotic mottling were collected for virome analysis (Fig. 1). These symptoms were used only as sampling criteria and does not attribute to the detected mitovirus, as plant-associated mitoviruses are generally cryptic and not known to induce disease symptoms. The RNA-seq reads obtained from the pooled RNA of symptomatic Colocasia leaves were assembled to generate 2,644 nucleotides (nts) long contig which was mapped to mitovirus sp. showing 59% of query coverage and 60.76% of sequence identity at amino acid level. However, the ORF containing RdRp motif of a mitovirus exhibits less than 70% amino acid (aa) with known mitoviruses and showed substantial sequence divergence, indicating a distinct mitovirus-like lineage. The virus was provisionally named Colocasia esculenta associated mitovirus 2 (CeaMV2). (Botella et al. 2021a, b; Jacquat et al. 2023a, b; Zerbini et al. 2023; Prajapati et al. 2025a, b). The CeaMV2 was found to share sequence similarity with the viruses belonging to the family Mitoviridae. Mitoviruses are known to infect fungi, however the exact origin of these viruses is still not clear (Hillman et al., 2013; Prajapati et al. 2025a, b). A 2,644-nt mitovirus-like RNA sequence was recovered, which encodes a single open reading frame (ORF) comprising of a protein of 544 amino acids (aa), translated from both plant (standard) genetic codes and fungal mitochondria. The sequence was submitted to NCBI and following PV943332 accession number was obtained. Further, Pfam analysis revealed the presence of ORF containing RdRp motif of mitovirus (PF05919) at aa position 298–518 (Fig. 2). Colocasia leaf samples generated 49,772 (1.64%) reads that mapped to the CeaMV2 genome.

Fig. 2.

Genome organization of Colocasia esculenta associated mitovirus 2

(CeaMV2)

The presence of visible symptoms may alternatively reflect the co-occurrence of other factors like biotic stress, fungal infection etc. Given that mitoviruses are predominantly fungal viruses and spread horizontally, the detected mitovirus, although phylogenetic clustering supports plant association, fungal involvement cannot be fully excluded without targeted experimental validation.

Phylogenetic analysis and sequence homology

Phylogenetic analysis based on RdRp amino acid sequences placed CeaMV2 within the family Mitoviridae. The sequence clustered with previously reported plant-associated mitoviruses, including grapevine mitovirus 1, azolla filiculoides mitovirus 1, cannabis sativa mitovirus 1, petunia exserta mitovirus 1 and beta vulgaris mitovirus 1. (Fig. 3). The complete genomic sequence (coding region) of CeaMV2 revealed sequence identity ranging from 22.55 to 40.74% at amino acid level with other plant-associated mitoviruses i.e. with buergenerula spartinae mitovirus 1 (AHY03257.1) and cannabis sativa mitovirus 1 (DAB41746.2) respectively (Fig. 4). Thus, the sequence identity was found to lie below the species demarcation criteria (below threshold for RdRp i.e. sequence identity below < 70% at amino acid level) (Botella et al. 2021a, b; ICTV 2021; Jacquat et al. 2023a, b).

Fig. 3.

RdRp protein based phylogenetic analysis of Colocasia esculenta associated mitovirus 2 (CeaMV2) with other mitoviruses, conducted at the amino acid level. Phylogenetic tree was generated using maximumlikelihood model using MEGA-X 1,000 bootstrap replicates (places at the nodes

on the tree)

Fig. 4.

Sequence identity matrix of RdRp sequences of Colocasia esculenta associated mitovirus 2 (CeaMV2) with representative members of the family Mitoviridae

Validation using RT-PCR

For the validation of HTS results, the samples revealed an amplification of ~ 525 bp (Supplementary Fig. 1) in RT-PCR. The results were confirmed through Sanger sequencing and submitted to NCBI GenBank with following accession numbers PX919761 and PX919762. BLASTx analysis of the partial RdRp gene sequence of CeaMV2 showed 57.97% sequence identity with other species of family Mitoviridae available in GenBank. Partial RdRp gene sequence of CeaMV2 shared highest sequence identities (57.97%) with suillus luteus mitovirus 8 (PQ180902) which is again less than the species demarcation of < 70% (Botella et al. 2021a, b; ICTV 2021; Jacquat et al. 2023a, b).

Identification miRNA and Predicted target in CeaMV2 genome

miRNA target prediction was performed using publicly available mature plant miRNA sequences retrieved from miRBase. No new small RNA libraries were generated in this study. The analysis represents an in-silico assessment of potential host-derived miRNA interactions with the viral RdRp gene. Using three miRNA detection algorithms miRanda, RNA22 and psRNATarget, identified a set of plant-derived mature miRNAs that could potentially target the RdRp gene of CeaMV2. For RdRp (ORF1), all three tools predicted multiple miRNAs, including members of the gra-miR7484c, hbr-miR6171, mtr-miR5759, sbi-miR6231-3p and bdi-miR7746-3p families (Table 2). Further validated the predicted miRNAs using all three tools and selected the top five based on their binding affinities to the RdRp gene. These miRNAs were evaluated for sequence length, GC content, and unequal pairing energy (UPE), with the most promising candidates targeting RdRp exhibiting a UPE of 13.912 (sbi-miR6231-3p) (Table 2).

Table 2.

Salient parameters of top five miRNAs were determined, showing potential target affinity toward RdRP gene of present CeaMV2. (UPE: unpair the target site)

miRNA	Target gene	Length miRNA	UPE	miRNA_target alignment
gra-miR7484c	RdRp	20	18.306	AGAAGUCGAAUUGCAUUUUG	:::::::.::: :::: :::	CAAAAUGUAAUGCGACCUCU
hbr-miR6171	RdRp	21	16.361	AUGUGGAUUGCUGAAGGCUUU	:::.:::..:::: :::.::	CAAGUCUUUGGCAAGCCAUAU
mtr-miR5759	RdRp	21	15.998	AAGGGGGUGAAAAGAUUCAAA	:::.::::::: ::...:::	GUUGGAUCUUUUAACUUUCUU
sbi-miR6231-3p	RdRp	21	13.912	UAUUUGUGGACUCAUGGACAU	: ::::::::.::: :::.	CAGCCCAUGAGUUCACUAAUG
bdi-miR5185m-3p	RdRp	21	17.27	UUUGAAAAUUGAACUAGAAGC	::.:::::::::: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR7746-3p	RdRp	24	14.483	UUCUAUUGGAACUCUUAAUCUAUG	:: : ::: .:::.:..:::::	UUUAUAAUAAAGGUUUCGGUAGAA
mtr-miR2643b-5p	RdRp	21	18.396	UCUAAUCUCUGUUCCCAAUUA	.:: :::::::: .:::::	AGAUGCGGAACAGAUGUUAGA
nta-miR6024	RdRp	22	14.417	UUUUAGCCAGAGUUGUUUUCCC	:.::.:.::::: .::::.	AUCAGAAUAGCUCUGUUUAAAG
nta-miR6025d	RdRp	22	16.985	AACAAUUGAGAUAACAUCUAGG	.:::: :: :::::::::::	GUUAGAGGUGUUCUCAAUUGUU
aly-miR773b-3p	RdRp	21	19.316	AAUUGUUCAUUCAAGGAUAUU	:::..:::.: ::: ::::	UCUAUUUUUGGAAGAAGAAUU
ath-miR5663-5p	RdRp	21	17.057	AGCUAAGGAUUUGC-AUUCUCA	::::: ::::.::.::.::	GAAGAAUUGCAAGUCUUUGGCA
bdi-miR5185b-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185c-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185d-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185e-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185f-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185g-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185h-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA
bdi-miR5185i-3p	RdRp	21	17.27	UUUGAGAAUUGAACUAGAAGC	::.::::::::.: :::	CAGACUGGUUCAAUUUUGAAA

Discussion

The presence of mitoviruses predominantly in fungi, with detection in plants (Wu et al. 2023; Prajapati et al. 2025a, b), highlights the aspect of host specificity in viral evolution. Viruses typically evolve to replicate efficiently within the specific cellular machinery of their hosts. The primary barrier to fungal mitoviruses infecting and replicating in plant cells lies in the fundamental differences in the genetic codes of plants and fungal mitochondria. UGA which acts as a stop codon (universal), encodes for tryptophan in the mitochondria of fungi (Nibert et al. 2018; Prajapati et al. 2025a, b). However, earlier studies have reported the presence of mitovirus derived sequences within plant nuclear and mitochondrial genomes, some of these sequences are expressed as functional plant genes (Bruenn et al. 2015; Xu et al., 2015). Although the CeaMV2 sequence was detected in the plant transcriptome, it may have originated from a mitovirus-like gene incorporated into the mitochondrial or nuclear genome of the host plant. PCR amplification from plant genomic DNA would be required to exclude an endogenous viral element (EVE) and such validation was not performed in the present study.

Further, most of the integrated genes are derived from the RNA-dependent RNA polymerase (RdRp) domain and encodes for a protein of shorter length of around 500 amino acids (aa) or less in case of plant mitovirus-like gene products, while those encoded by fungi are around 700 aa or longer (Prajapati et al. 2025a, b). Consistent with this pattern, the predicted RdRp of CeaMV2 falls within this size range, supporting its classification as a plant-associated mitovirus-like RNA. Domain analysis identified a conserved mitoviral RdRp core (Pfam PF05919), including the canonical GDD motif required for RNA polymerase catalytic activity, confirming its affiliation with the family Mitoviridae. Comparative alignment with complete mitovirus RdRps indicates that portions of the N- and/or C-terminal regions are truncated, suggesting that the recovered sequence may represent a partial or near-complete plant-associated mitovirus-like genome. The recovery of CeaMV2 from the transcriptome of C. esculenta and its ability to be translated using both standard plant and fungal mitochondrial codes suggests potential adaptation to plant mitochondrial environments, as reported earlier for grapevine mitovirus 1 (GMV1) and ocimum basilicum RNA virus 2 (ObRV2) (Goh et al. 2018; Prajapati et al. 2025a, b). The discovery of CeaMV2 adds to the expanding host range of plant and fungi-associated mitoviruses, underscoring the underestimated diversity and evolutionary complexity of the family Mitoviridae.

In the phylogenetic analysis CeaMV2 showed clustering within the family Mitoviridae with other plant and fungi-associated mitoviruses and low sequence identity (22.55–40.74% at the aa level) with closest relative. The sequence divergence indicates a distinct mitovirus-like lineage [ICTV demarcation threshold of < 70% aa identity for RdRp proteins (Botella et al. 2021a, b; Jacquat et al. 2023a, b)]. Further, CeaMV1 (the only previously reported mitovirus in C. esculenta) showed very low sequence identity of 38.14% to CeaMV2 (present study), suggesting distinct evolutionary lineages and different origins or transmission vectors.

The presence of CeaMV2 in Indian C. esculenta samples highlights the geographical diversification of mitoviruses associated with C. esculenta, complementing the earlier report of CeaMV1 from China (Wu et al. 2023). This supports the hypothesis that mitoviruses may be more widespread and host-diverse than previously understood, especially in vegetatively propagated crops where virus accumulation is common. However, phylogenetic clustering and sequence characteristics support the association of CeaMV2 with plant-associated mitoviruses rather than with canonical fungal mitoviruses. Future studies involving subcellular localization, fungal microbiome profiling, and small RNA sequencing could help determine the exact host and biological role of this virus.

The identification of Colocasia esculenta associated mitovirus 2 (CeaMV2) from symptomatic C. esculenta plants in India adds a new dimension to our understanding of mitoviral diversity in vegetatively propagated crops. The genome organization, low sequence identity with existing mitoviruses, and placement within the family Mitoviridae, with clustering among plant-associated mitoviruses. The ability of CeaMV2 to be translated using both plant and fungal mitochondrial genetic codes raises intriguing questions about its host specificity and evolutionary origin. This study not only extends the known virosphere of Colocasia esculenta but also underscores the power of HTS for uncovering hidden viral entities. Future investigations involving subcellular localization, fungal microbiome profiling, PCR-based exclusion of endogenization, and 5′ and 3′ RACE analyses will be essential to resolve host specificity and genome completeness.

Several studies have employed in silico approaches to predict and identify microRNAs (miRNAs) with potential antiviral functions, particularly those targeting plant viral genomes (Jabbar et al., 2019; Ashraf et al., 2022; Ashraf et al., 2023; Wenzhi et al., 2024). These computational analyses have significantly enhanced our understanding of post-transcriptional gene regulation mechanisms involved in plant immunity. miRNAs have emerged as key endogenous regulators, gene expression at various levels, including mRNA cleavage, translational repression, and epigenetic modifications (Bajczyk et al., 2023; Wenzhi et al., 2024). Their regulatory flexibility highlights their critical role in plant defense systems, where precise control of gene expression is essential to counter viral infections.

Additionally, artificial miRNA (amiRNA)-based RNA interference (RNAi) strategies have shown great promise in achieving sequence-specific gene silencing in genetically modified crops (Petchthai et al., 2018; Miao et al., 2021; Zhou et al., 2022; Pandey et al., 2024; Wenzhi et al., 2024). This targeted approach not only ensures high specificity in silencing viral genes or host factors essential for viral replication and movement but also minimizes off-target effects, making it an attractive tool for developing virus-resistant transgenic plants.

The present study investigates the potential of endogenous plant miRNAs to target viral genomes, focusing on the Colocasia esculenta-associated mitovirus 2 (CeaMV2), an interaction that remains largely unexplored. Computational analysis revealed several plant-derived miRNAs capable of targeting the viral RdRp gene, with distinct targeting patterns observed for CeaMV2. The free energy (ΔG) of plant-miRNA–mRNA duplexes was estimated to identify favourable interactions indicative of ‘true targets’ (Riffo-Campos et al., 2016), while filters were applied to eliminate false positives (Oliveira et al., 2017; Quillet et al., 2021).

Understanding the interaction between plant-miRNAs and CeaMV2 is critical, as it lays the foundation for developing miRNA-based antiviral strategies in plants. This research not only information on novel regulatory mechanisms in the plant-virus interaction but also identifies 21 candidate miRNAs for targeted control of CeaMV2. Among the top candidates, sbi-miR6231-3p demonstrated the most promising binding affinity, with a UPE of 13.912. The identification of these miRNAs suggests a possible antiviral defense mechanism in C. esculenta mediated by RNA interference.

Future research will focus on the experimental validation of the most promising plant-miRNAs to assess their efficacy in conferring resistance to CeaMV2 and potentially other viruses. This study establishes a comprehensive bioinformatics analysis for predicting miRNA–viral genome interactions and guiding the development of genetically modified plants with miRNA-mediated resistance. By reducing reliance on chemical control measures, such miRNA-based strategies offer a sustainable solution for improving crop resilience and promoting environmentally friendly agriculture.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

P.B: Data curation, Formal analysis, investigation, writing—original draft preparation. M.R.P.: Data curation, Formal analysis, investigation, methodology, writing—original draft preparation. S.M.: Resources. N.G.: Supervision, Writing—review and editing. S.K.S.: Conceptualization, supervision, resources, methodology, writing—review and editing. V.K.B.: Conceptualization, supervision, writing—review and editing.

Funding

The research work was supported by Indian Council of Agricultural Research, Department of Agricultural Research and Education, Government of India under All India Network Project on Emerging Pests (AINP-EP)-Plant Virus Sub-component (CS 8–13/2024-PP).

Data availability

The mitovirus-like RNA sequence has been deposited in GenBank under accession PV943332. Partial RdRp validation sequences are available under accessions PX919761 and PX919762. Raw HTS data are available in accession SRA under SRR36996674.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.