Simvastatin Restores Cisplatin Sensitivity by Suppressing the Caveolin‐1‐Mediated PI3K/AKT Signaling Pathway in Cisplatin‐Resistant Cervical Cancer Cells

Yujia Zhou; Hejing Liu; Shuangjia Pan; Luyi Ruan; Jiayi Ruan; Jiaru Chen; Huihui Ji; Xueqiong Zhu

doi:10.1096/fj.202504556RR

. 2026 May 5;40:e71873. doi: 10.1096/fj.202504556RR

Simvastatin Restores Cisplatin Sensitivity by Suppressing the Caveolin‐1‐Mediated PI3K/AKT Signaling Pathway in Cisplatin‐Resistant Cervical Cancer Cells

Yujia Zhou ¹, Hejing Liu ¹, Shuangjia Pan ¹, Luyi Ruan ¹, Jiayi Ruan ¹, Jiaru Chen ², Huihui Ji ^1,^✉, Xueqiong Zhu ^1,^✉

PMCID: PMC13144434 PMID: 42087353

ABSTRACT

Cervical cancer treatment is often hindered by the emergence of cisplatin (DDP) resistance. Increasing evidence has indicated that statins possess anti‐tumor and chemosensitization potential beyond their lipid‐lowering effects. Statin utilization is found to be significantly linked to decreased cervical cancer incidence and mortality. However, whether statins affect chemosensitivity to cisplatin in cisplatin‐resistant cervical cancer remains to be clarified. In cervical cancer cisplatin‐resistant cell lines (SiHa‐DDP and C33a‐DDP) constructed from their parental cells, the effects of seven statins (simvastatin, fluvastatin, pitavastatin, lovastatin, atorvastatin, rosuvastatin, and pravastatin) on cell viability in cisplatin‐resistant cells and corresponding parental cells were assessed using the CCK‐8 assay. Compared with parental counterparts, the IC₅₀ values of seven statin drugs were markedly elevated in cells exhibiting cisplatin resistance. Simvastatin significantly enhanced the efficacy of cisplatin in cisplatin‐resistant cervical cancer cells, demonstrating a synergistic anti‐cancer effect (CI < 1). Combined therapy using simvastatin and cisplatin inhibited cell viability and migration while promoting cell apoptosis. Mechanistically, simvastatin downregulated protein expressions of caveolin‐1 (CAV1), PI3K, and p‐AKT. CAV1 knockdown in SiHa‐DDP and C33a‐DDP cells markedly increased cisplatin sensitivity, confirming its critical role in chemoresistance. Rescue experiments showed that CAV1 overexpression partially counteracted the inhibitory effects of simvastatin. In vivo, compared with monotherapies, simvastatin combined with cisplatin treatment markedly suppressed tumor growth, reduced CAV1 protein expression, decreased the percentage of Ki67‐positive cells and promoted apoptosis. In all, simvastatin enhanced cisplatin sensitivity by suppressing the CAV1‐mediated PI3K/AKT pathway involvement in the development of cisplatin resistance in cervical cancer cells. These findings reveal a novel mechanism in cervical cancer cells resistant to cisplatin by which simvastatin may serve as a potential adjuvant to improve the therapeutic efficacy of cisplatin‐based chemotherapy.

Keywords: Caveolin‐1, cervical cancer, cisplatin resistance, PI3K/AKT signaling pathway, simvastatin

Simvastatin synergizes with cisplatin in cisplatin‐resistant cervical cancer cells through suppression of the caveolin‐1‐mediated PI3K/AKT signaling axis.

graphic file with name FSB2-40-e71873-g001.jpg

1. Introduction

Cervical cancer is the fourth most prevalent malignancy in women and remains a significant global health burden, with population‐based data indicating an overall 5‐year survival approaching 70% [1]. Stage‐dependent survival varied markedly among cervical cancer patients from 2000 to 2021. Patients with early‐stage disease (FIGO IA) had a favorable prognosis, with a 5‐year overall survival of 95.3%, whereas those with advanced‐stage disease (FIGO IV) experienced substantially poorer survival, at only 18.1% [2]. Despite notable progress achieved through vaccination and early screening programs, which have greatly reduced incidence in many regions, the disease still exerts substantial morbidity and mortality in developing and low‐income countries where medical resources remain limited [3, 4]. Cisplatin (DDP) is widely regarded as the cornerstone and first‐line chemotherapeutic drug in cervical cancer treatment [5]. Although patients often exhibit an initial favorable response, prolonged exposure to cisplatin frequently results in acquired resistance, driving tumor recurrence and metastasis and ultimately compromising overall prognosis [6, 7]. Consequently, developing innovative therapeutic options to address the issue of cisplatin resistance or enhance cisplatin chemosensitivity has become an urgent clinical priority.

Multiple molecular events have been known to participate in cisplatin resistance, including enhanced DNA damage repair capacity, impaired apoptosis signaling, and aberrant redox homeostasis, and so forth [8, 9]. Recently, lipid metabolism, particularly cholesterol metabolism, has been reported to emerge as a crucial metabolic determinant of tumor chemoresistance [10]. Cholesterol is indispensable for maintaining membrane structure, receptor activity, and signal transduction [11]. Elevated cholesterol levels in cancer cells may accelerate proliferation, suppress apoptosis, and even promote resistance to chemotherapy [12]. Statins, compounds targeting HMG‐CoA reductase, have long been used as lipid‐lowering medications and are recognized for their favorable safety profile [13]. Based on lipophilicity, a property to penetrate cell membranes and tissues, statins are typically classified into lipophilic statins and hydrophilic statins [14]. Lipophilic statins have higher membrane permeability, broader cellular uptake and enhanced anti‐tumor activity compared with hydrophilic statins, and have been associated with reduced all‐cause and cancer‐specific mortality [15, 16, 17]. Beyond their cardiovascular applications, accumulating evidence suggests that statins possess anticancer potential and can potentiate the efficacy of conventional chemotherapeutics in several tumor types [18]. A recent meta‐analysis across multiple cancer types found that statin therapy was associated with improved survival in advanced‐stage malignancies [19]. Accumulating epidemiological evidence suggests a protective role of statins against cervical cancer. Specifically, the use of statins for at least 6 months has been associated with a reduced risk of cervical cancer incidence, lower mortality, and improved survival outcomes [20, 21]. However, the influence of statins on cisplatin resistance and the molecular mechanism underlying this effect in cervical cancer remains largely unexplored.

Caveolin‐1 (CAV1), a scaffold protein localized within cholesterol‐rich caveolae microdomains, coordinates numerous processes such as signal organization, molecular trafficking, and cholesterol homeostasis [22]. Cholesterol depletion induced by statins affects caveolae organization, where CAV1 functions as a structural scaffold [23]. Aberrant CAV1 expression has been reported to reinforce the function and stability of ATP‐binding cassette transporters, leading to enhanced drug efflux and reduced intracellular drug concentration [24]. Meanwhile, the PI3K/AKT pathway, composed of phosphoinositide 3‐kinase and protein kinase B, is a critical signaling axis regulating cell survival and proliferation and has been reported to be influenced by CAV1 in an expression‐dependent manner [25, 26]. Dysregulated activation or mutation within this pathway is frequently associated with tumor development and anticancer agent resistance [27]. Despite these insights, whether modulating CAV1 expression can influence the PI3K/AKT axis and consequently resensitize cisplatin‐resistant cervical cancer cells has not yet been determined.

Herein, cisplatin‐resistant cervical cancer cell lines were established to explore their cholesterol metabolism and statins' responsiveness compared with those of their parental counterparts. The combinatorial antitumor efficacy of simvastatin and cisplatin both in vitro and in vivo was further evaluated. Mechanistic investigations involved CAV1 knockdown to assess its role in chemosensitivity and western blot analyses to monitor alterations in CAV1 expression and PI3K/AKT pathway activation following individual or combined treatments. Collectively, this work provides new experimental evidence that simvastatin targeting the CAV1/PI3K/AKT signaling axis may represent a promising strategy to counteract cisplatin resistance in cervical cancer.

2. Materials and Methods

2.1. Cell Culture and Establishment of Cisplatin‐Resistant Cervical Cancer Cell Lines

SiHa and C33a, two human cervical cancer cell lines, and 293T cells were obtained from the American Type Culture Collection (ATCC, USA). Cisplatin‐resistant cervical cancer cells (SiHa‐DDP and C33a‐DDP) were constructed from SiHa and C33a cells. Dulbecco's modified Eagle's medium (DMEM; Meilunbio, China) supplemented with 10% fetal bovine serum (FBS; Sunrise, Uruguay) and 1% penicillin–streptomycin (100 mg/mL; Invitrogen, UK) was employed to culture cells at 37°C in a humidified 5% CO₂ atmosphere.

SiHa‐DDP and C33a‐DDP cells were generated by gradually treating the parental SiHa and C33a cells with escalating doses of cisplatin over several months. The cisplatin concentration was gradually increased in a stepwise manner (0.5, 1, 2, 4, 6, 10 μM) to select resistant populations. After 8 months of induction, cells that proliferated stably in medium containing 4 μM cisplatin were designated as SiHa‐DDP and C33a‐DDP. The resistance of the established cell lines was validated by determining the half‐maximal inhibitory concentration (IC₅₀) value for cisplatin using a CCK‐8 cell viability assay compared with their parental counterparts. These resistant cell lines were cultured in cisplatin‐free medium for at least two passages before subsequent experiments.

2.2. Antibodies and Reagents

All statins and cisplatin were obtained from MedChemExpress (MCE, Monmouth Junction, NJ, USA). Simvastatin (HY‐17502), lovastatin (HY‐N0504), pitavastatin (HY‐B0144A), fluvastatin (HY‐14664), and atorvastatin (HY‐B0589) were dissolved in dimethyl sulfoxide (DMSO), while pravastatin sodium (HY‐B0165A) and rosuvastatin calcium (HY‐17504) were dissolved in sterile double‐distilled water. Dimethylformamide (DMF) was used to dissolve cisplatin (HY‐17394). Then, the above‐mentioned drug solvents were stored at −20°C. For the in vivo experiment, cisplatin was dissolved in saline, and simvastatin was dissolved in a 50% PEG300 and 50% saline mixture as recommended in the drug instructions.

Primary antibody rabbit monoclonal anti‐human multidrug resistance‐associated protein 1 (MRP1) (#72202) was bought from Cell Signaling Technology (Danvers, USA). Rabbit monoclonal anti‐human CAV1 (ab32577) was obtained from Abcam (Cambridge, UK). Rabbit monoclonal anti‐human Ki67 (HA721115) was obtained from HUABIO (Hangzhou, China). Affinity Biosciences (Changzhou, China) provided mouse monoclonal anti‐human β‐Actin (#T0022). Mouse monoclonal antibodies against human PI3K (60225‐1‐Ig), AKT (60203‐2‐Ig), and p‐AKT (66444‐1‐Ig) were purchased from Proteintech (Wuhan, China).

2.3. Cell Viability Assay (CCK‐8)

A density of 2000 cells per well was seeded for SiHa and SiHa‐DDP cells and 8000 cells per well for C33a and C33a‐DDP cells into 96‐well microplates. Following exposure to the specified drug concentrations, each well received 10 μL of CCK‐8 reagent (MA0218‐3, Meilunbio, China). The plates were then incubated at 37°C for 2 h, after which the absorbance at 450 nm was recorded using a microplate reader (Thermo, USA).

2.4. Drug Sensitivity Assay

Cells were incubated with varying concentrations of cisplatin and statins (simvastatin, lovastatin, pitavastatin, fluvastatin, atorvastatin, pravastatin, and rosuvastatin) for 48 h. The concentration ranges of each drug were indicated in Figure 1. Cell viability was assessed using the CCK‐8 assay as described above. IC₅₀ values for drugs were calculated using nonlinear regression analysis in GraphPad Prism 10.0 software. The cisplatin resistance index (RI) was determined by the IC₅₀ of cisplatin‐resistant cells divided by the IC₅₀ of the corresponding parental counterparts.

Construction of cisplatin‐resistant cervical cancer cell lines and their increased tolerance to statins. (A) Cell viability after being treated with various concentrations of cisplatin for 48 h in cisplatin‐resistant cervical cancer cells and their parental cells. (B) The protein expression of MRP1 in cisplatin‐resistant cervical cancer cells and their parental cells. (C) The cholesterol levels in cisplatin‐resistant cervical cancer cells and their parental cells. (D–H) Cell viability after being treated with various concentrations of simvastatin, fluvastatin, pitavastatin, lovastatin, and atorvastatin for 48 h in cisplatin‐resistant cervical cancer cells and their parental cells. *p < 0.05, ****p < 0.0001.

2.5. Western Blot Assay

Harvested cells were lysed on ice using a radioimmunoprecipitation assay (RIPA)‐based solution (P0013B, Beyotime, China) supplemented with phenylmethylsulfonyl fluoride (PMSF) and phosphatase inhibitors. Then ultrasonic lysis was carried out and subsequently subjected to centrifugation for 20 min at 12 000 rpm under 4°C conditions. After collection of the supernatant, protein concentrations were quantified with a bicinchoninic acid (BCA) protein assay kit (P0011, Beyotime, China). Between 20 and 40 μg of protein was applied to sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) gels of varying concentrations (8%, 10%, or 12%), followed by transfer to polyvinylidene fluoride (PVDF) membranes. 5% skim milk in Tris‐buffered saline containing Tween‐20 (TBST) was employed to block membranes for 1.5 h. After overnight incubation with primary antibodies at 4°C, membranes were treated with horseradish peroxidase (HRP)‐labeled secondary antibodies (1:5000, Biosharp, China) for 1.5 h at room temperature. Details of the primary antibodies were provided below: rabbit monoclonal antibodies against human MRP1 (1:1000) and CAV1 (1:1000), and mouse monoclonal antibodies against human PI3K, AKT, p‐AKT (all 1:1000), and β‐Actin (1:3000). An enhanced chemiluminescence (ECL, Meilunbio, China) reagent was utilized to detect protein bands. Finally, relative protein expressions were quantified by ImageJ software.

2.6. Cholesterol Content Detection Assay

The cholesterol detection kit (S0211S, Beyotime, China) was employed to assess cellular cholesterol levels. SiHa, SiHa‐DDP, C33a, and C33a‐DDP cells were lysed in isopropanol, and the supernatant was centrifuged for 5 min at 11 200 rpm under 4°C conditions. The supernatant was subsequently mixed with the working reagent and incubated at 37°C for 1.5 h. Microplate readers were utilized to detect the absorbance at 570 nm. Cholesterol contents were quantified based on the standard curve.

2.7. Drug Combination Assay

Of all the statins tested, cervical cancer cells resistant to cisplatin showed the greatest sensitivity to simvastatin. Therefore, simvastatin was selected for subsequent experiments. Cisplatin‐resistant cervical cancer cells were exposed to cisplatin, simvastatin, or a combination of both for 48 h to evaluate their effects on cell viability. Specifically, the concentrations of cisplatin were 0, 1.25, 2.5, 5, 10, 20, and 40 μM for SiHa‐DDP cells, and 0, 5, 10, 20, 40, and 80 μM for C33a‐DDP cells. Simvastatin was used at 0, 8, 16, and 32 μM for SiHa‐DDP cells, and at 0, 20, 40, and 60 μM for C33a‐DDP cells. The CCK‐8 assay was used as described above. To assess drug interactions, CompuSyn software (ComboSyn Inc., USA) was employed to compute the combination index (CI) according to the Chou‐Talalay method, classifying CI values as synergistic if below 1, additive if equal to 1, and antagonistic if above 1 [28].

In order to further investigate the effects of drug treatments, four groups were established for both SiHa‐DDP and C33a‐DDP cells: control group (CTRL), cisplatin group (DDP), simvastatin group (SIM), and cisplatin plus simvastatin combination group (D + S). The control group received no drug treatment. And concentration combinations were chosen according to the CI value (CI < 1). SiHa‐DDP cells received 20 μM cisplatin and/or 16 μM simvastatin, while C33a‐DDP cells were exposed to 40 μM cisplatin and/or 20 μM simvastatin for 48 h. The apoptotic rates were analyzed by flow cytometry, the migration ability was evaluated using the Transwell assay, and western blot was utilized to assess the expression of proteins.

2.8. Flow Cytometry

SiHa‐DDP or C33a‐DDP cells were incubated for 24 h in 60‐mm dishes. The drug treatment groups in each cell line were established as previously described. Harvested cells were rinsed with phosphate‐buffered saline (PBS) after 48 h treatment. 1× binding buffer was applied to resuspend cells. Fluorescein isothiocyanate‐conjugated Annexin V (FITC‐Annexin V) and phycoerythrin‐propidium iodide (PE‐PI) solution (556 547, BD Biosciences, USA) were mixed with the cell suspension and reacted at room temperature for 15 min with the samples shielded from light. The apoptotic rates of cells were assessed via CytoFLEX flow cytometry (Beckman Coulter, Fullerton, USA). Apoptotic levels were assessed based on the proportions of early and late apoptotic cells.

2.9. Transwell Assay

The migratory behavior of cells was evaluated using Transwell chambers (Corning, USA). The treatment groups for cisplatin‐resistant cervical cancer cells were prepared as previously described. Cells were then plated in the upper chamber using serum‐free medium, while DMEM with FBS was added to the lower chamber. After incubation for 24 h, cells that reached the lower membrane surface were first treated with 4% paraformaldehyde for 30 min and subsequently subjected to 0.1% crystal violet (C0121‐100 mL, Beyotime, China) staining for 15 min. Migratory cells were imaged under a microscope (Leica, Japan), and their numbers were quantified with ImageJ software.

2.10. Identification of Overlapping Genes

Three independent gene expression datasets: cervical cancer‐associated genes, cisplatin‐associated genes, and simvastatin‐associated genes were analyzed to identify genes that overlapped with the VennDiagram R package (v1.7.3) running on R version 4.5.1. Cervical cancer‐related genes and simvastatin‐associated genes were obtained by searching for “cervical cancer” and “simvastatin” in the GeneCards database (https://www.genecards.org/) [29]. Cisplatin‐related genes were acquired from GeneWeaver [30]. The Venn diagram showed overlap among the three lists, yielding 14 overlapping genes. Among these, CAV1 was selected for further analysis due to its potential relevance to cisplatin resistance and statin therapy.

2.11. Enrichment Analysis

Biological pathways associated with CAV1 were characterized through Gene Set Enrichment Analysis, carried out with the aid of GSEA software (version 4.3.2) based on TCGA‐CESC expression profiles. Analysis based on the CAV1 mRNA expression profile was implemented through the “clusterProfiler” R package, and the Hallmark gene sets were obtained from the Molecular Signatures Database (MSigDB) [31]. Using 1000 permutations, gene sets with a normalized enrichment score above 1 in combination with a false discovery rate under 0.25 were regarded as significantly enriched.

2.12. Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR)

Cellular RNA was extracted with the RNA Easy‐Isolation kit (Vazyme, China) according to the provided protocol. RNA samples were evaluated for both concentration and purity via a NanoDrop 2000 spectrophotometer (Thermo, USA). One microgram of total RNA was reverse‐transcribed using the EasyScript All‐in‐One First‐Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech, China). The PerfectStart Green qPCR SuperMix (TransGen Biotech, China) was employed to perform quantitative real‐time PCR. The relative expression levels of target genes were normalized to β‐actin. Table S1 summarized the primer sequences applied in this study.

2.13. Plasmid Construction and Cell Transfection

Plasmids were all designed and synthesized by Youbio Biosciences lnc (Changsha, China). In order to construct stable CAV1 knockdown cell lines, the sequences of small hairpin RNA (shRNA) targeting CAV1 (CAV1‐sh1: CCACCTTCACTGTGACGAAAT, CAV1‐sh2: GACGTGGTCAAGATTGACTTT) were transfected into 293 T cells using Lipofectamine 2000 (MA0672, Meilunbio, China) with psPAX2 and pMD2.G vectors. After 48 h, harvest the cell culture supernatant containing viruses and add to SiHa‐DDP and C33a‐DDP cells with polybrene (8 μg/mL) for 2 days. Later, puromycin (HY‐B1743, MCE, USA) was utilized to screen the transfected cells. The knockdown of CAV1 protein in transfected cells was assessed using western blot analysis.

Overexpression cDNA CAV1‐overexpressed (CAV1‐OE) was cloned into the PCDH‐GFP + PURO‐3xFlag vector. The plasmid and control plasmid were transfected into SiHa‐DDP and C33a‐DDP cells with Lipofectamine 2000 in Opti‐MEM reduced‐serum medium (Gibco, USA). The effectiveness of the transfection procedure was confirmed via western blot.

2.14. Xenograft Tumor Models

Female BALB/c nude mice at 6 weeks of age were purchased from Charles River Laboratories. All animal experiments were conducted at the Wenzhou Institute, Chinese Academy of Sciences, in accordance with institutional guidelines and approved by the Animal Care and Use Committee (WIUCAS25062404). Mice received a subcutaneous injection into the right flank containing 5 × 10⁶ C33a‐DDP cells suspended in 100 μL PBS. Tumor growth was monitored every 3 days by measuring dimensions with a digital caliper, and volumes were derived using the formula: volume = (length × width²)/2. Once tumors reached a size of approximately 50 mm³, the mice were randomly allocated into four groups (n = 5 in each): control (CTRL) group, cisplatin (DDP) group, simvastatin (SIM) group, and cisplatin plus simvastatin (D + S) combination group. An intraperitoneal injection of cisplatin at 4 mg/kg was administered every 6 days, while simvastatin was administered orally (by gavage) at 30 mg/kg every 2 days. In the combination group, cisplatin and simvastatin were used at the same doses and schedules as in the respective single‐drug groups. Control mice received equivalent volumes of vehicle solutions via the same routes. After a 14‐day period of drug exposure, mice were anesthetized and euthanized through cervical dislocation. Tumors and major organs were collected and preserved for further research.

2.15. Paraffin Embedding and Section Preparation

Tissue samples were collected and immediately preserved in 4% paraformaldehyde at room temperature for 2 days. Following fixation, the specimens were gradually dehydrated in ethanol solutions of ascending concentration (75%, 85%, 95%, and 100%), spending 30 min in each step, and then cleared twice in xylene for 1 h. The tissues were then infiltrated with melted paraffin wax for 1 h (repeated twice) followed by embedding in fresh paraffin. After solidification, paraffin blocks were cut into 5 μm sections with an Ultra‐Thin Microtome (Leica, Japan). The sections were floated on 42°C warm distilled water to remove wrinkles, placed onto poly‐L‐lysine‐coated glass slides, and dried at 60°C for 2 h to secure strong adhesion. The paraffin sections were then stored at room temperature for subsequent experiments.

2.16. Hematoxylin and Eosin (H&E) Staining

Paraffin sections were subjected to routine hematoxylin–eosin staining using a Hematoxylin–Eosin (HE) Stain Kit (G1120, Solarbio, China). Histological evaluation of major organs, including the heart, liver, spleen, lung, and kidney, was performed under a microscope (Leica, Japan) to assess potential treatment‐associated tissue alterations.

2.17. Immunohistochemistry (IHC) Assay of Mouse Tissues

The section preparation was mentioned above. After deparaffinization, a grade ethanol solution was used to rehydrate sections. Then, antigen retrieval in a microwave oven, endogenous peroxidase activity was inhibited using 3% H₂O₂ after that. Then, sections underwent blocking using 5% BSA and incubated overnight at 4°C with a rabbit monoclonal anti‐human CAV1 antibody (1:200) or Ki67 antibody (1:500), respectively. After incubation with secondary antibodies for 30 min, staining was visualized using 3,3′‐Diaminobenzidine (DAB) solution (Zhongshan Golden Bridge Biotechnology Co. Ltd., China) for 30 s. Then, the cell nuclei were counterstained for 3 s with hematoxylin. For CAV1, IHC evaluation involved multiplying the staining intensity (scored 0–3) with the proportion of positive cells (scored 0–4) to obtain a final score [32]. The combined score was applied for statistical evaluation. For Ki67, the proliferation index was calculated as the percentage of Ki67‐positive cells.

2.18. TUNEL Assay

Detection of apoptosis in paraffin‐embedded tissue sections was performed using the One‐Step TUNEL Assay Kit (C1086, Beyotime). Paraffin was removed from tissue sections using xylene, followed by rehydration through sequential ethanol dilutions culminating in distilled water. Afterward, sections were exposed to 20 μg/mL proteinase K (ST533‐1 mL, Beyotime) at 37°C for 30 min to facilitate tissue permeabilization and DNA break detection, followed by washing 3 times with PBS. Each tissue section received the TUNEL working solution and was incubated at 37°C for 1 h. Post‐incubation, the tissue sections were thoroughly rinsed three times using PBS, and nuclei were visualized using DAPI staining. The fluorescence microscope was used to observe under a FITC filter set. Cells positive for TUNEL were counted in randomly selected areas. Positive cell percentages were quantified using ImageJ.

2.19. Immunohistochemistry (IHC) Assay of Human Cervical Cancer Tissues

Cervical cancer and normal cervical tissue specimens were obtained from patients at the Second Affiliated Hospital of Wenzhou Medical University, following approval by the Ethics Committee (2023‐K‐04‐01). The immunohistochemistry protocol was performed as described above, with minor modifications. Specifically, sections were incubated with an anti‐human CAV1 antibody (1:500) at 4°C overnight, followed by incubation with the corresponding secondary antibody and DAB staining for 1 min. All remaining steps were performed as described in Section 2.17.

2.20. Statistical Analysis

All statistical analyses were carried out using SPSS version 21.0 (SPSS Inc., Chicago, IL, USA) and constructed using Prism 10.0 software (GraphPad). The data were assessed for normal distribution and equal variance via Shapiro–Wilk and Levene's tests. Comparisons between two groups were performed using Student's t‐test when variance was equal, whereas Welch's t‐test was used if the variances were unequal. Multiple‐group differences were analyzed using one‐way ANOVA followed by Fisher's LSD post hoc test. When the data violated the assumption of normality, the nonparametric Mann–Whitney U‐test was employed. Differences were regarded as statistically significant if the two‐sided p value fell below 0.05.

3. Results

3.1. Successful Construction and Validation of Cisplatin‐Resistant Cervical Cancer Cells

To begin with, SiHa‐DDP and C33a‐DDP cells, two cisplatin‐resistant cervical cancer cell lines, were established successfully. As illustrated in Figure 1A, the IC₅₀ values of cisplatin in SiHa‐DDP cells were 78.26 μM, and the cisplatin IC₅₀ values of SiHa cells were 11.13 μM. The drug resistance index (RI) was calculated as 7. Similarly, the cisplatin IC₅₀ values of C33a‐DDP cells were 109 μM, and the cisplatin IC₅₀ values of C33a cells were 1.75 μM. C33a‐DDP cells' RI was calculated as 62. In addition, MRP1 protein was significantly upregulated in both SiHa‐DDP and C33a‐DDP cells compared with their parental counterparts (Figures 1B and S1A). Thus, the established SiHa‐DDP and C33a‐DDP cell lines provided reliable models for investigating the mechanisms underlying cisplatin resistance.

3.2. Increased Tolerance of Statins in Cisplatin‐Resistant Cervical Cancer Cells

Cholesterol levels were measured to assess alterations within cervical cancer cells exhibiting resistance to cisplatin and found to be elevated compared with their parental counterparts (Figure 1C). Considering the elevated cholesterol levels in resistant cells, the differential effects of statins on parental and resistant cells were subsequently investigated. Figures 1D–H and S1B,C presented lipophilic and amphiphilic statins' IC₅₀ of SiHa‐DDP, SiHa, C33a‐DDP, and C33a cells. All the statin IC₅₀ values of cisplatin‐resistant cervical cancer cells were significantly higher than those of parental cells. These results suggested that cisplatin‐resistant cells exhibited a reduced sensitivity to statin treatment. In SiHa‐DDP and C33a‐DDP cells, the IC₅₀ values of simvastatin were 37.98 μM and 53.78 μM, representing the lowest IC₅₀ among all tested statins. In the parental SiHa and C33a cells, the IC₅₀ values of simvastatin were 24.97 μM and 44.61 μM, respectively (Figure 1D). The IC₅₀ values of fluvastatin, pitavastatin, lovastatin, and atorvastatin were over 50 μM in SiHa‐DDP and above 100 μM in C33a‐DDP cells (Figure 1E–H). However, rosuvastatin and pravastatin's IC₅₀ values in cisplatin‐resistant cervical cancer cells exceeded 800 μM. As for SiHa and C33a cells, their IC₅₀ values of rosuvastatin and pravastatin were all higher than those of other tested statins (Figure S1B,C). Therefore, in comparison with hydrophilic statins like rosuvastatin and pravastatin, cervical cancer cells were more sensitive to lipophilic statins (simvastatin, lovastatin, fluvastatin, pitavastatin, and atorvastatin). Lipophilic statins have potent pleiotropic and anticancer effects compared with hydrophilic statins, and simvastatin has the strongest lipophilicity. Besides, cisplatin‐resistant cervical cancer cells were the most sensitive to simvastatin treatment among seven types of statins. Therefore, simvastatin was used to investigate whether it had a synergistic effect with cisplatin in cisplatin‐resistant cells.

3.3. Simvastatin and Cisplatin Had a Synergistic Anti‐Tumor Effect in Cisplatin‐Resistant Cervical Cancer Cells

To further assess the synergistic inhibitory effects of simvastatin and cisplatin on cervical cancer cells resistant to cisplatin, the combination index (CI) was calculated under treatment with a series of concentrations of simvastatin and cisplatin. As expected, both in SiHa‐DDP and C33a‐DDP, simvastatin had a synergistic effect with cisplatin (CI < 1) (Tables 1 and 2). Figure 2A showed the heatmap illustrating the cytotoxic effects of simvastatin combined with cisplatin at different concentration gradients. The color gradient in the heatmap represented cell viability, with darker shades indicating lower viability. The regions with lower cell viability appeared mainly in the mid‐ to high‐dose combinations, suggesting a cooperative cytotoxic effect in SiHa‐DDP and C33a‐DDP cells. In addition, simvastatin combined with cisplatin notably enhanced the apoptosis and attenuated the migration in cervical cancer cells resistant to cisplatin relative to single‐drug treatment (Figure 2B–E). Thus, the combination of simvastatin and cisplatin exhibited synergistic and significant inhibition of the progression among cervical cancer cells resistant to cisplatin.

TABLE 1.

The combination index (CI) of simvastatin and cisplatin in SiHa‐DDP.

Dose of SIM (μM)	Dose of DDP (μM)	CI
8.0	1.25	0.8304
	2.5	0.839
	5.0	0.704
	10.0	0.6434
	20.0	0.5339
	40.0	0.5882
16.0	1.25	0.6259
	2.5	0.4667
	5.0	0.3511
	10.0	0.3213
	20.0	0.335
	40.0	0.2654
32.0	1.25	0.4455
	2.5	0.4054
	5.0	0.2684
	10.0	0.3066
	20.0	0.3378
	40.0	0.2428

Open in a new tab

TABLE 2.

The combination index (CI) of simvastatin and cisplatin in C33a‐DDP.

Dose of SIM (μM)	Dose of DDP (μM)	CI
20.0	5.0	0.6794
	10.0	0.6475
	20.0	0.6294
	40.0	0.5958
	80.0	0.4766
40.0	5.0	0.684
	10.0	0.6549
	20.0	0.6231
	40.0	0.5658
	80.0	0.412
60.0	5.0	0.5522
	10.0	0.5229
	20.0	0.4777
	40.0	0.3789
	80.0	0.1814

Open in a new tab

Simvastatin and cisplatin had a synergistic effect in cisplatin‐resistant cervical cancer cells. (A) Cytotoxic effects of cisplatin (DDP), simvastatin (SIM), and their combination on SiHa‐DDP and C33a‐DDP cells. (B) Representative flow cytometry plots showing cell apoptosis percentage after treatment with DDP, SIM, and DDP + SIM in SiHa‐DDP and C33a‐DDP cells. (C) Representative images of cell migration after treatment with DDP, SIM, and DDP + SIM in SiHa‐DDP and C33a‐DDP cells. (D) Quantitative analysis of apoptosis levels in 2B. (E) Quantification of the number of migrated cells in 2C (C, control; D, cisplatin; S, simvastatin; D + S, combination of cisplatin and simvastatin). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.4. CAV1 Influenced the Sensitivity of Cisplatin in Cisplatin‐Resistant Cervical Cancer Cells

A Venn diagram was constructed to identify the overlapping differentially expressed genes (DEGs). As shown in Figure 3A, 14 DEGs (CAV1, TNF, IL6, ABCB1, MMP9, CXCL8, RHOA, ABCG2, PPARG, CASP9, TLR2, CASP8, AKT1, HRAS) were identified at the intersection. These overlapping genes were considered potential targets involved in both cisplatin resistance and simvastatin treatment in cervical cancer. Among them, CAV1 was selected for further analysis because of its important role in cholesterol transport and chemotherapy resistance. And IHC analysis revealed that CAV1 expression was significantly higher in cervical cancer tissues compared with normal cervical epithelium (Figure S2A,B). The results of qRT‐PCR and western blot assays demonstrated that CAV1 mRNA and protein expression levels were increased in cervical cancer cells exhibiting cisplatin resistance in comparison with SiHa and C33a cells (Figures 3B,C and S2C). To investigate the potential link between CAV1 and cisplatin resistance, CAV1 knockdown cisplatin‐resistant cervical cells were constructed. Figures 3D and S2D showed the downregulation of CAV1 protein expression in CAV1‐knockdown SiHa‐DDP and C33a‐DDP cells compared to the control group, verifying the knockdown efficiency. In addition, SiHa‐DDP CAV1‐sh1 and SiHa‐DDP CAV1‐sh2 cells exhibited markedly decreased viability upon cisplatin treatment compared with the control SiHa‐DDP cells. Besides, cisplatin IC₅₀ values of CAV1‐sh1 and CAV1‐sh2 SiHa‐DDP cells were reduced compared with the control (Figure 3E). A similar trend was also observed in C33a‐DDP cells (Figure 3F). It was found that downregulating CAV1 could reduce the IC₅₀ of cisplatin and obviously promote the efficiency of cisplatin treatment to cisplatin‐resistant cervical cancer cells.

CAV1 influenced the sensitivity of cisplatin in cisplatin‐resistant cervical cancer cells. (A) Venn diagram illustrating the overlapping target genes of cisplatin, simvastatin, and cervical cancer. (B) The CAV1 mRNA levels in cisplatin‐resistant cervical cancer cells and their parental cells. (C) The CAV1 protein expression levels in cisplatin‐resistant cervical cancer cells and their parental cells. (D) The efficacy of CAV1 knockdown in SiHa‐DDP and C33a‐DDP cells was verified using the western blot assay. (E) Cell viability of control and CAV1‐knockdown SiHa‐DDP cells after 48 h of cisplatin treatment, with statistical analysis of the corresponding IC₅₀ values. (F) Cell viability of control and CAV1‐knockdown C33a‐DDP cells after 48 h of cisplatin treatment, with statistical analysis of the corresponding IC₅₀ values. **p < 0.01, ****p < 0.0001.

3.5. Simvastatin Inhibited the CAV1/PI3K/AKT Pathway in Cisplatin‐Resistant Cervical Cancer Cells

Intending to explore the potential mechanisms of CAV1 in cisplatin‐resistant cervical cancer, GSEA revealed a significant association between high CAV1 gene expression and the triggering of the PI3K/AKT signaling axis (Figure 4A). To elucidate the mechanism underlying the combined effect of simvastatin and cisplatin in cisplatin‐resistant cervical cancer cells, western blot analysis was performed. Results revealed that simvastatin treatment had no effect on total AKT expression, but notably reduced CAV1, PI3K, and p‐AKT protein expression in SiHa‐DDP and C33a‐DDP cells relative to the untreated group. Notably, these reductions were further enhanced when simvastatin was combined with cisplatin (Figure 4B,C). Moreover, CAV1 overexpression partially abrogated the inhibitory effect of simvastatin, as indicated by the elevated levels of PI3K, AKT, and p‐AKT relative to the untreated group (Figure 4D,E), suggesting that simvastatin enhanced the cisplatin sensitivity of cisplatin‐resistant cells through CAV1‐mediated regulation of the PI3K/AKT signaling pathway. Thus, simvastatin inhibited the CAV1/PI3K/AKT signaling axis, and its co‐administration with cisplatin exerted an additive suppressive effect on this signaling pathway's activation, thereby attenuating the progression of cisplatin‐resistant cells.

Simvastatin inhibited the CAV1/PI3K/AKT pathway in cisplatin‐resistant cervical cancer cells. (A) GSEA plot showing enrichment of the PI3K/AKT signaling pathway in the high CAV1 expression group. (B) The protein expression of CAV1, PI3K, AKT, and p‐AKT in SiHa‐DDP and C33a‐DDP cells treated with DDP, SIM, or DDP + SIM. (C) Quantification of the western blot results shown in 4B. (D) The protein expression of CAV1, PI3K, AKT, and p‐AKT in control and CAV1‐overexpressed SiHa‐DDP and C33a‐DDP cells treated with simvastatin. (E) Quantification of the western blot results shown in 4D. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.6. Simvastatin Enhanced the Antitumor Efficacy of Cisplatin In Vivo

To strengthen the in vivo evidence for the synergy between simvastatin and cisplatin, cisplatin‐resistant cervical cancer cells were implanted into BALB/c nude mice to establish a xenograft tumor model. Figure 5A showed excised tumors and the tumor volume growth curve, illustrating the inhibitory effect of combination therapy (DDP + SIM) on tumor growth. The final tumor volume and tumor weight consistently demonstrated a significant reduction in the group receiving the combination treatment relative to each single‐agent therapy (Figure 5B). Immunohistochemical analysis revealed that CAV1 protein was predominantly expressed on the plasma membrane of cervical cancer cells (Figure 5C). Relative to the control group, CAV1 expression detected by staining was notably declined in simvastatin treatment while combination treatment with simvastatin and cisplatin exhibited the weakest staining intensity. As shown in Figure 5D, quantitative IHC demonstrated a marked decrease in CAV1 protein levels in the combination treatment group compared with single‐drug treatment. In addition, Ki67 staining demonstrated a significant reduction in proliferative activity in the combination treatment group compared with either monotherapy, as evidenced by a decreased percentage of Ki67‐positive cells (Figure S3A,B). Furthermore, TUNEL staining exhibited a higher proportion of apoptotic cells in the combined‐treatment cohort relative to either the DDP‐only or SIM‐only groups, consistent with enhanced antitumor activity (Figure 5E,F). To examine the potential toxicity of the drug combination, histological analysis using H&E staining indicated preserved morphology in major organs, including the heart, liver, spleen, lungs, and kidneys, with no detectable treatment‐associated alterations (Figure S3C). Collectively, these in vivo results demonstrated that simvastatin and cisplatin exerted a synergistic effect in inhibiting tumor growth in cisplatin‐resistant cervical cancer cells.

Simvastatin enhanced the antitumor efficacy of cisplatin in vivo. (A) Representative images of excised tumors from C33a‐DDP xenograft‐bearing mice and tumor volume growth curves following treatment with DDP, SIM, or DDP + SIM. (B) Final tumor volumes and weights of CTRL, DDP, SIM, and DDP + SIM groups. (C) Representative images of CAV1 immunohistochemical staining in tumor tissues from CTRL, DDP, SIM, and DDP + SIM groups. (D) Quantitative analysis of immunohistochemical staining scores for CAV1 in 5C. (E) Quantitative analysis of TUNEL‐positive cells in 5F. (F) Representative images of TUNEL staining in tumor sections from CTRL, DDP, SIM, and DDP + SIM groups. *p < 0.05, **p < 0.01.

4. Discussion

Resistance to chemotherapy remains a central factor limiting the success of current cancer therapeutic strategies [33]. Increasing evidence implicates dysregulated cholesterol metabolism as a critical contributor to the development of drug resistance. In hepatocellular carcinoma (HCC), elevated cholesterol levels remodeled lipid rafts to activate oncogenic signaling pathways [34]. Sorafenib‐resistant HCC cells displayed increased intracellular cholesterol, and cholesterol reduction restored sorafenib sensitivity [35]. Likewise, in non‐small cell lung cancer (NSCLC), gefitinib‐resistant cells exhibited higher lipid‐raft cholesterol content than their sensitive counterparts, and cholesterol depletion enhanced gefitinib efficacy [36, 37]. Moreover, recent studies targeting cholesterol synthesis or uptake have demonstrated that inhibition of cholesterol metabolism could overcome platinum‐based drug resistance. Wang et al. [12] reported that the reduction of intracellular cholesterol markedly alleviated cisplatin resistance in breast cancer cells. They developed platinum (IV) complexes FP (fenofibrate‐platinum [IV]) and DFP (difluorofenofibrate‐platinum [IV]), which effectively overcame cisplatin resistance by inhibiting cholesterol metabolism in addition to inducing DNA damage. Squalene epoxidase (SQLE), an enzyme involved in cholesterol biosynthesis, has been shown to promote chemoresistance via cholesterol‐dependent AKT activation in head and neck cancers [38]. In the present study, SiHa‐DDP and C33a‐DDP, two cervical cancer cell lines exhibiting resistance to cisplatin, were successfully established to simulate clinical drug resistance. Compared with their parental counterparts, the resistant variants exhibited significantly elevated intracellular cholesterol levels, suggesting that dysregulated cholesterol metabolism may contribute to cisplatin resistance. After evaluating the cytotoxicity of seven statins approved by the U.S. Food and Drug Administration (FDA), both parental and cisplatin‐resistant cervical cancer cells displayed increased sensitivity to lipophilic statins, which may be attributed to their higher membrane permeability, facilitating intracellular accumulation. However, cisplatin‐resistant cells displayed relative tolerance to these agents, implying that cisplatin resistance may be accompanied by adaptive changes in cholesterol metabolism that confer a broader multidrug‐resistant phenotype.

Statins, as inhibitors of HMGCR, primarily block de novo cholesterol biosynthesis [39]. Increasing evidence supports that statins not only exerted antitumor effects beyond lipid regulation but also enhanced the chemosensitivity of tumor cells [15]. For instance, simvastatin was shown to restore sorafenib sensitivity in hepatocellular carcinoma by suppressing PKM2‐driven glycolysis and blocking the HIF‐1α/PPAR‐γ/PKM2 signaling axis, in the meantime reducing HCC cell proliferation and promoting apoptosis [40]. In addition, statins have been shown to effectively target chemoresistant pancreatic ductal adenocarcinoma organoids by attenuating protein glycosylation, cholesterol accumulation, and epithelial‐mesenchymal transition (EMT) characteristics [41]. Similarly, Zhai et al. [42] used experimental evidence obtained from both cell‐based systems and animal models, which indicated that pitavastatin directly bound to neuropilin‐1 (NRP1) and was shown to reverse resistance to cisplatin in both colorectal carcinoma and non‐small‐cell lung cancer. As for the present study, simvastatin, the most lipophilic statin, co‐treatment with cisplatin yielded a significant synergistic response in cervical cancer cells exhibiting cisplatin resistance. Compared with either drug alone, the combination treatment significantly enhanced apoptosis and suppressed cell migration. Additionally, in vivo experiments demonstrated that co‐treatment with simvastatin and cisplatin significantly suppressed tumor growth in cisplatin‐resistant cervical cancer models. Simvastatin was administered at 30 mg/kg every 2 days, a dose derived from FDA‐approved clinical regimens (20–40 mg/day, with a maximum of 80 mg/day) using body surface area conversion [43]. This dose falls within the range commonly applied in preclinical studies and accounts for interspecies differences in pharmacokinetics and oral bioavailability. Previous studies have employed comparable dosing regimens to evaluate the antitumor effects of simvastatin [44]. HE staining of major organs revealed no obvious histological toxicity. Together, these findings indicate that the dosing strategy is scientifically justified and clinically informative, highlighting the potential of simvastatin as an adjunct therapy in cisplatin‐resistant cervical cancer. All the results indicated that simvastatin potentiated cisplatin efficacy and might represent a new approach for treating cisplatin resistance in resistant cervical cancer cells.

Caveolin‐1, the principal structural component of lipid rafts, plays a critical role in regulating membrane fluidity and cholesterol metabolism [22]. There are various studies demonstrating the association between overexpression of CAV1 and chemoresistance in cancers, such as hepatocellular carcinoma [45], pancreatic cancer [46], and melanoma [47]. Pereira et al. [48] demonstrated high CAV1 protein levels reduced HER2 membrane availability, thereby limiting antibody‐drug conjugates (ADCs) binding and internalization in heterogeneous gastric cancer. What's more, CAV1 overexpression has also been shown to suppress cisplatin‐induced apoptosis and promote cell survival in gastric cancer through stimulation of the WNT signaling cascade via LRP6 phosphorylation and β‐catenin dephosphorylation [49]. In line with the above findings, the present research applied qRT‐PCR assay and western blot analysis, found that the relative CAV1 mRNA and protein expressions were elevated in cisplatin‐resistant cervical cancer cells relative to the parental counterparts. Besides, it was the first to establish CAV1‐knockdown cisplatin‐resistant cervical cancer cell lines, demonstrating that CAV1 suppression markedly increased cisplatin sensitivity. Therefore, it was suggested that CAV1 represented a promising target for overcoming cisplatin resistance. Moreover, both simvastatin monotherapy and its combination with cisplatin significantly reduced CAV1 expression in resistant cervical cancer cells, with the combination showing a more pronounced effect. These results indicated that simvastatin might enhance the cisplatin sensitivity of cervical cancer cells resistant to cisplatin by downregulating CAV1 and disrupting lipid raft‐associated signaling.

Nowadays, activation of the PI3K/AKT signaling cascade is recognized as a crucial mechanism underlying reduced chemosensitivity [50]. Histone lysine crotonylation (Kcr), regulated by acyl‐CoA synthetase short‐chain family member 2 (ACSS2), could activate the PI3K/AKT pathway and then drive EGFR‐TKI resistance in lung cancer [51]. Liu et al. [52] showed that cisplatin induced CCL5 secretion from senescent cancer‐associated fibroblasts (CAFs) in neuroendocrine prostate cancer, which activated the CCR5/PI3K/AKT pathway in tumor cells to promote DNA repair and resistance. And Zhu et al. [53] reported that simvastatin overcame ferroptosis and chemo‐immunotherapy resistance in AKT‐hyperactivated intrahepatic cholangiocarcinoma. The present study carried out a western blot assay to detect PI3K, AKT, and p‐AKT protein levels. It was found that PI3K and p‐AKT were reduced in simvastatin and simvastatin combined with cisplatin groups, demonstrating that simvastatin significantly suppressed the PI3K/AKT signaling pathway activation. Besides, to further investigate whether simvastatin exerted its effect by suppressing the expression of CAV1 and subsequently regulating the activation of the PI3K/AKT signaling pathway, a rescue experiment was performed in cisplatin‐resistant cervical cancer cells with CAV1 overexpression. These findings indicated that, compared with the control group, the expression levels of PI3K/AKT pathway‐related proteins were markedly increased in CAV1‐overexpressed cells treated with simvastatin. These findings suggested that simvastatin might enhance cisplatin sensitivity by inhibiting CAV1 expression, thereby attenuating the PI3K/AKT signaling pathway activation.

Several limitations of the present study should be acknowledged. Although cholesterol accumulation was observed in resistant cells, the underlying metabolic mechanisms were not dissected and warrant further investigation. And the experimental design for repeated in vivo studies and survival analyses will be incorporated into future investigations. Transcriptome‐wide profiling in statin‐treated models may provide deeper insight into molecular alterations associated with cisplatin resistance.

5. Conclusion

In conclusion, our study demonstrated that simvastatin combined with cisplatin exerted a synergistic anticancer effect in cervical cancer cells which were resistant to cisplatin, as shown both in vitro and in vivo. Mechanistically, simvastatin downregulated CAV1 expression, thereby attenuating the activation of the PI3K/AKT signaling pathway. These findings identified a novel pathway by which simvastatin functions as a potential co‐therapy to potentiate the impact of cisplatin treatment on cervical cancer cells.

Author Contributions

Y.Z., H.J., and X.Z. conceived and designed the study. Y.Z. and H.L. performed the in vitro and in vivo experiments. S.P. and L.R. contributed to data collection and analysis. Y.Z. and H.L. prepared the figures, tables, and drafted the manuscript. J.R. and J.C. offered advice on certain aspects of the research. X.Z. and H.J. revised and approved the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the Natural Science Foundation of Zhejiang Province (No. LMS25H160024), the Natural Science Foundation of Zhejiang Province (No. LQ23H160073), and Zhejiang Key Laboratory of Traditional Chinese Medicine for Diagnosis and Treatment of Gynecological Cancers (2022‐11).

Ethics Statement

The study was approved by the Ethics Committee of the Second Affiliated Hospital of Wenzhou Medical University (2023‐K‐04‐01). Written informed consent was obtained from all patients before tissue collection. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the Wenzhou Institute, University of Chinese Academy of Sciences (WIUCAS25062404). All procedures were performed in accordance with the approved protocol, institutional guidelines, and national regulations on animal welfare.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: (A) Quantification of the western blot results shown in 1B. (B) Cell viability was assessed after treatment with various concentrations of rosuvastatin for 48 h in cisplatin‐resistant cervical cancer cells and their parental cells. (C) Cell viability was assessed after treatment with various concentrations of pravastatin for 48 h in cisplatin‐resistant cervical cancer cells and their parental cells. *p < 0.05, **p < 0.01.

Figure S2: (A) Representative images of CAV1 immunohistochemical staining in normal cervical epithelium and cervical cancer tissues. (B) Quantitative analysis of immunohistochemical staining scores for CAV1 in S1D. (C) Quantification of the western blot results shown in 3C. (D) Quantification of the western blot results shown in 3D. *p < 0.05, ***p < 0.001, ****p < 0.0001.

Figure S3: (A) Representative images of Ki67 immunohistochemical staining in tumor tissues from CTRL, DDP, SIM, and DDP + SIM groups. (B) Quantitative analysis of Ki67‐positive cells in S3A. (C) H&E‐stained sections of major organs collected from mice from CTRL, DDP, SIM, and DDP + SIM groups. *p < 0.05, ***p < 0.001, ****p < 0.0001.

FSB2-40-e71873-s001.pdf^{(3.4MB, pdf)}

Table S1: Primer sequences used for qRT‐PCR.

FSB2-40-e71873-s003.docx^{(14.4KB, docx)}

Data S1: fsb271873‐sup‐0003‐Figures.pdf.

FSB2-40-e71873-s002.pdf^{(3.7MB, pdf)}

Acknowledgments

The graphical abstract was created with BioRender.com.

Contributor Information

Huihui Ji, Email: jihuihui@wmu.edu.cn.

Xueqiong Zhu, Email: zjwzzxq@163.com.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author.

References

1. Siegel R. L., Kratzer T. B., Giaquinto A. N., Sung H., and Jemal A., “Cancer Statistics, 2025,” CA: A Cancer Journal for Clinicians 75 (2025): 10–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Wang S., Zhu Q., Lu Y., et al., “Update of Incidence and Survival in Patients With Cervical Cancer in the United States From 2000 to 2021,” Journal of Gynecologic Oncology 37 (2026): e36. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Brisson M., Kim J. J., Canfell K., et al., “Impact of HPV Vaccination and Cervical Screening on Cervical Cancer Elimination: A Comparative Modelling Analysis in 78 Low‐Income and Lower‐Middle‐Income Countries,” Lancet 395 (2020): 575–590. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Alfaro K., Maza M., Cremer M., Masch R., and Soler M., “Removing Global Barriers to Cervical Cancer Prevention and Moving Towards Elimination,” Nature Reviews. Cancer 21 (2021): 607–608. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Petrelli F., Riboldi V., Bruschieri L., et al., “First‐Line Treatment of Locally Advanced Cervical Carcinoma: An Updated Systematic Review and Bayesian Network Meta‐Analysis,” Cancer Treatment Reviews 135 (2025): 102921. [DOI] [PubMed] [Google Scholar]
6. Lin X., Wang F., Chen J., et al., “N(6)‐Methyladenosine Modification of CENPK mRNA by ZC3H13 Promotes Cervical Cancer Stemness and Chemoresistance,” Military Medical Research 9 (2022): 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Wang M., Liu J., Liao X., et al., “The SGK3‐Catalase Antioxidant Signaling Axis Drives Cervical Cancer Growth and Therapy Resistance,” Redox Biology 67 (2023): 102931. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Galluzzi L., Senovilla L., Vitale I., et al., “Molecular Mechanisms of Cisplatin Resistance,” Oncogene 31 (2012): 1869–1883. [DOI] [PubMed] [Google Scholar]
9. Zhang C., Xu C., Gao X., and Yao Q., “Platinum‐Based Drugs for Cancer Therapy and Anti‐Tumor Strategies,” Theranostics 12 (2022): 2115–2132. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Li J., Guo Y., Zhang W., et al., “Cholesterol Metabolism: A Strategy for Overcoming Drug Resistance in Tumors,” Biochemical Pharmacology 238 (2025): 116974. [DOI] [PubMed] [Google Scholar]
11. Jiang W., Jin W. L., and Xu A. M., “Cholesterol Metabolism in Tumor Microenvironment: Cancer Hallmarks and Therapeutic Opportunities,” International Journal of Biological Sciences 20 (2024): 2044–2071. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Wang Y., Cai L., Li H., et al., “Overcoming Cancer Resistance to Platinum Drugs by Inhibiting Cholesterol Metabolism,” Angewandte Chemie 62 (2023): e202309043. [DOI] [PubMed] [Google Scholar]
13. Collins R., Reith C., Emberson J., et al., “Interpretation of the Evidence for the Efficacy and Safety of Statin Therapy,” Lancet 388 (2016): 2532–2561. [DOI] [PubMed] [Google Scholar]
14. Glebavičiūtė G., Vijaya A. K., and Preta G., “Effect of Statin Lipophilicity on the Proliferation of Hepatocellular Carcinoma Cells,” Biology‐Basel 13 (2024): 455. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Jiang W., Hu J. W., He X. R., Jin W. L., and He X. Y., “Statins: A Repurposed Drug to Fight Cancer,” Journal of Experimental & Clinical Cancer Research 40 (2021): 241. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Jaiswal V., Agrawal V., Ang S. P., et al., “Post‐Diagnostic Statin Use and Its Association With Cancer Recurrence and Mortality in Breast Cancer Patients: A Systematic Review and Meta‐Analysis,” European Heart Journal ‐ Cardiovascular Pharmacotherapy 9 (2023): 731–740. [DOI] [PubMed] [Google Scholar]
17. Ding S., Yang F., Lai P., et al., “Association Between Statin Usage and Mortality Outcomes in Aging U.S. Cancer Survivors: A Nationwide Cohort Study,” Aging Clinical and Experimental Research 36 (2024): 200. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Huang B., Song B. L., and Xu C., “Cholesterol Metabolism in Cancer: Mechanisms and Therapeutic Opportunities,” Nature Metabolism 2 (2020): 132–141. [DOI] [PubMed] [Google Scholar]
19. Zhou Q., Jiao Z., Liu Y., Devreotes P. N., and Zhang Z., “The Effects of Statins in Patients With Advanced‐Stage Cancers—A Systematic Review and Meta‐Analysis,” Frontiers in Oncology 13 (2023): 1234713. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Kim D. S., Ahn H. S., and Kim H. J., “Statin Use and Incidence and Mortality of Breast and Gynecology Cancer: A Cohort Study Using the National Health Insurance Claims Database,” International Journal of Cancer 150 (2022): 1156–1165. [DOI] [PubMed] [Google Scholar]
21. Wang K. H., Liu C. H., and Ding D. C., “Statins as Repurposed Drugs in Gynecological Cancer: A Review,” International Journal of Molecular Sciences 23 (2022): 13937. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Bhowmick S., Biswas T., Ahmed M., Roy D., and Mondal S., “Caveolin‐1 and Lipids: Association and Their Dualism in Oncogenic Regulation,” Biochimica Et Biophysica Acta. Reviews on Cancer 1878 (2023): 189002. [DOI] [PubMed] [Google Scholar]
23. Ruzzi F., Cappello C., Semprini M. S., et al., “Lipid Rafts, Caveolae, and Epidermal Growth Factor Receptor Family: Friends or Foes?,” Cell Communication and Signaling: CCS 22 (2024): 489. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Yang C., He B., Dai W., et al., “The Role of Caveolin‐1 in the Biofate and Efficacy of Anti‐Tumor Drugs and Their Nano‐Drug Delivery Systems,” Acta Pharmaceutica Sinica B 11 (2021): 961–977. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Dini A., Barker H., Piki E., et al., “A Multiplex Single‐Cell RNA‐Seq Pharmacotranscriptomics Pipeline for Drug Discovery,” Nature Chemical Biology 21 (2025): 432–442. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Song Y., An O., Ren X., et al., “RNA Editing Mediates the Functional Switch of COPA in a Novel Mechanism of Hepatocarcinogenesis,” Journal of Hepatology 74 (2021): 135–147. [DOI] [PubMed] [Google Scholar]
27. Nayak R., Pandey S., Kumar D., Kumar S., and Pai K. S. R., “Signaling Networks and MiRNA Crosstalk in Ovarian Cancer Chemoresistance,” Journal of Ovarian Research 18 (2025): 185. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Chou T. C., “Drug Combination Studies and Their Synergy Quantification Using the Chou‐Talalay Method,” Cancer Research 70 (2010): 440–446. [DOI] [PubMed] [Google Scholar]
29. Safran M., Solomon I., Shmueli O., et al., “GeneCards 2002: Towards a Complete, Object‐Oriented, Human Gene Compendium,” Bioinformatics 18 (2002): 1542–1543. [DOI] [PubMed] [Google Scholar]
30. Baker E., Bubier J. A., Reynolds T., Langston M. A., and Chesler E. J., “GeneWeaver: Data Driven Alignment of Cross‐Species Genomics in Biology and Disease,” Nucleic Acids Research 44 (2016): D555–D559. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Subramanian A., Tamayo P., Mootha V. K., et al., “Gene Set Enrichment Analysis: A Knowledge‐Based Approach for Interpreting Genome‐Wide Expression Profiles,” Proceedings of the National Academy of Sciences of the United States of America 102 (2005): 15545–15550. [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Liu H., Liu Y., Zhou Y., et al., “TM7SF2‐Induced Lipid Reprogramming Promotes Cell Proliferation and Migration via CPT1A/Wnt/β‐Catenin Axis in Cervical Cancer Cells,” Cell Death Discovery 10 (2024): 207. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Vasan N., Baselga J., and Hyman D. M., “A View on Drug Resistance in Cancer,” Nature 575 (2019): 299–309. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Wong T. L., Kong Y., and Ma S., “Lipid Metabolism in Cancer Cells: Its Role in Hepatocellular Carcinoma Progression and Therapeutic Resistance,” Hepatology Communications 9 (2025): e0837. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Wan S., He Q. Y., Yang Y., et al., “SPARC Stabilizes ApoE to Induce Cholesterol‐Dependent Invasion and Sorafenib Resistance in Hepatocellular Carcinoma,” Cancer Research 84 (2024): 1872–1888. [DOI] [PubMed] [Google Scholar]
36. Zhang H. Y., Ji S. C., Xie S. H., et al., “Design and Synthesis of Marine‐Inspired Itampolin A Derivatives to Overcome Chemoresistance in NSCLC via Cholesterol Homeostasis Modulation,” Marine Drugs 23 (2025): 357. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Ali A., Levantini E., Fhu C. W., et al., “CAV1‐GLUT3 Signaling Is Important for Cellular Energy and Can Be Targeted by Atorvastatin in Non‐Small Cell Lung Cancer,” Theranostics 9 (2019): 6157–6174. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Zhao X., Guo B., Sun W., Yu J., and Cui L., “Targeting Squalene Epoxidase Confers Metabolic Vulnerability and Overcomes Chemoresistance in HNSCC,” Advancement of Science 10 (2023): e2206878. [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Stouth D. W., Lebeau P. F., and Austin R. C., “Repurposing Two Old Friends to Fight Cancer: Caffeine and Statins,” Cancer Research 83 (2023): 2091–2092. [DOI] [PubMed] [Google Scholar]
40. Feng J., Dai W., Mao Y., et al., “Simvastatin Re‐Sensitizes Hepatocellular Carcinoma Cells to Sorafenib by Inhibiting HIF‐1α/PPAR‐γ/PKM2‐Mediated Glycolysis,” Journal of Experimental & Clinical Cancer Research 39 (2020): 24. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Li Y., Tang S., Wang H., et al., “A Pancreatic Cancer Organoid Biobank Links Multi‐Omics Signatures to Therapeutic Response and Clinical Evaluation of Statin Combination Therapy,” Cell Stem Cell 32 (2025): 1369–1389.e1314. [DOI] [PubMed] [Google Scholar]
42. Zhai Y. Y., Wang Q., Nong Q. Y., et al., “Pitavastatin Overcomes Multi‐Drug Resistance in CRC and NSCLC by Targeting the NRP1‐ZFX Axis,” Biochemical Pharmacology 241 (2025): 117183. [DOI] [PubMed] [Google Scholar]
43. Grundy S. M., Stone N. J., Bailey A. L., et al., “2018 AHA/ACC/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the Management of Blood Cholesterol: Executive Summary: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines,” Circulation 139 (2019): e1046–e1081. [DOI] [PubMed] [Google Scholar]
44. Guo C., Wan R., He Y., et al., “Therapeutic Targeting of the Mevalonate‐Geranylgeranyl Diphosphate Pathway With Statins Overcomes Chemotherapy Resistance in Small Cell Lung Cancer,” Nature Cancer 3 (2022): 614–628. [DOI] [PubMed] [Google Scholar]
45. Hu B., Zou T., Qin W., et al., “Inhibition of EGFR Overcomes Acquired Lenvatinib Resistance Driven by STAT3‐ABCB1 Signaling in Hepatocellular Carcinoma,” Cancer Research 82 (2022): 3845–3857. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Gupta V. K., Sharma N. S., Kesh K., et al., “Metastasis and Chemoresistance in CD133 Expressing Pancreatic Cancer Cells Are Dependent on Their Lipid Raft Integrity,” Cancer Letters 439 (2018): 101–112. [DOI] [PubMed] [Google Scholar]
47. Wang M., Cao Y., Ren C., et al., “PTRF Confers Melanoma‐Acquired Drug Resistance Through the Upregulation of EGFR,” Cell Proliferation 59 (2025): e70086. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Pereira P. M. R., Mandleywala K., Monette S., et al., “Caveolin‐1 Temporal Modulation Enhances Antibody Drug Efficacy in Heterogeneous Gastric Cancer,” Nature Communications 13 (2022): 2526. [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Wang X., Lu B., Dai C., et al., “Caveolin‐1 Promotes Chemoresistance of Gastric Cancer Cells to Cisplatin by Activating WNT/β‐Catenin Pathway,” Frontiers in Oncology 10 (2020): 46. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Zhang H., Sun Y., Liu R., et al., “The Role of Tumor Microenvironment and Signaling Pathways in Regulating Breast Cancer Stem Cells: Implications for Therapy Resistance and Tumor Recurrence,” Drug Resistance Updates 84 (2025): 101315. [DOI] [PubMed] [Google Scholar]
51. Chen S., Zhong M., Wang X., et al., “Activation of Epigenetic Reprogramming via Crotonylation Overcomes Resistance to EGFR‐TKI Therapy in Lung Cancer,” Proceedings of the National Academy of Sciences of the United States of America 122 (2025): e2509255122. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Liu B., Zhang W., Ji Y., et al., “Targeting the CCL5/CCR5 Axis in Tumor‐Stromal Crosstalk to Overcome Cisplatin Resistance in Neuroendocrine Prostate Cancer,” Journal of Experimental & Clinical Cancer Research 44 (2025): 296. [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Zhu J., Xiong Y., Zhang Y., et al., “Simvastatin Overcomes the pPCK1‐pLDHA‐SPRINGlac Axis‐Mediated Ferroptosis and Chemo‐Immunotherapy Resistance in AKT‐Hyperactivated Intrahepatic Cholangiocarcinoma,” Cancer Communications 45 (2025): 1038–1071. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FSB2-40-e71873-s001.pdf^{(3.4MB, pdf)}

Table S1: Primer sequences used for qRT‐PCR.

FSB2-40-e71873-s003.docx^{(14.4KB, docx)}

Data S1: fsb271873‐sup‐0003‐Figures.pdf.

FSB2-40-e71873-s002.pdf^{(3.7MB, pdf)}

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author.

[fsb271873-bib-0001] 1. Siegel R. L., Kratzer T. B., Giaquinto A. N., Sung H., and Jemal A., “Cancer Statistics, 2025,” CA: A Cancer Journal for Clinicians 75 (2025): 10–45. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0002] 2. Wang S., Zhu Q., Lu Y., et al., “Update of Incidence and Survival in Patients With Cervical Cancer in the United States From 2000 to 2021,” Journal of Gynecologic Oncology 37 (2026): e36. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0003] 3. Brisson M., Kim J. J., Canfell K., et al., “Impact of HPV Vaccination and Cervical Screening on Cervical Cancer Elimination: A Comparative Modelling Analysis in 78 Low‐Income and Lower‐Middle‐Income Countries,” Lancet 395 (2020): 575–590. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0004] 4. Alfaro K., Maza M., Cremer M., Masch R., and Soler M., “Removing Global Barriers to Cervical Cancer Prevention and Moving Towards Elimination,” Nature Reviews. Cancer 21 (2021): 607–608. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0005] 5. Petrelli F., Riboldi V., Bruschieri L., et al., “First‐Line Treatment of Locally Advanced Cervical Carcinoma: An Updated Systematic Review and Bayesian Network Meta‐Analysis,” Cancer Treatment Reviews 135 (2025): 102921. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0006] 6. Lin X., Wang F., Chen J., et al., “N(6)‐Methyladenosine Modification of CENPK mRNA by ZC3H13 Promotes Cervical Cancer Stemness and Chemoresistance,” Military Medical Research 9 (2022): 19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0007] 7. Wang M., Liu J., Liao X., et al., “The SGK3‐Catalase Antioxidant Signaling Axis Drives Cervical Cancer Growth and Therapy Resistance,” Redox Biology 67 (2023): 102931. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0008] 8. Galluzzi L., Senovilla L., Vitale I., et al., “Molecular Mechanisms of Cisplatin Resistance,” Oncogene 31 (2012): 1869–1883. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0009] 9. Zhang C., Xu C., Gao X., and Yao Q., “Platinum‐Based Drugs for Cancer Therapy and Anti‐Tumor Strategies,” Theranostics 12 (2022): 2115–2132. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0010] 10. Li J., Guo Y., Zhang W., et al., “Cholesterol Metabolism: A Strategy for Overcoming Drug Resistance in Tumors,” Biochemical Pharmacology 238 (2025): 116974. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0011] 11. Jiang W., Jin W. L., and Xu A. M., “Cholesterol Metabolism in Tumor Microenvironment: Cancer Hallmarks and Therapeutic Opportunities,” International Journal of Biological Sciences 20 (2024): 2044–2071. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0012] 12. Wang Y., Cai L., Li H., et al., “Overcoming Cancer Resistance to Platinum Drugs by Inhibiting Cholesterol Metabolism,” Angewandte Chemie 62 (2023): e202309043. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0013] 13. Collins R., Reith C., Emberson J., et al., “Interpretation of the Evidence for the Efficacy and Safety of Statin Therapy,” Lancet 388 (2016): 2532–2561. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0014] 14. Glebavičiūtė G., Vijaya A. K., and Preta G., “Effect of Statin Lipophilicity on the Proliferation of Hepatocellular Carcinoma Cells,” Biology‐Basel 13 (2024): 455. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0015] 15. Jiang W., Hu J. W., He X. R., Jin W. L., and He X. Y., “Statins: A Repurposed Drug to Fight Cancer,” Journal of Experimental & Clinical Cancer Research 40 (2021): 241. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0016] 16. Jaiswal V., Agrawal V., Ang S. P., et al., “Post‐Diagnostic Statin Use and Its Association With Cancer Recurrence and Mortality in Breast Cancer Patients: A Systematic Review and Meta‐Analysis,” European Heart Journal ‐ Cardiovascular Pharmacotherapy 9 (2023): 731–740. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0017] 17. Ding S., Yang F., Lai P., et al., “Association Between Statin Usage and Mortality Outcomes in Aging U.S. Cancer Survivors: A Nationwide Cohort Study,” Aging Clinical and Experimental Research 36 (2024): 200. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0018] 18. Huang B., Song B. L., and Xu C., “Cholesterol Metabolism in Cancer: Mechanisms and Therapeutic Opportunities,” Nature Metabolism 2 (2020): 132–141. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0019] 19. Zhou Q., Jiao Z., Liu Y., Devreotes P. N., and Zhang Z., “The Effects of Statins in Patients With Advanced‐Stage Cancers—A Systematic Review and Meta‐Analysis,” Frontiers in Oncology 13 (2023): 1234713. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0020] 20. Kim D. S., Ahn H. S., and Kim H. J., “Statin Use and Incidence and Mortality of Breast and Gynecology Cancer: A Cohort Study Using the National Health Insurance Claims Database,” International Journal of Cancer 150 (2022): 1156–1165. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0021] 21. Wang K. H., Liu C. H., and Ding D. C., “Statins as Repurposed Drugs in Gynecological Cancer: A Review,” International Journal of Molecular Sciences 23 (2022): 13937. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0022] 22. Bhowmick S., Biswas T., Ahmed M., Roy D., and Mondal S., “Caveolin‐1 and Lipids: Association and Their Dualism in Oncogenic Regulation,” Biochimica Et Biophysica Acta. Reviews on Cancer 1878 (2023): 189002. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0023] 23. Ruzzi F., Cappello C., Semprini M. S., et al., “Lipid Rafts, Caveolae, and Epidermal Growth Factor Receptor Family: Friends or Foes?,” Cell Communication and Signaling: CCS 22 (2024): 489. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0024] 24. Yang C., He B., Dai W., et al., “The Role of Caveolin‐1 in the Biofate and Efficacy of Anti‐Tumor Drugs and Their Nano‐Drug Delivery Systems,” Acta Pharmaceutica Sinica B 11 (2021): 961–977. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0025] 25. Dini A., Barker H., Piki E., et al., “A Multiplex Single‐Cell RNA‐Seq Pharmacotranscriptomics Pipeline for Drug Discovery,” Nature Chemical Biology 21 (2025): 432–442. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0026] 26. Song Y., An O., Ren X., et al., “RNA Editing Mediates the Functional Switch of COPA in a Novel Mechanism of Hepatocarcinogenesis,” Journal of Hepatology 74 (2021): 135–147. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0027] 27. Nayak R., Pandey S., Kumar D., Kumar S., and Pai K. S. R., “Signaling Networks and MiRNA Crosstalk in Ovarian Cancer Chemoresistance,” Journal of Ovarian Research 18 (2025): 185. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0028] 28. Chou T. C., “Drug Combination Studies and Their Synergy Quantification Using the Chou‐Talalay Method,” Cancer Research 70 (2010): 440–446. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0029] 29. Safran M., Solomon I., Shmueli O., et al., “GeneCards 2002: Towards a Complete, Object‐Oriented, Human Gene Compendium,” Bioinformatics 18 (2002): 1542–1543. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0030] 30. Baker E., Bubier J. A., Reynolds T., Langston M. A., and Chesler E. J., “GeneWeaver: Data Driven Alignment of Cross‐Species Genomics in Biology and Disease,” Nucleic Acids Research 44 (2016): D555–D559. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0031] 31. Subramanian A., Tamayo P., Mootha V. K., et al., “Gene Set Enrichment Analysis: A Knowledge‐Based Approach for Interpreting Genome‐Wide Expression Profiles,” Proceedings of the National Academy of Sciences of the United States of America 102 (2005): 15545–15550. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0032] 32. Liu H., Liu Y., Zhou Y., et al., “TM7SF2‐Induced Lipid Reprogramming Promotes Cell Proliferation and Migration via CPT1A/Wnt/β‐Catenin Axis in Cervical Cancer Cells,” Cell Death Discovery 10 (2024): 207. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0033] 33. Vasan N., Baselga J., and Hyman D. M., “A View on Drug Resistance in Cancer,” Nature 575 (2019): 299–309. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0034] 34. Wong T. L., Kong Y., and Ma S., “Lipid Metabolism in Cancer Cells: Its Role in Hepatocellular Carcinoma Progression and Therapeutic Resistance,” Hepatology Communications 9 (2025): e0837. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0035] 35. Wan S., He Q. Y., Yang Y., et al., “SPARC Stabilizes ApoE to Induce Cholesterol‐Dependent Invasion and Sorafenib Resistance in Hepatocellular Carcinoma,” Cancer Research 84 (2024): 1872–1888. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0036] 36. Zhang H. Y., Ji S. C., Xie S. H., et al., “Design and Synthesis of Marine‐Inspired Itampolin A Derivatives to Overcome Chemoresistance in NSCLC via Cholesterol Homeostasis Modulation,” Marine Drugs 23 (2025): 357. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0037] 37. Ali A., Levantini E., Fhu C. W., et al., “CAV1‐GLUT3 Signaling Is Important for Cellular Energy and Can Be Targeted by Atorvastatin in Non‐Small Cell Lung Cancer,” Theranostics 9 (2019): 6157–6174. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0038] 38. Zhao X., Guo B., Sun W., Yu J., and Cui L., “Targeting Squalene Epoxidase Confers Metabolic Vulnerability and Overcomes Chemoresistance in HNSCC,” Advancement of Science 10 (2023): e2206878. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0039] 39. Stouth D. W., Lebeau P. F., and Austin R. C., “Repurposing Two Old Friends to Fight Cancer: Caffeine and Statins,” Cancer Research 83 (2023): 2091–2092. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0040] 40. Feng J., Dai W., Mao Y., et al., “Simvastatin Re‐Sensitizes Hepatocellular Carcinoma Cells to Sorafenib by Inhibiting HIF‐1α/PPAR‐γ/PKM2‐Mediated Glycolysis,” Journal of Experimental & Clinical Cancer Research 39 (2020): 24. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0041] 41. Li Y., Tang S., Wang H., et al., “A Pancreatic Cancer Organoid Biobank Links Multi‐Omics Signatures to Therapeutic Response and Clinical Evaluation of Statin Combination Therapy,” Cell Stem Cell 32 (2025): 1369–1389.e1314. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0042] 42. Zhai Y. Y., Wang Q., Nong Q. Y., et al., “Pitavastatin Overcomes Multi‐Drug Resistance in CRC and NSCLC by Targeting the NRP1‐ZFX Axis,” Biochemical Pharmacology 241 (2025): 117183. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0043] 43. Grundy S. M., Stone N. J., Bailey A. L., et al., “2018 AHA/ACC/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the Management of Blood Cholesterol: Executive Summary: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines,” Circulation 139 (2019): e1046–e1081. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0044] 44. Guo C., Wan R., He Y., et al., “Therapeutic Targeting of the Mevalonate‐Geranylgeranyl Diphosphate Pathway With Statins Overcomes Chemotherapy Resistance in Small Cell Lung Cancer,” Nature Cancer 3 (2022): 614–628. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0045] 45. Hu B., Zou T., Qin W., et al., “Inhibition of EGFR Overcomes Acquired Lenvatinib Resistance Driven by STAT3‐ABCB1 Signaling in Hepatocellular Carcinoma,” Cancer Research 82 (2022): 3845–3857. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0046] 46. Gupta V. K., Sharma N. S., Kesh K., et al., “Metastasis and Chemoresistance in CD133 Expressing Pancreatic Cancer Cells Are Dependent on Their Lipid Raft Integrity,” Cancer Letters 439 (2018): 101–112. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0047] 47. Wang M., Cao Y., Ren C., et al., “PTRF Confers Melanoma‐Acquired Drug Resistance Through the Upregulation of EGFR,” Cell Proliferation 59 (2025): e70086. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0048] 48. Pereira P. M. R., Mandleywala K., Monette S., et al., “Caveolin‐1 Temporal Modulation Enhances Antibody Drug Efficacy in Heterogeneous Gastric Cancer,” Nature Communications 13 (2022): 2526. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0049] 49. Wang X., Lu B., Dai C., et al., “Caveolin‐1 Promotes Chemoresistance of Gastric Cancer Cells to Cisplatin by Activating WNT/β‐Catenin Pathway,” Frontiers in Oncology 10 (2020): 46. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0050] 50. Zhang H., Sun Y., Liu R., et al., “The Role of Tumor Microenvironment and Signaling Pathways in Regulating Breast Cancer Stem Cells: Implications for Therapy Resistance and Tumor Recurrence,” Drug Resistance Updates 84 (2025): 101315. [DOI] [PubMed] [Google Scholar]

[fsb271873-bib-0051] 51. Chen S., Zhong M., Wang X., et al., “Activation of Epigenetic Reprogramming via Crotonylation Overcomes Resistance to EGFR‐TKI Therapy in Lung Cancer,” Proceedings of the National Academy of Sciences of the United States of America 122 (2025): e2509255122. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0052] 52. Liu B., Zhang W., Ji Y., et al., “Targeting the CCL5/CCR5 Axis in Tumor‐Stromal Crosstalk to Overcome Cisplatin Resistance in Neuroendocrine Prostate Cancer,” Journal of Experimental & Clinical Cancer Research 44 (2025): 296. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb271873-bib-0053] 53. Zhu J., Xiong Y., Zhang Y., et al., “Simvastatin Overcomes the pPCK1‐pLDHA‐SPRINGlac Axis‐Mediated Ferroptosis and Chemo‐Immunotherapy Resistance in AKT‐Hyperactivated Intrahepatic Cholangiocarcinoma,” Cancer Communications 45 (2025): 1038–1071. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Simvastatin Restores Cisplatin Sensitivity by Suppressing the Caveolin‐1‐Mediated PI3K/AKT Signaling Pathway in Cisplatin‐Resistant Cervical Cancer Cells

Yujia Zhou

Hejing Liu

Shuangjia Pan

Luyi Ruan

Jiayi Ruan

Jiaru Chen

Huihui Ji

Xueqiong Zhu

ABSTRACT

1. Introduction

2. Materials and Methods

2.1. Cell Culture and Establishment of Cisplatin‐Resistant Cervical Cancer Cell Lines

2.2. Antibodies and Reagents

2.3. Cell Viability Assay (CCK‐8)

2.4. Drug Sensitivity Assay

FIGURE 1.

2.5. Western Blot Assay

2.6. Cholesterol Content Detection Assay

2.7. Drug Combination Assay

2.8. Flow Cytometry

2.9. Transwell Assay

2.10. Identification of Overlapping Genes

2.11. Enrichment Analysis

2.12. Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR)

2.13. Plasmid Construction and Cell Transfection

2.14. Xenograft Tumor Models

2.15. Paraffin Embedding and Section Preparation

2.16. Hematoxylin and Eosin (H&E) Staining

2.17. Immunohistochemistry (IHC) Assay of Mouse Tissues

2.18. TUNEL Assay

2.19. Immunohistochemistry (IHC) Assay of Human Cervical Cancer Tissues

2.20. Statistical Analysis

3. Results

3.1. Successful Construction and Validation of Cisplatin‐Resistant Cervical Cancer Cells

3.2. Increased Tolerance of Statins in Cisplatin‐Resistant Cervical Cancer Cells

3.3. Simvastatin and Cisplatin Had a Synergistic Anti‐Tumor Effect in Cisplatin‐Resistant Cervical Cancer Cells

TABLE 1.

TABLE 2.

FIGURE 2.

3.4. CAV1 Influenced the Sensitivity of Cisplatin in Cisplatin‐Resistant Cervical Cancer Cells

FIGURE 3.

3.5. Simvastatin Inhibited the CAV1/PI3K/AKT Pathway in Cisplatin‐Resistant Cervical Cancer Cells

FIGURE 4.

3.6. Simvastatin Enhanced the Antitumor Efficacy of Cisplatin In Vivo

FIGURE 5.

4. Discussion

5. Conclusion

Author Contributions

Funding

Ethics Statement

Conflicts of Interest

Supporting information

Acknowledgments

Contributor Information

Data Availability Statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases