Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for the real-time RT-PCR
| MRNA | Nucleotide sequence | GenBank ID |
|---|---|---|
| Human β-actin (s) | ctcttccagccttccttcct (780–799) | BC013835 |
| Human β-actin (as) | caccttcaccgttccagttt (963–982) | |
| GFP(s) | taccagcggtggtttgtttg (4091–4110) | U57609 |
| GFP(as) | gcagagcgaggtatgtaggc (4252–4271) | |
| β-Gal (s) | gctggataacgacattg (2435–2453) | U02451 |
| β-Gal (as) | cagcaccgcatcagcaag (2560–2577) |
