Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Description of gene probes developed and applied in this study
| Probe name (target position)a | Targeted phylogenetic group | Nucleotide sequence (5′-3′) | Hybridization temp (°C) |
|---|---|---|---|
| STEN838 (838-857) | Xanthomonadaceae | GATACTGGGCACCAAGTTGTG | 40 |
| OXAL635 (635-656) | Oxalobacteriaceae | TTCTAGCCTTGCAGTCTCCATC | 45 |
| ORGA620 (620-637) | Plastids | ACCGCCTGTCCAGAGTTG | 40 |
According to E. coli position (7).
