KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-Digoxigenin | Roche | Cat # 11333089001, RRID:AB_514496 |
| Chemicals, peptides, and recombinant proteins | ||
| HEPES | Carl Roth | CAS # 7365-45-9 |
| Tris | Carl Roth | CAS # 77-86-1 |
| Sodium Chloride | Carl Roth | CAS # 7647-14-5 |
| Potassium Glutamate | Sigma-Aldrich | CAS # 6382-01-0 |
| Magnesium Chloride | Carl Roth | CAS # 7791-18-6 |
| Zink Sulfate | Sigma-Aldrich | Cat # 221376 |
| Dextrose | Fisher | Cat # D16-1 |
| Sodium Phosphate-monobasic | Fisher | Cat # P285-500 |
| Sodium Phosphate-dibasic | Fisher | Cat # S375-500 |
| Ammonium Sulfate | Fisher | Cat # A702-500 |
| Glycerol | Fisher | Cat # G153-4 |
| Tris (2-Carboxyethyl) phosphine Hydrochloride (TCEP) | GoldBio | Cat # TCEP1 |
| EDTA | Carl Roth | CAS # 6381-92-6 |
| Bovine Serum Albumin | Carl Roth | CAS # 90604-29-8 |
| NTP | Promega | Cat # P1132 |
| Biotin-16-UTP | Jena Bioscience | NU-821-BIO16 |
| Digoxigenin-11-UTP | Jena Bioscience | NU-821-DIGX |
| RNA 5′ Polyphosphatase | Biosearch technologies | RP8092H |
| T4 Polynucleotide Kinase | New England Biolabs | Cat # M0201 |
| T4 RNA ligase 2 | New England Biolabs | Cat # M0239 |
| Ulp1 peptidase | Byrd et al.39 | N/A |
| Phosphocellulose (P-11) | Whatman, Sigma-Aldrich | Cat # Z753807 |
| Agarose | Sigma-Aldrich | Cat # A9539 |
| TAE buffer 50× | ThermoFisher | Cat # B49 |
| TBE buffer 10× | Roth | Cat # 3061 |
| RNA Gel Loading Dye (2X) | ThermoFisher | Cat # R0641 |
| SyBrSafe Nucleic Acid Gel Stain | Invitrogen, ThermoFisher | Cat # S33102 |
| The RNA storage solution | Thermo Scientific | Cat # AM7001 |
| Strep-Tactin Superflow resin | IBA LifeSciences | Cat # 21208 |
| Ni-NTA agarose beads | Qiagen | Cat # 36113 |
| BioLock | IBA Lifesciences | Cat # 2-0205-050 |
| Dithiothreitol (DTT) | ThermoFisher | Cat # R0861 |
| isopropyl β-D-1-thiogalactopyranoside (IPTG) | Biopioneer | Cat # C0012-100 |
| phenylmethylsulfonyl fluoride (PMSF) | Sigma-Aldrich | Cat # P7626-25G |
| Kanamycin sulfate | Fisher | Cat # BP906-5 |
| chloramphenicol | Fisher | Cat # BP904-100 |
| β-mercaptoethanol | ThermoScientific | Cat # 125472500 |
| Desthiobiotin | IBA Lifesciences | Cat # 2-1000-002 |
| imidazole | ThermoFisher | Cat # A10221.36 |
| Polyethyleneimine (PEI) | Sigma-Aldrich | CAS # 26658-46-8 |
| 1% w/w TEV protease | Kirchdoerfer et al.8 | N/A |
| Protease Inhibitor Tablets, EDTA-free | Pierce, ThermoFisher | Cat # A32965 |
| NZCYM Broth | Research Products International | SKU # N72000-250.0 |
| Critical commercial assays | ||
| Phusion High-Fidelity PCR kit | New England Biolabs | Cat # E0553 |
| Monarch PCR & DNA Cleanup Kit | New England Biolabs | Cat # T1030 |
| HiScribe T7 High Yield RNA Synthesis Kit | New England Biolabs | Cat # E2040 |
| RNA Clean & Concentrator | Zymo Research | Cat # R1015, R1017 |
| pET-46 Ek/LIC Vector Kit | Novagen | Cat # 71335 |
| pFastBac Dual Expression Vector | Life Technologies | Cat # 10712024 |
| MAX Efficiency DH10Bac Competent Cells | Life Technologies | Cat # 10361012 |
| Cellfectin II Reagent | Life Technologies | Cat # 10362100 |
| pSUMO plasmid | LifeSensors | Cat # pE1001K |
| QuikChange II Site-Directed Mutagenesis Kit | Agilent Technologies | Cat # 200523 |
| Superdex 200 Increase 10/300 GL | GE Life Sciences | Cat # GE28-9909-44 |
| HisTrap FF column | Cytiva | Cat # 17525501 |
| HiTrap SP Sepharos FF column | Cytiva | Cat # 17515701 |
| Sephacyl S200-HR HiPrep 16/60 column | Cytiva | Cat # 17116601 |
| Pierce BCA Protein Assay Kit | ThermoFisher | Cat # 23225 |
| Deposited data | ||
| All data obtained in this study | This study | https://doi.org/10.48338/VU01-DY3HI3 |
| Experimental models: Cell lines | ||
| Sf9 cells | Expression Systems | Cat # 94-001F |
| Sf21 cells | Expression Systems | Cat # 94-003F |
| Oligonucleotides | ||
| K288A SDM- Forward Primer- GCCGGGTACCGGCGCGAGCCACTTTGCG | IDT | N/A |
| K288A SDM Reverse Primer - CGCAAAGTGGCTCGCGCCGGTACCCGGC | IDT | N/A |
| Oligo’s for dsRNA template and RNA hairpins (Table S1) | Biomers | N/A |
| Recombinant DNA | ||
| pFastBac DNAs with nsp12 gene, double TEV site and strep-tag | Genscript | GenBank MN985325 |
| nsp7 genes cloned into pET46 with an N-terminal 6× histidine tag, enterokinase site, TEV site | Novagen | GenBank MN985325 |
| nsp8 genes cloned into pET46 with an N-terminal 6× histidine tag, enterokinase site, TEV site | Novagen | GenBank MN985325 |
| nsp13 gene from SARS-CoV-2 Washington isolate as E. coli codon-optimized fragment | GenScript | GenBank MN985325 |
| pBAD/Myc-HisB plasmid (Invitrogen) with mukB-His10 | Papini et al.40 | N/A |
| pMK-T (ColE1 ori, KanR) plasmid (ThermoFisher) with a palindromic sequence | Papini et al.40 | N/A |
| Software and algorithms | ||
| Python 3 | Python Software Foundation | https://www.python.org/download/releases/3.0/ |
| labVIEW | National Instruments41 | https://www.ni.com/en-us.html |
| Bead-tracking software in labVIEW | Cnossen et al.42 | http://www.github.com/jcnossen/BeadTracker |
| Data analysis code | This study | https://doi.org/10.48338/VU01-DY3HI3 |
| Other | ||
| 3130XL Genetic Analyzer | Applied Biosystems | Cat # 106MI60-01 |
| Akta Pure 25 M FPLC | Cytiva | 29018226 |
| Amicon Ultra-15 centrifugation filter | MilliporeSigma | Cat # UFC9010D |
| Centrifugal concentrator | Vivaspin | Cat # VS0404 |
| Microfluidizer | Microfluidics | Cat # LM20 |
| Dynabeads M-270 Streptavidin | Invitrogen | Cat # 65305 |
| Polystyrene beads | Sigma-Aldrich | SKU # LB3-1ML |
| 50× oil immersion objective lens | Nikon | Cat # MRL01502 |
| CMOS camera | Teledyne DALSA Falcon2 | Cat # FA-80-12M1H |
| Opto-mechanics | Thorlabs | https://www.thorlabs.de/ |
| Tube lens | Qioptic | Cat # G322304000 |
| Piezo | Physic Instrument (PI) | Cat # P-726.1CD |
| Motors (z-position, rotation) | Physic Instrument (PI) | Cat # M-126-PD1, C-150 |
| Pump | Cole-Parmer GmbH | Cat # 77122-32 |
| LED | OSRAM Opto | GTIN # 4062986000272 |
| Permanent magnets | Supermagnete | Cat # W-05-G |
| #1 Coverglass | OMNILAB, Menzel | Cat # 1184900 |
| Foil heater | Thorlabs | Cat # HT10K |
| Kapton tape | Thorlabs | Cat # KAP22-075 |
| PID temperature controller | Thorlabs | Cat # TC200 |
| GPU | NVIDIA | Cat # GK104-355-A2 |