Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jun 11.
Published in final edited form as: J Hymenopt Res. 2025 Aug 25;98:721–742. doi: 10.3897/jhr.98.163211

Synopeas ruficoxum Buhl (Hymenoptera, Platygastridae) is a natural enemy of soybean gall midge, Resseliella maxima Gagné (Diptera, Cecidomyiidae)

Sarah C von Gries 1, Jessica Awad 2, Elijah J Talamas 3, Anthony J McMechan 4, Robert L Koch 1, Amelia R I Lindsey 1
PMCID: PMC13251541  NIHMSID: NIHMS2167699  PMID: 42281790

Abstract

Platygastridae (Hymenoptera) is known as a ‘dark taxon’ as it is highly diverse and understudied. Within Platygastridae, one of the largest genera is Synopeas Förster, species of which parasitize Cecidomyiidae (Diptera). This study identifies a new host association between these two families, with Synopeas ruficoxum Buhl as the second reported parasitoid of soybean gall midge, Resseliella maxima Gagné. Parasitoids were reared from soybean stems infested with R. maxima collected in Nebraska, USA. Furthermore, PCR assays confirmed that R. maxima larvae are parasitized by S. ruficoxum in the field. All S. ruficoxum specimens were female, suggesting that this may be an asexually reproducing population. We found that some, but not all, S. ruficoxum were infected with a bacterium, Wolbachia, known to mediate asexual reproduction in other insects, suggesting other factors may be responsible for the all-female population. Publicly available barcoding data allowed us to determine that S. ruficoxum is also present in Eastern Canada, which is beyond the known geographic range of R. maxima. This suggests that S. ruficoxum has other hosts or that the geographic range of R. maxima is broader than currently documented. A redescription and diagnostic data for S. ruficoxum are provided, advancing the ability to use this parasitoid for biological control of R. maxima.

Keywords: biological control, host association, parasitism, Synopeas maximum, Wolbachia, parthenogenesis

Introduction

Platygastridae (Hymenoptera) is known as a ‘dark taxon’, a term used to describe understudied taxa that are highly diverse, difficult to identify, and in need of professional taxonomic organization and identification (Srivathsan et al. 2022; Awad et al. 2023). Within Platygastridae, Synopeas Förster, 1856, is one of the largest genera, containing close to 400 described species (Awad et al. 2021). Synopeas species are koinobiont endoparasitoids, which means they oviposit into eggs or young larvae and the parasitoid waits to metamorphose until the last larval instar or prepupal stage of the host (Austin, 1984; Kim et al. 2011; Abram et al. 2012; Chen et al. 2021). Synopeas species are only known to parasitize Cecidomyiidae (Diptera), and many species appear to be host-specific, although relatively few host records exist (Vlug 1995; Awad et al. 2021).

Cecidomyiidae is also a diverse dark taxon, found globally, with new species regularly being discovered and described (Huang et al. 2022; Srivathsan et al. 2022). The soybean gall midge, Resseliella maxima Gagné, 2019 (Diptera: Cecidomyiidae) is one such recently described species (Gagné et al. 2019). Resseliella maxima has been reported in seven states in the midwestern USA (McMechan et al. 2023), where it is a pest of soybean, Glycine max (L.) Merr. (Fabalaes: Fabaceae), with potential to cause high yield reductions (McMechan et al. 2021; Helton et al. 2022). Resseliella maxima has also been found to infest other Fabaceae, including sweet clover (Melilotus officinalis (L.) Lam.), alfalfa (Medicago sativa L.), and dry beans (Phaseolus vulgaris L.) (Potter et al. 2022; Bragard et al. 2023). However, it remains unknown if R. maxima is a previously unknown exotic species that invaded the USA or if it is a native that expanded its host range to include soybean.

Recent surveys for natural enemies of R. maxima in Minnesota led to the discovery of Synopeas maximum Awad & Talamas, 2023 (Melotto et al. 2023a), which was confirmed to parasitize R. maxima (Melotto et al. 2023b). The work presented here documents a second species, Synopeas ruficoxum Buhl, 2006 that also parasitizes R. maxima. The original description of S. ruficoxum is brief, based solely on the morphology of a single female specimen (Buhl 2006), and is insufficient for diagnosis. Therefore, a morphological and molecular redescription of S. ruficoxum is provided. This study also marks the first record of S. ruficoxum from the United States.

Methods

Field collection and laboratory rearing

Synopeas specimens were acquired in 2021 and 2023 using methods modified from Melotto et al. (2023b). In brief, R. maxima-infested soybean stems were collected from soybean field edges, placed into emergence buckets in the laboratory, and monitored for emergence of adult insects. These adult insects were collected, freeze-killed, and preserved in 95% ethanol for morphological and molecular identification. In 2021, R. maxima-infested soybean stems were collected on 24 and 27 August from two fields in Lancaster County, Nebraska. Emerged adult insects from 2021 were then pooled together for preservation and storage. In 2023, R. maxima-infested soybean stems were collected from two fields in Nebraska, one field near the city of Syracuse (Otoe County) and the other near the city of Wahoo (Saunders County). Fields were sampled every two weeks starting when fields began to show signs of infestation (Syracuse: 22 June; Wahoo: 27 June) and continued until soybean plants senesced (Syracuse: 18 August; Wahoo: 25 August). Emerged adult insects from 2023 were then separated by field and sampling date for preservation and storage.

DNA barcoding

Genomic DNA from individual specimens was extracted using a modified non-destructive HotSHOT protocol (Truett et al. 2000), as described in Melotto et al. (2023b). The cytochrome oxidase subunit I (COI) barcoding region was amplified with the universal primer pair LCO-1490/HCO-2198 (Folmer et al. 1994). Since all of the reared wasps of interest were female (see results), specimens were screened for Wolbachia, an endosymbiont found in insects and known to alter sex ratios (Werren et al. 2008). Wolbachia-specific primers Wspec_F/Wspec_R (Werren & Windsor, 2000) were used to amplify the 16S rRNA gene. All PCR reactions were prepared in a final volume of 20 μL with Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs), 1 μL of DNA template, and 500 nM of each primer alongside positive and negative controls. Thermalcycling was performed on a Mastercycler nexus PCR cycler (Eppendorf ) with an initial denaturation of 2 min at 98 °C, followed by 35 cycles of amplification (COI: 10 s at 98 °C, 30 s at 55 °C, and 20 s at 72 °C; Wspec: 15 s at 98 °C, 15 s at 60 °C, and 15 s at 72 °C), and a final elongation of 2 min at 72 °C. PCR products were separated on a 1% agarose gel via electrophoresis and imaged under ultraviolet light after staining with 3X GelRed (Biotium). The COI PCR products were cleaned with the DNA Clean & Concentrator-5 Kit (Zymo Research) according to the manufacturer’s instructions and sequenced in both directions via Sanger sequencing (ACGT, Inc. Wheeling, IL, USA). Sequences were inspected for peak quality, aligned, and trimmed of priming regions in SnapGene version 6.2.1. The COI sequences were deposited in BOLD (Barcode of Life Data System) and accession numbers are listed in Table 1.

Table 1.

Specimens of Synopeas ruficoxum examined.

Lab Code Collecting Unit Identifier Collection Location Year Collected Haplotype BOLD ID

NA NHMD 918361 (holotype) Belleville, Canada 2005 NA NA
GMP#04688 BIOUG26568-F09 Montreal, Canada 2014 3 POBGC998-15
GMP#07677 BIOUG32277-G12 Guelph, Canada 2015 3 AGAKN602-17
PN12 FSCA 00034119 Lancaster Co., NE 2021 NA NA
WB27 CNC664038 Syracuse, NE 2023 1 SRSVG001-24
WB28 CNC664039 Syracuse, NE 2023 1 SRSVG002-24
WB29 CNC664040 Wahoo, NE 2023 1 SRSVG003-24
WB30 CNC664041 Syracuse, NE 2023 1 SRSVG004-24
WB31 USNMENT01977476 Syracuse, NE 2023 1 SRSVG005-24
WB32 USNMENT01977477 Syracuse, NE 2023 1 SRSVG006-24
WB33 USNMENT01977478 Syracuse, NE 2023 1 SRSVG007-24
WB34 USNMENT01977479 Syracuse, NE 2023 1 SRSVG008-24
WB35 FSCA 00033412 Syracuse, NE 2023 1 SRSVG009-24
WB36 FSCA 00033413 Wahoo, NE 2023 1 SRSVG010-24
WB38 FSCA 00033428 Wahoo, NE 2023 NA NA
WB40 FSCA 00033414 Wahoo, NE 2023 1 SRSVG011-24
WB41 FSCA 00033415 Wahoo, NE 2023 1 SRSVG012-24
WB43 FSCA 00033416 Syracuse, NE 2023 1 SRSVG013-24
WB44 FSCA 00033417 Syracuse, NE 2023 1 SRSVG014-24
WB45 FSCA 00033418 Syracuse, NE 2023 1 SRSVG015-24
WB46 FSCA 00033419 Syracuse, NE 2023 1 SRSVG016-24
WB47 FSCA 00033420 Syracuse, NE 2023 1 SRSVG017-24
WB48 FSCA 00033421 Syracuse, NE 2023 1 SRSVG018-24
WB49 FSCA 00033422 Syracuse, NE 2023 1 SRSVG019-24
WB50 FSCA 00033423 Wahoo, NE 2023 1 SRSVG020-24
WB51 FSCA 00033424 Wahoo, NE 2023 1 SRSVG021-24
WB52 FSCA 00033425 Syracuse, NE 2023 1 SRSVG022-24
WB55 FSCA 00033426 Wahoo, NE 2023 2 SRSVG023-24
WB56 FSCA 00033427 Syracuse, NE 2023 NA NA

Used in phylogenetic tree. NA indicates specimens without sequence data.

Phylogenetic analysis

BLASTn was used to query COI barcodes from Nebraska specimens against GenBank and identify putative conspecifics. Then, a phylogenetic reconstruction of Synopeas was performed with all unique S. ruficoxum haplotypes, previously published Synopeas sequences available on BOLD, and an outgroup from the genus Leptacis Förster, 1856 (Hymenoptera: Platygastridae) (Table 2). Specific Synopeas sequences were selected based on the previously published Synopeas phylogeny from Melotto et al. (2023a) to ensure breadth across the genus and resolution within the subgroup to which S. ruficoxum belongs. Sequences were aligned using MAFFT version 7.475 (Katoh and Standley 2013) with default parameters and manually inspected to confirm that codons were aligned (i.e., no frameshifts). Phylogenetic reconstruction was performed with IQ-Tree version 1.6.12 using model optimization option (TIM+F+I+G4 model selected) and 1000 ultrafast bootstrap replicates. The tree was rooted and formatted in FigTree version 1.4.4 and annotated in Inkscape version 1.3.2.

Table 2.

Seqeunces used in phylogenetic reconstruction.

BOLD ID BOLD Taxonomy BOLD Collection Localities

AGAKJ438-17 Leptacis species Canada, Ontario, Guelph
GMCAB1365-15 Platygastridae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
SMTPP3010-15 Synopeas species Canada, British Columbia, Fort St. James
PLECD2063-20 Platygastridae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
SSKJA3802-14 Synopeas species Canada, Nova Scotia, Kejimkujik National Park
SMTPL5931-15 Synopeas pennsylvanicum Canada, Manitoba, Winnipeg
SSKJA1568-14 Synopeas pennsylvanicum Canada, Nova Scotia, Kejimkujik National Park
GMSAV2013-13 Platygastridae South Africa, Gauteng
PLNDH1325-20 Platygastridae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
HPPPO207-13 Synopeas species Canada, Nova Scotia, Halifax
POBGC1293-15 Synopeas species Canada, Quebec, Montreal
GMRSA2644-14 Platygastridae Russia, Primorskiy Kray
GMGMR1684-18 Synopeas species Germany, Bavaria, Munich
CNLMO725-14 Synopeas species Canada, Quebec, La Mauricie National Park
SSKJB3297-14 Synopeas species Canada, Nova Scotia, Kejimkujik National Park
JSJUN2256-11 Platygastridae Canada, Ontario, Leeds and Grenville
OPPEI2554-17 Platygastrinae Canada, Ontario, Owen Sound
GMHGL156-13 Platygastrinae Honduras, Cortes, Cusuco National Park
JCCCY195-16 Platygastrinae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
PLUAK400-20 Platygastrinae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
PLUAJ560-20 Platygastrinae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
PLHCJ120-20 Platygastrinae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
PLTAF055-20 Platygastrinae Costa Rica, Guanacaste, Area de Conservacion Guanacaste
PLFDO1511-20 Platygastrinae Costa Rica, Guanacaste, Area de Conservacion Guanacaste

Listed here at the lowest taxonomic rank provided on BOLD.

Parasitoid-host association

To test the parasitoid-host association between S. ruficoxum and R. maxima, field-collected R. maxima larvae were screened for parasitism using PCR. Larvae were obtained by collecting R. maxima-infested soybean stems and dissecting out the larvae, as per Melotto et al. (2023b). Two stems were collected from the edge of the aforementioned field in Wahoo on 27 June and 11 July 2023. Of the larvae dissected from the stems, seven were randomly selected to be screened for parasitism by S. ruficoxum. DNA from individual larvae was extracted using a modified destructive protocol (Truett et al. 2000), as described in Melotto et al. (2023b).

For the detection and identification of S. ruficoxum DNA in R. maxima larvae, a S. ruficoxum-specific reverse primer (Sruf_Rmax_R: GATTCTAATATCAATTGAAGC) was designed. This primer was paired with the universal primer LCO-1490 (Folmer et al. 1994) to amplify a 370 bp region of COI. PCR reactions were prepared as above and thermal cycling was performed with an initial denaturation of 2 min at 98 °C, followed by 35 cycles of amplification (10 s at 98 °C, 30 s at 54 °C, and 20 s at 72 °C), and a final elongation of 2 min at 72 °C. Controls included a no-template negative control and DNA extracted from an S. ruficoxum adult as a positive control. The PCR products were separated, cleaned, and sequenced in the same manner as described above to test if the PCR amplicon was in fact derived from S. ruficoxum.

In parallel, to verify these larvae were R. maxima and not a different cecidomyiid, the larvae were barcoded using the universal degenerate primer pair LCO-1490-JJ2/HCO2198-JJ2 (Astrin et al. 2016), then aligned to a confirmed R. maxima sequence (GenBank accession number OQ342780). PCR reactions were prepared as above and thermal cycling was performed with an initial denaturation of 2 min at 98 °C, followed by 35 cycles of amplification (10 s at 98 °C, 30 s at 55 °C, and 20 s at 72 °C), and a final elongation of 2 min at 72 °C. The PCR products were separated, cleaned, and sequenced in the same manner as mentioned above.

Imaging

Brightfield photography was performed using a Macropod microphotography system (Macroscopic Solutions) with 10× and 20× Mitutoyo objective lenses. Scanning electron microscopy was performed with a Phenom XL G2 Desktop SEM. Image stacks were rendered in Helicon Focus, and images of primary types were deposited in Zenodo (Table 3). Images of reared voucher specimens were deposited in BOLD (Table 1).

Table 3.

World species of the Synopeas craterum-group (Ectadius sensu Förster).

Species Year Type repository Type Locality Images

S. abdominator (Fouts) 1925 USNM USA: Texas USNMENT00954758
S. atturense Mukerjee 1981 USNM India USNMENT01109823
S. bengalense Mukerjee 1978 USNM India USNMENT01109922
S. bennetti Buhl 2011 NHMUK Trinidad
S. craterum (Walker) 1835 NMINH England https://zenodo.org/records/13931982
S. fontali Buhl 2002 MNCN Panama
S. grenadense (Ashmead) 1895 NHMUK Grenada https://zenodo.org/records/13935191
S. guatemalae Buhl 2003 MZLU Guatemala
S. halmaherense Buhl 2008 NBC Indonesia https://zenodo.org/records/4503235
S. indopeninsulare Mani 1975 USNM India USNMENT01109919
S. infuscatum Buhl 2008 NBC Indonesia https://zenodo.org/records/4503181
S. insulare (Ashmead) 1894 NHMUK St. Vincent
S. longifuniculus Buhl 2002 MNCN Panama
S. macrurus (Ashmead) 1895 NHMUK Grenada https://zenodo.org/records/13935199
S. masneri Buhl, O’Connor & Ashe 2009 NMINH Indonesia https://zenodo.org/records/4563030
S. mineoi Buhl, O’Connor & Ashe, 2009 NMINH Indonesia https://zenodo.org/records/4539460
S. mukerjeei Buhl 1997 NHMD Philippines https://zenodo.org/records/4503979
S. nievesaldreyi Buhl 2002 MNCN Panama
S. nigricorne Buhl 2015a NHMD Chile https://zenodo.org/records/14194534
S. nigroides Buhl 2001 MZLU Ecuador
S. orbitaliforme Buhl 2011 NHMUK Trinidad
S. polaszeki Buhl 2004a NHMD Cote d’Ivoire https://zenodo.org/records/14201398
S. politiventre Buhl 2015a NHMD Chile https://zenodo.org/records/1037312
S. popovicii Buhl 2015b NHMD Madagascar https://zenodo.org/records/14199492
S. rionegroense Buhl 2004b HNHM Argentina
S. royi Buhl 2001 MZLU South Africa
S. ruficoxum Buhl 2006 NHMD Canada https://zenodo.org/records/14037325
S. saintexuperyi Buhl 1997 NHMD Papua New Guinea https://zenodo.org/records/4501968
S. saltaense Buhl 2009 HNHM Argentina
S. saopaulense Buhl 2004b HNHM Brazil
S. solomonensis Buhl 1997 NHMD Solomon Islands
S. striatum (Risbec) 1958 RMCA DRC
S. tanzanianum Buhl 2010 NHMD Tanzania
S. zaitama Yoshida & Hirashima 1979 KUEC Japan https://zenodo.org/records/14193063

Institutional abbreviations

Specimens examined during this study are deposited in the following institutions and abbreviated as follows:

HNHM Hungarian Museum of Natural History, Budapest, Hungary
KUEC Kyushu University Entomological Collection, Fukuoka, Japan
MNCN Museo Nacional de Ciencias Naturales, Madrid, Spain
MZLU Lund University Zoological Museum, Lund, Sweden
NBC Naturalis Biodiversity Center, Leiden, Netherlands
NHMD Natural History Museum of Denmark, Copenhagen, Denmark
NHMUK Natural History Museum, London, UK
NMINH National Museum of Ireland, Natural History, Dublin, Ireland
RMCA Royal Museum for Central Africa, Tervuren, Belgium
USNM United States National Museum, Washington DC, USA

Results

Laboratory rearing

From the R. maxima-infested stems collected in Nebraska in 2021 and 2023, a total of 31 Synopeas adults were reared, one from 2021 and 30 from 2023. The reared Synopeas spp. were binned into two morphotypes, one of which was confirmed to be S. maximum (n = 5). Of the five S. maximum, all of which were reared in 2023, one female was reared from the stems collected from the field near Syracuse, and the remaining adults (three females and one male) were reared from stems collected from the field near Wahoo. The other morphotype (n = 26), had not been observed in previous work in Minnesota (Melotto et al. 2023a, b). Of these 26 unidentified Synopeas sp., all of which were female, a single wasp was reared from stems collected in 2021, and 25 were reared from stems collected in 2023 (17 from the field near Syracuse and 8 from the field near Wahoo). For the single wasp reared in 2021, emergence timing was not recorded; however, for those reared in 2023, Synopeas adults emerged from 21 to 62 days after stems were collected. Finally, from those same emergence buckets, 792 and 1,989 adult R. maxima were reared in 2021 and 2023, respectively.

DNA barcoding and wasp identification

Of the 26 unidentified Synopeas reared from stems collected from Nebraska, 23 were successfully barcoded using LCO/HCO primers (Table 1). Of the 23 COI sequences, 22 of them were 100% identical to one another (haplotype 1) and one was 99.5% identical to the rest (2 bp difference; haplotype 2) (Table 1). These two haplotypes were similar to two additional sequences on GenBank labeled as ‘Platygastridae sp.’ One of these Platygastridae sp. sequences was from a wasp collected in 2014 in the Montreal Botanical Garden, Montreal, Quebec, Canada (BOLD ID: POBGC998–15), and the other was collected in 2015 in the Arkell Research Station, Guelph, Ontario, Canada (BOLD ID: AGAKN602–17) (Fig. 1). These two additional sequences were identical to each other, 97.9% similar to haplotype 1, and 97.7% similar to haplotype 2, defining these two specimens as an additional haplotype (haplotype 3) of what appeared to be the same species.

Figure 1.

Figure 1.

Geographic distribution of Synopeas ruficoxum and Resseliella maxima in the USA and Canada. Dots indicate locations where S. ruficoxum adults have been collected (Table 1). The holotype was collected in Belleville, Canada. Orange shading indicates the county-level geographic distribution of R. maxima (soybeangallmidge.org). Map was created in arcGIS Pro 3.3.0 using data obtained from the publicly available sources, including library.carleton.ca/find/gis/geospatial-data for state and province boundaries and soybeangallmidge.org for R. maxima distribution. All shapefiles were standardized to the WGS 1984 coordinate system.

The two Canadian specimens were borrowed, and all specimens of this unidentified Synopeas sp. (n = 28; two from Canada, 26 from Nebraska) were identified as S. ruficoxum by morphological comparison to the holotype (Fig. 1, Table 1). Since the original description of S. ruficoxum is based on a single female specimen and the description is brief (Buhl 2006), a redescription is provided below (see “Results: Taxonomy”). Finally, since only female S. ruficoxum have been collected, specimens were screened for Wolbachia using Wolbachia-specific primers. Out of the 23 wasps that were barcoded, 16 (70%) were PCR-positive for Wolbachia DNA, which does not fully align with the hypothesis that Wolbachia is mediating parthenogenesis (see Discussion).

Phylogenetic analysis

A phylogeny of Synopeas was constructed from all unique S. ruficoxum haplotypes, S. maximum, and previously published Synopeas sequences (Fig. 2). While the backbone has relatively low bootstrap support (<60%), many species or putative species groups are strongly supported. Phylogenetic reconstruction supported S. maximum and S. ruficoxum as members of different species groups. This analysis supports the monophyly of S. ruficoxum and indicates that the Canadian haplotype is sister to the clade of USA haplotypes.

Figure 2.

Figure 2.

Phylogenetic tree of the genus Synopeas that focuses on S. ruficoxum collected from Nebraska and Canada, and S. maximum, another species associated with R. maxima. Collection localities associated with each sequence are available in Table 2. Nodes are color coded to indicate bootstrap support. Taxa are named by the barcode accession number (BOLD ID) and species name, if available. Branch lengths represent nucleotide substitutions per site.

Parasitoid-host association

Of seven field-collected R. maxima larvae, two screened positive for S. ruficoxum DNA. The S. ruficoxum-specific COI amplicons from these two specimens were sequenced, and both aligned with 100% identity to S. ruficoxum haplotype 1 (Table 1). The two larvae that were positive for S. ruficoxum were also barcoded, and were 99.5% similar to the corresponding COI region from the R. maxima mitochondrial genome (GenBank accession OQ342780) (Melotto et al. 2023c). Both R. maxima sequences were deposited in GenBank (accessions: PQ649846 and PQ649847). These results confirm the parasitoid-host association between S. ruficoxum and R. maxima.

Taxonomy

Elongation of the female metasoma, as seen in S. ruficoxum, was historically regarded as a genus-level character. Dolichotrypes Crawford & Bradley, 1911 was proposed for species with highly elongate and abruptly narrow T4–T6 (Fig. 3A); Sactogaster Förster, 1856 for species with S2 laterally compressed and ventrally expanded (Fig. 3D); and Ectadius Förster for species in which the metasoma is elongate, without modification to S2 or extreme elongation of T6 (Fig. 3B, C). In contrast, Synopeas sensu Förster has T2 longer than T3–T6 combined (Fig. 3E). Synopeas ruficoxum belongs to the group formerly treated as Ectadius, typified by S. craterum (Walker, 1835). We thus refer to the craterum-group for species in which female specimens have T5 longer than wide, T4–T6 not abruptly narrow, and S2 without a conspicuous ventral expansion.

Figures 3.

Figures 3.

A Synopeas idarniforme (Dodd), holotype female, SAMA DB 32–032767, lateral view B Synopeas craterum (Walker) NHWM-HYM#0005311, dorsal view C Synopeas craterum (Walker) NHWM-HYM#0005311, lateral view D Synopeas sp. OSUC 404923 E Synopeas sp., OSUC 334240.

We recognize 34 described species of Synopeas in the craterum-group (Table 3). The majority of these species were described from the tropics; only four are known from the Holarctic region: S. craterum from Europe; S. abdominator (Fouts, 1925) from the southern USA; S. zaitama Yoshida & Hirashima, 1979 from Japan; and S. ruficoxum Buhl, 2006 from Canada. Host associations are unknown for most species worldwide, except for S. craterum, which is associated with Resseliella ribis (Marikovskij, 1956) (Vlug 1995), and for S. zaitama, which is associated with Resseliella odai (Inouye 1955; Yoshida and Hirashima 1979). The present study adds a third host association for this group: S. ruficoxum and R. maxima.

The genus Synopeas is grammatically neuter, from the Greek σύν [syn], with, and ὄπεας [opeas], awl (Foerster 1856). The original epithet of S. ruficoxus is masculine, which is grammatically incorrect. This necessitates a mandatory change to the neuter form S. ruficoxum.

Synopeas craterum (Walker)

Platygaster Craterus Walker, 1835: 224 (original description).

Ectadius craterus (Walker, 1835) – Förster 1856: 113 (generic transfer).

Polymecus craterus (Walker, 1835) – Förster 1856: 144 (unnecessary replacement name); Marshall 1873: 19 (catalogued).

Synopeas Craterus (Walker): Thomson 1859: 71, 72 (generic transfer, description).

Synopeas craterus (Walker): Masner 1965: 141 (type information); Vlug and Graham 1984: 129 (lectotype designation); Vlug 1985: 205 (description of type, keyed); Vlug 1995: 77, 112 (catalogued, host information).

Synopeas craterum (Walker): Awad et al. 2023: 11, fig. 6 (mandatory change).

Synopeas abdominator (Fouts)

Leptacis abdominator Fouts, 1925: 101, 102 (original description).

Synopeas abdominator (Fouts): Masner and Muesebeck 1968: 98 (generic transfer, type information); Vlug 1995: 75 (catalogued).

Synopeas zaitama Yoshida & Hirashima

Synopeas zaitama Yoshida & Hirashima, 1979: 129–131, figs 43–49 (original description); Vlug 1995: 83 (catalogued).

Synopeas ruficoxum Buhl

Figs 4, 5

Figure 4.

Figure 4.

Synopeas ruficoxum (FSCA 00033423) A head, anterior view B head and pronotum, lateral view C habitus, dorsolateral view D habitus, dorsal view.

Figures 5.

Figures 5.

Synopeas ruficoxum, lateral view A holotype, New Brunswick, Canada (NHMD 918361) B Guelph, Ontario, Canada 2017 (BIOUG26568-F09; accession number MG346361) C Nebraska, USA 2021(FSCA 00034119).

Synopeas ruficoxa Buhl, 2006: 203, figs 38–41 (original description).

Synopeas ruficoxum Buhl: von Gries et al. 2025 (mandatory change).

Description.

Females. Body length: 1.7–2.1 mm (n = 10). Body color: black. Color of legs: coxae brown, otherwise yellow to brown. Color of mesoscutellar spine: concolorous with mesoscutellar disc.

Head.

Shape of head in anterior view: round to ovoid (Fig. 4A). Central keel: absent; present only between toruli. Sculpture on frons: reticulate microsculpture. Epitorular sculpture: reticulate microsculpture; minute rugulae. Number of clypeal setae: 4. Length of median pair of clypeal setae: longer than lateral pair. Arrangement of clypeal setae: median pair closer to each other than to lateral setae. Shape of mandible: bidentate. Distance between lateral ocellus and compound eye (OOL): greater than 1 ocellar diameter. OOL: LOL: 1:1; 1:1.2. Lateral ocellar de-pression: present posterolaterally. Hyperoccipital carina: absent or only faintly sug-gested medially. Hyperoccipital carina strength: indicated as sharp angle of vertex between lateral ocelli. Distance between lateral ocellus and hyperoccipital carina: greater than 1 ocellar diameter. Claval formula: 1–1-1–1.

Mesosoma.

Epomial carina: present, complete, or nearly so. Pronotal cervical sulcus: smooth, glabrous. Anterior pronotal pit: present. Ventral pronotal pit: setose. Microsculpture of lateral pronotum: present anterodorsally, absent posteroventrally. Lateral pronotal sculpture coverage: 1/3–1/2. Setation of lateral pronotum: anteroventrally glabrous, otherwise uniformly sparse (Fig. 4B). Mesoscutellar spine: short to moderately developed and pointed. Mesoscutellar spine in lateral view: pointing posteriorly, often with slight downcurve at tip. Origin of mesoscutellar spine: slightly below dorsal apex of mesoscutellum. Posterior margin of propodeal carina in lateral view: rounded. Mesosomal dorsum in lateral view: slightly convex. Scutoscutellar sulcus: shallow, mesoscutum not elevated relative to mesoscutellum. Notauli: percurrent. Parapsidal line: indicated. Setation of mesoscutum: sparse. Mesoscutal lamella: short, truncate. Setation of mesoscutellum: sparse to absent, denser along posterior margin. Setal patch of dorsolateral hind coxa: present, long, extending dorsally to level of felt field.

Metasoma.

Sculpture of T2: faintly sculptured in posterior corners. Length of T2: conspicuously shorter than mesosoma. Sculpture of T3 to T5: reticulate. Sculpture of T6: entirely reticulate. Shape of T6: triangular, 2.5 times as long as wide. Microsculpture of S2: sculptured in posterior 1/3. Shape of S2: slightly expanded ventrally. Sculpture of S3 to S5: reticulate. Shape of S3: trapezoidal, approximately as wide as long. Shape of S4: more than twice as long as wide. Shape of S5: approximately twice as long as wide. Sculpture of S6: entirely reticulate.

Wing.

Length of setae on disc of fore wing: much shorter than distance between setal bases. Density of setae on disc of fore wing: sparse. Arrangement of setae on disc of fore wing: uniformly setose distally, proximally sparser. Fore wing marginal setae: uniformly very short.

Males.

Unknown.

Diagnosis.

Synopeas ruficoxum and S. craterum have distinctly elongate T4 and T5, both at least twice as long as wide (Figs 4C, D), as opposed to S. abdominator and S. zaitama, in which T4 is only slightly longer than wide. In S. ruficoxum, the mesoscutellar spine is well-developed, originating below the dorsal apex of the mesoscutellum, and points posteriorly, often with a downward curve at the tip. This sets it apart from S. craterum, which has a very short spine originating at the dorsal apex of the mesoscutellum, and from S. abdominator, in which the short, straight spine is angled posterodorsally. The posterior half of the lateral pronotum is smooth in S. ruficoxum, whereas it is sculptured in S. zaitama. The sculpture of the ventral metasoma is more extensive in S. ruficoxum than in S. abdominator, which has no sculpture on S6.

Remarks.

The original description compared S. ruficoxum to S. auripes (Ashmead, 1893) and S. ashmeadii Dalla Torre, 1898, neither of which shares its metasomal structure. Such comparisons are of little relevance and demonstrate the importance of examining specimens rather than relying solely on written descriptions. This is particularly relevant for very old descriptions because many authors provided too little detail for accurate diagnosis, and there may even be significant errors in the provided text and illustrations.

The species epithet refers to the color of the coxae, which tend to be much lighter than the rest of the body (Fig. 5A, B). However, in some specimens the coxae are dark brown and the appendages are darker overall (Fig. 5C). Coloration can be altered by specimen age and preservation history, and also exhibits natural variation in many species. Due to this variability, coloration is not a reliable diagnostic character for most Synopeas species.

Material examined.

Synopeas ruficoxum Buhl, holotype female, NHMD 918361, Canada, New Brunswick, Carleton Co, Meduxnekeag River (near Belleville) 46.11354°N, 67.40556°W 10–15.VII.2005 Malaise trap 2 J. Bonet, M. Forshage, R. Hovmöller (ZMUC). Other material: 28 females, USA: Nebraska, FSCA 00033404–00033407 (CNCI); FSCA 00033408–00033411 (USNM); FSCA 00033412–00033419 (UMSP); FSCA 00033420–00033428, 00034119 (FSCA); BOLD Vouchers: BIOUG32277-G12, BIOUG26568-F09. The list of materials examined is also provided in Table 1.

Discussion

Platygastrids have potential as biological control agents, but their implementation is impeded by the challenge of species-level identification and the lack of knowledge on their biology and how to rear them (Awad et al. 2025). The present study integrated morphology, molecular biology, and ecology to describe and provide identification resources for the platygastrid wasp, S. ruficoxum. Furthermore, our integrated approach enabled us to determine that S. ruficoxum is the second-known parasitoid of R. maxima. While parasitism of R. maxima by S. ruficoxum was suggested by its emergence from buckets containing field-collected soybean stems infested with R. maxima, DNA barcoding was critical for providing direct evidence of the host-parasitoid association. This is only the third host association known for the Synopeas craterum-group, all of which parasitize Resseliella species (Yoshida and Hirashima 1979; Vlug 1995). However, to further evaluate the biological control potential of Synopeas species, assessments of (a) host specialization, (b) reproductive strategy, and (c) evolutionary and life history are needed.

Since there are limited known host associations for Synopeas generally, there is a poor understanding of the relative degree of host specialization. Because there are challenges associated with such assessments (i.e., rearing of multiple species of plants, cecidomyiids, and parasitoids) (Awad et al. 2025), host associations might best be explored by implementing molecular methods. However, an exclusively molecular biology approach is limited primarily by the ability to associate COI sequences with taxon names. Combining paired collections of cecidomyiids and parasitoids (e.g. rearing insects from plant material) with a much-needed revision of platygastrid taxa would enhance the utility of this approach. Furthermore, in addition to enabling the identification of host associations, an integrated approach (including molecular biology, ecology, and systematics) would also allow us to determine the parasitoid community of specific cecidomyiid species.

However, confidently identifying all associated parasitoids could still prove difficult, as individual cecidomyiid species have up to 14 parasitoid species associated with them (Hawkins and Gagné 1989). Across Resseliella species (n = 8), a maximum of two associated parasitoids have been recorded (Hawkins and Gagné 1989). Our current understanding of R. maxima is in line with this range, as two species of Synopeas have been confirmed to parasitize R. maxima: S. maximum (Melotto 2023a, b), and now S. ruficoxum. However, parasitism has only been assessed in two out of the seven states with known R. maxima infestations. Notably, S. ruficoxum has been reared from R. maxima only in Nebraska, whereas S. maximum has been collected from both Nebraska and Minnesota. Despite only being reared from Nebraska, other records of S. ruficoxum extend from Ontario to the Atlantic coast of Canada, indicating that S. ruficoxum may attack other species of cecidomyiids, or, that R. maxima may have a geographic range larger than presently documented. Indeed, low-level, asymptomatic infestations of R. maxima can go unnoticed (Bragard et al. 2023).

Not only are there potential differences in host specialization and geography, sex-ratios indicate the two Synopeas species have different reproductive biologies, an important factor that impacts biological control programs (Stouthamer 1993; Heimpel and Mills 2017). Only females parasitize hosts, so a sexual population with males means an appreciable proportion of individuals will not contribute directly to pest suppression (Ode and Hardy 2008). Additionally, in the context of biological control agent releases, males facilitate mating with wild populations and ultimately the potential to dilute desirable traits originally present in the released population (Hopper et al. 1993). This challenge is further intensified by the potential for rapid post-release evolution, which may lead to shifts in agent efficacy or host specificity (Roderick and Navajas 2003). While both male and female S. maximum have been collected, all records of S. ruficoxum are female. The S. maximum adults collected from the field in Wahoo consisted of three females and one male, which is more female-biased than what was observed in Luverne, Minnesota (seven females, nine males) (Melotto et al. 2023a). However, these are small sample sizes that may not necessarily reflect the population-level sex ratio. Regardless, the consistent presence of S. maximum males indicates that this species is sexually reproducing. In contrast, the fact that only female S. ruficoxum have been collected suggests this is a species that reproduces via thelytokous parthenogenesis (i.e., the asexual reproduction of females). We screened S. ruficoxum for Wolbachia, to assess whether the all-female population was potentially due to Wolbachia-mediated parthenogenesis (Fricke and Lindsey 2024b). However, Wolbachia was detected in only 70% of S. ruficoxum, which does not fully support the hypothesis that Wolbachia is inducing parthenogenesis. It is possible Wolbachia prevalence was disrupted by high summer temperatures, as has been seen in other species (Pintureau et al. 2002), or asexual reproduction is simply not mediated by Wolbachia (Fricke and Lindsey 2024a). In either case, determining how the reproductive biologies of S. maximum and S. ruficoxum impact parasitism rates and population dynamics requires further research.

Thelytoky also has taxonomic implications (Enghoff 1976; Stouthamer et al. 1990). The closest relative of a parthenogenetic species may be one that reproduces sexually, making it crucial that female-to-female comparisons are made when constructing diagnostic tools. Furthermore, some parasitoids are known to be geographically parthenogenetic (Brues 1928). This phenomenon is not yet known in Platygastridae, but it also has yet to be explored. Some Nearctic Synopeas species were described solely on male specimens, precluding the use of important features of the female antenna and metasoma for identification. Thus, species names from male-only descriptions can be a taxonomic hindrance and, in some cases, may be treated as nomina dubia. As described here, the craterum-group of Synopeas is defined by metasomal characters found only in female specimens. The reliability of metasomal shape for subgeneric classification, either as formal subgenera or informal species groups, has yet to be evaluated in a phylogenetic context. Such an endeavor requires a much larger taxon sampling than provided here and multiple loci, but likely will be very useful for parsing Synopeas into smaller groups that are monophyletic and more manageable from an identification standpoint.

Independent of their use for classification, modifications to the metasoma in Synopeas offer the opportunity to explore functional morphology. Presumably, the shapes of the metasoma and ovipositor reflect parasitoid oviposition strategy, with metasomal elongation providing extended reach of the ovipositor. The two parasitoids of R. maxima may have specialized on different developmental stages of the host. For example, S. maximum, with a short metasoma (Melotto et al. 2023a), could attack hosts earlier in development and closer to the surface of the plant tissues, whereas S. ruficoxum, with a long metasoma, may target hosts at a later stage of development, when the larvae have burrowed deeper into the plant tissue (Gagné et al. 2019). The distance between S. maximum and S. ruficoxum in the phylogenetic analysis (Fig. 2) suggests that host shifts within Synopeas may be determined by ecological and physical factors more than phylogenetic affinity. However, further observational studies are needed from a greater representation of parasitoids and hosts.

Conclusions

In summary, this work identified S. ruficoxum as the second parasitoid of R. maxima, which provides a host-parasitoid system in which we can explore interesting ecological questions. One key question is whether the two Synopeas parasitoids differ in phenology, such as generation cycles or population density, and how this may influence their effectiveness in controlling R. maxima. Additionally, determining spatial variation in the abundance of the two Synopeas parasitoids and R. maxima could inform our understanding of shifts in host parasitoid communities across geographic regions. Finally, investigating interactions between S. ruficoxum and S. maximum, including niche partitioning and multiparasitism, could reveal how they coexist and jointly impact host populations.

Acknowledgements

We thank Matheus Pires de Mello Ribeiro and Elliot Knoell for collecting field samples and rearing specimens, Lars Vilhelmsen (NHMD) and Ryoji Kawai (Kyushu University) for providing access to type material and specimen photographs, and Pheylan Anderson for compiling counties with known R. maxima infestations into arcGIS-friendly shapefiles. This work was supported by a grant secured by R.L.K., A.R.I.L., A.J.M., and Erin Hodgson (Iowa State University) from Sustainable Agriculture Research and Education (SARE). Jessica Awad was supported by the Bundesministerium für Bildung und Forschung, Berlin, Germany, project “German Barcode of Life III: Dark Taxa” (FKZ 16LI1901C). Elijah Talamas was supported by the Florida Department of Agriculture and Consumer Services, Division of Plant Industry. ARIL was supported by the National Institute of General Medical Sciences (NIGMS) of the National Institutes of Health (NIH) under award number R35GM150991.

References

  1. Abram PK, Haye T, Mason PG, Cappuccino N, Boivin G, Kuhlmann U (2012) Biology of Synopeas myles, a parasitoid of the swede midge, Contarinia nasturtii, in Europe. BioControl 57: 789–800. 10.1007/s10526-012-9459-x [DOI] [Google Scholar]
  2. Ashmead W (1893) Monograph of the North American Proctotrypidae. Bulletin of the United States National Museum 45: 1–472. 10.5479/si.03629236.45.1 [DOI] [Google Scholar]
  3. Ashmead W (1894) Report on the parasitic Cynipidae, part of the Braconidae, the Ichneumonidae, the Proctotrypidae, and part of the Chalcidinae. Part III. Zoological Journal of the Linnean Society of London 25: 188–254. [Google Scholar]
  4. Ashmead W (1895) Report on the parasitic Hymenoptera of the island of Grenada, comprising the families Cynipidae, Ichneumonidae, Braconidae, and Proctotrypidae. Proceedings of the Zoological Society of London 1895: 742–812. [Google Scholar]
  5. Astrin JJ, Höfer H, Spelda J, Holstein J, Bayer S, Hendrich L, Huber BA, Kielhorn KH, Krammer HJ, Lemke M, Monje JC, Morinière J, Rulik B, Petersen M, Janssen H, Muster C (2016) Towards a DNA Barcode Reference Database for Spiders and Harvestmen of Germany. PLoS ONE 11(9): e0162624. 10.1371/journal.pone.0162624 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Austin AD (1984) New species of Platygastridae (Hymenoptera) from India which parasitise pests of mango, particularly Procontarinia spp. (Diptera: Cecidomyiidae). Bulletin of Entomological Research 74(4): 549–557. 10.1017/S0007485300013924 [DOI] [Google Scholar]
  7. Awad J, Bremer JS, Butterill PT, Moore MR, Talamas EJ (2021) A taxonomic treatment of Synopeas Förster (Platygastridae, Platygastrinae) from the island of New Guinea. Journal of Hymenoptera Research 87: 5–65. 10.3897/jhr.87.65563 [DOI] [Google Scholar]
  8. Awad J, Krogmann L, Talamas E (2023) Taxonomic history and review of the Förster genera of Platygastridae (Hymenoptera: Platygastroidea). European Journal of Taxonomy 875: 1–46. 10.5852/ejt.2023.875.2137 [DOI] [Google Scholar]
  9. Awad J, Reinisch R, Moser M, Vasilița C, Krogmann L (2025) Untangling host specialization in a “double dark taxa” system. Annals of the Entomological Society of America 118(3): 206–219. 10.1093/aesa/saaf003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bragard C, Baptista P, Chatzivassiliou E, Di Serio F, Gonthier P, Miret JAJ, Justesen AF, Magnusson CS, Milonas P, Navas-Cortes JA, Parnell S, Potting R, Reignault PL, Stefani E, Thulke H-H, Van der Werf W, Civera AV, Yuen J, Zappalà L, Grégoire J-C, Malumphy C, Kertesz V, Maiorano A, MacLeod A (2023) Pest categorisation of Resseliella maxima, EFSA Journal 21: e07769. 10.2903/j.efsa.2023.7769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Brues CT (1928) A note on the genus Pelecinus. Psyche 35: 205–209. 10.1155/1928/47573 [DOI] [Google Scholar]
  12. Buhl P (1997) On some new or little known species of Platygastrinae (Hymenoptera, Platygastridae). Entomofauna 18: 429–467. [Google Scholar]
  13. Buhl P (2001) Taxonomical notes on Platygastridae (Hymenoptera, Platygastroidea). Entomofauna, Zeitschrift für Entomologie 22: 17–40. [Google Scholar]
  14. Buhl P (2002) Contributions to the platygastrid fauna of Panama (Hymenoptera, Platygastridae). Entomofauna, Zeitschrift für Entomologie 23: 309–330. [Google Scholar]
  15. Buhl P (2003) New or little known platygastrids (Hymenoptera: Platygastridae). Phegea 31: 183–192. [Google Scholar]
  16. Buhl P (2004a) New African Platygastrinae (Hymenoptera: Platygastridae). Folia Entomologica Hungarica 65: 65–83. [Google Scholar]
  17. Buhl P (2004b) New Neotropical species of Platygastrinae (Hymenoptera, Platygastridae). Entomofauna, Zeitschrift für Entomologie 25: 221–236. [Google Scholar]
  18. Buhl P (2006) New species of Platygastrinae from Canada (Hymenoptera, Platygastridae). Entomofauna, Zeitschrift für Entomologie 27: 193–205. [Google Scholar]
  19. Buhl P (2008) New and little known Platygastridae from Indonesia and Malaysia (Hymenoptera: Platygastroidea). Zoologische Mededelingen 82: 515–579. [Google Scholar]
  20. Buhl P (2009) Taxonomical studies on Oriental Platygastridae (Hymenoptera: Platygastroidea). Journal of Asia-Pacific Entomology 12: 123–132. 10.1016/j.aspen.2009.02.001 [DOI] [Google Scholar]
  21. Buhl P (2010) Platygastridae from the Udzungwa Mountains, Tanzania (Hymenoptera, Platygastroidea). Journal of Afrotropical Zoology 6: 29–46. [Google Scholar]
  22. Buhl P (2011) New Neotropical species of Platygastrinae and Sceliotrachelinae (Hymenoptera: Platygastridae), with keys to species of the larger genera, some redescriptions and a checklist. Folia Heyrovskyana 19: 25–128. [Google Scholar]
  23. Buhl P (2015a) Further new or little known Neotropical species of Platygastrinae (Hymenoptera: Platygastridae). International Journal of Environmental Studies 72: 316–330. 10.1080/00207233.2014.994275 [DOI] [Google Scholar]
  24. Buhl P (2015b) New species of Platygastrinae from the Afrotropical region (Hymenoptera, Platygastridae). Entomofauna, Zeitschrift für Entomologie 36: 313–332. [Google Scholar]
  25. Buhl PN, O’Connor JP, Ashe P (2009) New species of Platygastridae (Hym., Platygastroidea) from Sulawesi. Entomologists Monthly Magazine 145: 87–96. [Google Scholar]
  26. Chen H, Lahey Z, Talamas EJ, Valerio AA, Popovici OA, Musetti L, Klompen H, Polaszek A, Masner L, Austin AD, Johnson NF (2021) An integrated phylogenetic reassessment of the parasitoid superfamily Platygastroidea (Hymenoptera: Proctotrupomorpha) results in a revised familial classification. Systematic Entomology 46: 1088–1113. 10.1111/syen.12511 [DOI] [Google Scholar]
  27. Crawford JC, Bradley JC (1911) A new Pelecinus-like genus and species of Platygastridae. Proceedings of the Entomological Society of Washington 13: 124–125. [Google Scholar]
  28. Dalla Torre CW (1898) Catalogus Hymenoptorum Hucusque Descriptorum Systematicus et Synonymicus. Volumen V: Chalcididae et Proctotrupidae. G. Engelmann, Leipzig. [Google Scholar]
  29. Enghoff H (1976) Taxonomic problems in parthenogenetic animals. Zoologica Scripta 5(1–4): 103–104. 10.1111/j.1463-6409.1976.tb00686.x [DOI] [Google Scholar]
  30. Folmer O, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. [PubMed] [Google Scholar]
  31. Förster A (1856) Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen. [Google Scholar]
  32. Fouts RM (1925) New serphoid parasites from the United States (Hymenoptera). Proceedings of the Entomological Society of Washington 27(5): 93–103. [Google Scholar]
  33. Fricke LC, I Lindsey AR (2024) Examining Wolbachia-Induced Parthenogenesis in Hymenoptera. In: Fallon AM (Ed.) Wolbachia Methods and Protocols, 55–68. Humana Press. 10.1007/978-1-0716-3553-7_4 [DOI] [Google Scholar]
  34. Fricke LC, I Lindsey AR (2024b) Identification of parthenogenesis-inducing effector proteins in Wolbachia. Genome Biology and Evolution 16(4): evae036. 10.1093/gbe/evae036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Gagné RJ, Yukawa J, Elsayed AK, McMechan AJ (2019) A new pest species of Resseliella (Diptera: Cecidomyiidae) on Soybean (Fabaceae) in North America, with a description of the genus. Proceedings of the Entomological Society of Washington 121(2): 168–177. 10.4289/0013-8797.121.2.168 [DOI] [Google Scholar]
  36. Hawkins BA, Gagné RJ (1989) Determinants of assemblage size for the parasitoids of Cecidomyiidae (Diptera). Oecologia 81(1): 75–88. 10.1007/BF00377013 [DOI] [PubMed] [Google Scholar]
  37. Heimpel GE, Mills NJ (2017) Biological Control: Ecology and Applications. Cambridge University Press. 10.1017/9781139029117 [DOI] [Google Scholar]
  38. Helton ML, Tinsley NA, McMechan AJ, Hodgson EW (2022) Developing an injury severity to yield loss relationship for soybean gall midge (Diptera: Cecidomyiidae). Journal of Economic Entomology 115(3): 767–772. 10.1093/jee/toac038 [DOI] [PubMed] [Google Scholar]
  39. Hopper KR, Roush RT, Powell W (1993) Management of genetics of biological-control introductions. Annual Review of Entomology 38(1): 27–51. 10.1146/annurev.en.38.010193.000331 [DOI] [Google Scholar]
  40. Huang J, Miao X, Wang Q, Menzel F, Tang P, Yang D, Wu H, Vogler AP (2022) Metabarcoding reveals massive species diversity of Diptera in a subtropical ecosystem. Ecology and Evolution 12: e8535. 10.1002/ece3.8535 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Inouye H (1955) Cryptomeria bark gall midge (Thomasiniana odai n. sp.). Forest Pest News 4: 159–163. [Google Scholar]
  42. Katoh K, Standley DM (2013) MAFFT Multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Kim I-K, Park J-D, Shin S-C, Park I-K (2011) Prolonged embryonic stage and synchronized life-history of Platygaster robiniae (Hymenoptera: Platygastridae), a parasitoid of Obolodiplosis robiniae (Diptera: Cecidomyiidae). Biological Control 57(1): 24–30. 10.1016/j.biocontrol.2010.12.007 [DOI] [Google Scholar]
  44. Mani MS (1975) On a collection of Scelionidae and Platygastridae (Hymenoptera: Proctotrypoidea) from India. Memoirs of the School of Entomology, St. John’s College 4: 63–80. [Google Scholar]
  45. Marikovskij PI 1956. [New gall midges (Diptera, Itonididae) of the USSR.] Entomologicheskoe Obozrenie 35: 184–195. [Google Scholar]
  46. Masner L (1965) The types of Proctotrupoidea (Hymenoptera) in the British Museum (Natural History) and in the Hope Department of Entomology, Oxford. Bulletin of the British Museum of Natural History, Entomology Supplement 1: 3–154. 10.5962/p.97756 [DOI] [Google Scholar]
  47. Masner L, Muesebeck C (1968) The types of Proctotrupoidea (Hymenoptera) in the United States National Museum. Bulletin of the United States National Museum 270: 1–143. 10.5479/si.03629236.270 [DOI] [Google Scholar]
  48. McMechan AJ, Hodgson EW, Varenhorst AJ, Hunt T, Wright R, Potter B (2021) Soybean gall midge (Diptera: Cecidomyiidae), a new species causing injury to soybean in the United States. Journal of Integrated Pest Management 12(1): 8. 10.1093/jipm/pmab001 [DOI] [Google Scholar]
  49. McMechan AJ, Schroeder de Souza J, Umezu N, Gupta P, Carmona GI (2023) Hilling as a cultural control strategy for soybean gall midge (Diptera: Cecidomyiidae). Journal of Economic Entomology 116: 2009–2013. 10.1093/jee/toad195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Melotto G, Awad J, Talamas EJ, Koch RL, Lindsey ARI (2023a) Synopeas maximum Awad & Talamas (Hymenoptera, Platygastridae): A new species of parasitoid associated with soybean gall midge, Resseliella maxima Gagné (Diptera, Cecidomyiidae). Journal of Hymenoptera Research 96: 181–205. 10.3897/jhr.96.102865 [DOI] [Google Scholar]
  51. Melotto G, Potter BD, Koch RL, Lindsey ARI (2023b) Spatial and temporal dynamics of soybean gall midge (Resseliella maxima) parasitism by Synopeas maximum. Pest Management Science 79(12): 5096–5105. 10.1002/ps.7711 [DOI] [PubMed] [Google Scholar]
  52. Melotto G, Jones MW, Bosely K, Flack N, Frank LE, Jacobson E, Kipp EJ, Nelson S, Ramirez M, Walls CW, Koch RL, Lindsey ARI, Faulk C (2023c) The genome of the soybean gall midge (Resseliella maxima). G3 Genes|Genomes|Genetics 13(4): jkad046. 10.1093/g3journal/jkad046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Mukerjee MK (1978) Descriptions of some new species and records of known Platygastridae (Hymenoptera, Proctotrupoidea) from India. Memoirs of the School of Entomology, St. John’s College 5: 67–97. [Google Scholar]
  54. Mukerjee MK (1981) On a collection of Scelionidae and Platygastridae (Hymenoptera: Proctotrupoidea) from India. Records of the Zoological Survey of India Miscellaneous Publication Occasional Paper 2: 1–78. [Google Scholar]
  55. Ode PJ, Hardy IC W (2008) Parasitoid sex ratios and biological control. In: Behavioral ecology of insect parasitoids (253–291). Blackwell Publishing. 10.1002/9780470696200.ch12 [DOI] [Google Scholar]
  56. Pintureau B, Lassablière F, Daumal J, Grenier S (2002) Does a cyclic natural thermal cure occur in Wolbachia-infected Trichogramma species? Ecological Entomology 27(3): 366–372. 10.1046/j.1365-2311.2002.00416.x [DOI] [Google Scholar]
  57. Potter B, Koch RL, Melotto G, Lisak SC (2022) [October 31] Soybean gall midge – Not just for soybeans anymore. University of Minnesota Extension. Minnesota Crop News. https://blog-crop-news.extension.umn.edu/2022/10/soybean-gall-midge-not-just-for.html [Google Scholar]
  58. Risbec J (1958) Contributions à la connaissance de Hyménoptères Chalcidoïdes et Proctotrupoïdes de l’Afrique Noire. IV. Prototrupoïdes du Congo Belge. Annales du Musée Royal du Congo Belge Tervuren (Belgique), Serie in-8°, Sciences Zoologiques 64: 106–138. [Google Scholar]
  59. Roderick GK, Navajas M (2003) Genes in new environments: genetics and evolution in biological control. Nature Reviews Genetics 4(11): 889–899. 10.1038/nrg1201 [DOI] [Google Scholar]
  60. Soybean Gall Midge Alert Network: Emergence, Scouting and Management. soybeangallmidge.org
  61. Srivathsan A, Ang Y, Heraty JM, Hwang WS, Jusoh WFA, Kutty SN, Puniamoorthy J, Yeo D, Roslin T, Meier R (2022) Global convergence of dominance and neglect in flying insect diversity (p. 2022.08.02.502512). bioRxiv. 10.1101/2022.08.02.502512 [DOI] [Google Scholar]
  62. Stouthamer R, Pinto JD, Platner GR, Luck RF (1990) Taxonomic status of thelytokous forms of Trichogramma (Hymenoptera: Trichogrammatidae). Annals of the Entomological Society of America 83.3 : 475–481. 10.1093/aesa/83.3.475 [DOI] [Google Scholar]
  63. Stouthamer R (1993) The use of sexual versus asexual wasps in biological control. Entomophaga 38: 3–6. 10.1007/BF02373133 [DOI] [Google Scholar]
  64. Thomson C (1859) Sveriges Proctotruper. Tribus VII. Platygastrini. Öfversigt af Kongliga Ventenskaps-Akademiens Förhandlingar 16: 69–87. [Google Scholar]
  65. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, Warman ML (2000) Preparation of PCR-Quality Mouse Genomic DNA with Hot Sodium Hydroxide and Tris (HotSHOT). BioTechniques 29(1): 52–54. 10.2144/00291bm09 [DOI] [PubMed] [Google Scholar]
  66. Vlug H (1985) The types of Platygastridae (Hymenoptera, Scelionidae) described by Haliday and Walker and preserved in the National Museum of Ireland and the British Museum (Natural History). 2. Keys to species, redescriptions, synonymy. Tijdschrift voor Entomologie 127: 179–224. [Google Scholar]
  67. Vlug H (1995) Catalogue of the Platygastridae (Platygastroidea) of the world (Insecta: Hymenoptera). Hymenopterorum Catalogus 19: 1–168. [Google Scholar]
  68. Vlug H, Graham M (1984) The types of Platygastridae (Hymenoptera, Scelionidae) described by Haliday and Walker and preserved in the National Museum of Ireland and the British Museum (Natural History). Designation of lectotypes. Tijdschrift voor Entomologie 127: 115–135. [Google Scholar]
  69. Walker F (1835) On the species of Platygaster, &c. The Entomological Magazine 3: 217–274. [Google Scholar]
  70. Werren JH, Baldo L, Clark ME (2008) Wolbachia: Master manipulators of invertebrate biology. Nature Reviews Microbiology 6(10): 741–751. 10.1038/nrmicro1969 [DOI] [PubMed] [Google Scholar]
  71. Werren JH, Windsor DM (2000) Wolbachia infection frequencies in insects: Evidence of a global equilibrium? Proceedings of the Royal Society B: Biological Sciences 267(1450):1277–1285. [Google Scholar]
  72. Yoshida N, Hirashima Y (1979) Systematic studies on proctotrupoid and chalcidoid parasites of gall midges injurious to Pinus and Cryptomeria in Japan and Korea (Hymenoptera). Esakia 14: 113–133. [Google Scholar]

RESOURCES