Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jun 12.
Published in final edited form as: Dev Biol. 2026 Jun 8;537:62–70. doi: 10.1016/j.ydbio.2026.06.001

Placode-derived orphan chemokine CXCL14 is critical for proper chick trigeminal ganglion formation

Hugo A Urrutia 1,*, Junpeng Gao 1,*, Marianne E Bronner 1,**
PMCID: PMC13256242  NIHMSID: NIHMS2183245  PMID: 42264339

Abstract

The trigeminal ganglion, the largest of cranial sensory ganglia, has a dual origin from neural crest and ectodermal placode cells, which interact extensively during ganglion formation. In the developing chick embryo, we find that the orphan chemokine Cxcl14 is expressed in placode-derived cells at a time corresponding to when placode and neural crest cells, expressing the chemokine receptor Cxcr4, begin to condense into the trigeminal ganglion. In contrast, Cxcl12, the proposed canonical receptor for Cxcr4, is expressed in the frontonasal process and branchial arches, regions distant from the forming ganglion primordium. Importantly, CRISPR-Cas9 mediated knockout of Cxcl14 disrupted trigeminal ganglion formation, resulting in loss of the maxillomandibular lobe and reduction in the ophthalmic lobe as well as defective axonal projections. Taken together, these data reveal a new in vivo role for Cxcl14 during development and suggest a ligand-receptor interaction between CXCR4 and CXCL14, rather than CXCL12, during trigeminal ganglion development.

Keywords: Neural crest, placode, chemokine, trigeminal ganglion, neurogenesis, receptor

Introduction

In vertebrates, the trigeminal ganglion is the largest of all cranial sensory ganglia and has a dual origin from two embryonic cell populations, cranial neural crest and ectodermal placodal cells (D’Amico-Martel and Noden, 1983). The formation of ganglion involves several discrete steps mediated by interactions between these two embryonic cell types. First, migratory cranial neural crest cells interact with ingressing placode cells via Robo-Slit signaling (Shiau et al., 2008; Shiau and Bronner-Fraser, 2009). Subsequently, the cells condense lateral to the developing neural tube into discrete cell aggregates, a process involving several cell-cell and cell-matrix interactions (Halmi et al., 2024, 2022; Shah and Taneyhill, 2015; Wu and Taneyhill, 2019).

Chemokine signaling is another receptor-ligand interaction that has been implicated in cranial neural crest and placode interactions. Chemokines are small, secreted ligands known for their roles in regulating cell migration in immune response, cancer and embryogenesis (Kasemeier-Kulesa et al., 2010; Kucia et al., 2004; Olesnicky Killian et al., 2009). In the developing vertebrate head and neck, the directional migration of both cranial and cardiac neural crest is influenced by the chemokine ligand Cxcl12, also known as Stromal cell derived factor (Sdf1), which is expressed in the branchial arches (Escot et al., 2013; Olesnicky Killian et al., 2009). The receptor Cxcr4 is expressed in the neural folds as well as in migrating neural crest cells. In Xenopus, cranial neural crest cells, expressing Cxcr4, are attracted toward the cranial placode cells that express the ligand, Cxcl12. The interaction between Cxcr4 and Cxcl12 activates Rac1 signaling in neural crest cells, promoting actin polymerization and directing their migration toward Cxcl12-positive placodal cells. Upon contact, neural crest cells are repelled through a process known as contact inhibition of locomotion (CIL). This physical interaction induces the formation of transient N-cadherin–dependent adhesions, which inhibit focal adhesions in placodal cells, leading to protrusion collapse and generating a coordinated migratory behavior between neural crest and placode cells termed “chase and run” (Theveneau et al., 2010, 2013). In zebrafish, Cxcr4-Cxcl12 interactions have also been implicated in cranial crest migration as well as proper positioning of the trigeminal ganglion (Knaut et al., 2003; Olesnicky Killian et al., 2009).

Initially, Cxcl12 and Cxcr4 were thought to form an exclusive ligand-receptor pair, but subsequent work revealed that Cxcl12 can also bind to the receptor Cxcr7 (Balabanian et al., 2005; Bleul et al., 1996; Boldajipour et al., 2008; Chen et al., 2015; Halasy et al., 2023; Levoye et al., 2009; Memi et al., 2013). While Cxcl12 appears critical for cranial neural crest migration in anamniotes, in chick its expression is restricted to the ectoderm of the branchial arches, regions quite distant from the site of trigeminal ganglion formation. This raises the intriguing possibility that, in addition to Cxcl12, other factors, including unidentified chemokines, may also contribute to trigeminal ganglion formation. Accordingly, here we explore the potential role of the orphan ligand, Cxcl14.

In contrast to extensive literature on Cxcl12, little is known about the expression or function of Cxcl14 during embryonic development. Cxcl14 is a novel orphan chemokine with known roles in immune cell migration and anti-microbial effects (Dai et al., 2015; Lu et al., 2016; Westrich et al., 2020). Its expression has been noted in several epithelial tissue and its loss correlates with malignancy (Giacobbi et al., 2024; Gordon et al., 2011; Sjöberg et al., 2016; Westrich et al., 2020, 2019). Although Cxcl14 has been suggested to interact with Cxcr4, Cxcr7, Lrp1, or Cxcl12, supporting evidence remains contradictory (Atanes et al., 2019; Collins et al., 2017; Miyajima et al., 2024; Sand et al., 2015). Cxcl14 is proposed to signal via the MAPK/Erk1/2 pathway (Waldemer-Streyer et al., 2017), potentially influencing cell cycle progression and epithelial-to-mesenchymal transition (EMT).

Here we explore the role of Cxcl14 in the forming trigeminal ganglion of the chick embryo. We noted that Cxcl14 expression begins at the onset of ganglion aggregation, as neural crest and placode cells are extensively interacting. Intriguingly, Cxcl14 expression was largely restricted to ectodermal cells including the placodal precursors and migrating placode cells. In contrast, Cxcr4 was exclusively expressed by neural crest cells, whereas the proposed ligand of Cxcr4, Cxcl12, was expressed in the branchial arches, some distance away from the forming ganglion primordium. Importantly, loss of Cxcl14 disrupted ganglion formation, leading to abnormal gangliogenesis and defective axonal projections. Taken together, we propose that Cxcl14, produced by placodal cells, is required for proper trigeminal ganglion formation likely mediated by interactions with migratory cranial neural crest that express the chemokine receptor Cxcr4.

Materials and Methods

Chicken embryos

Fertilized chicken embryos (Gallus gallus) were obtained from local commercial sources (Petaluma Egg Farm, Petaluma, CA) and incubated at 37°C in humidified incubators to the desired stages. Embryos were staged by Hamburger-Hamilton (HH) (Hamburger and Hamilton, 1951) staging method as indicated.

Construct design and cloning

DNA constructs were produced by PCR reactions using AccuPrime high-fidelity DNA Taq polymerase (ThermoFisher) or KOD One PCR Master Mix (TOYOBO) followed by standard purification (Qiagen), restriction enzyme digestion, and ligation with either T4 DNA ligase or HiFi DNA assembly (NEB). The pCI-memb-eGFP construct was generated by replacing the eGFP sequence in pCIG with a membrane-bound eGFP containing a N-terminally fused 2X membrane targeting sequence (myristoylation signal). The ectodermal reporter construct was generated by amplifying the full-length lunatic fringe (LFNG) enhancer from a previous construct and inserting it into the pTK backbone, upstream of membrane-bound eGFP. All constructs produced in this study were later verified by Sanger sequencing (Laragen) and full plasmid sequencing (Primordium) prior to usage. Constructs for all experiments were used at a final concentration of 2.5 μg/μl, diluted in EB buffer.

CRISPR/Cas9-mediated perturbations

Guide RNA (gRNA) targets for Cxcl14 were generated and obtained using the CHOPCHOP tool (Labun et al., 2019, 2021). One gRNA targeting the coding sequence of Cxcl14 (AGGTACCCATTTTGTGTGGA) and one control gRNA (GCACTGCTACGATCGTCTCA) were generated and cloned into a modified version of our previously published single plasmid CRISPR/Cas9 system (Gandhi et al., 2021). To increase electroporation efficiency, the Cas9 protein and gRNA cassettes were expressed on separate plasmids, each linked to a portion of super-folder GFP (Kamiyama et al., 2016) that generate GFP signal when co-expressed. The final vectors were verified by Sanger sequencing (Laragen) prior to usage. All CRISPR/Cas9 construct used for the experiments were used at final concentration of 2.5 μg/μl, diluted in EB buffer. To enable visualization of the injection solution, 2 μl of 2% red/blue food dye was added per 10 μl injection mix.

Morpholino-mediate perturbation

All translation-blocking morpholino oligomer (MO) were synthesized by Gene Tools, LLC. Standard control oligomer (CCTCTTACCTCAGTTACAATTTATA, control MO) and two MOs targeting the 5’UTR and signal peptide sequence of Cxcl14 (TCTGTCTTGTGTTCCCGTCCTCGAG and CAAGGCTGCTGTCAGGAGCTTCATG, Cxcl14 MOs) were diluted with nuclease free water and used at a final dose of 1.0 mM. Injection mixes were made containing pCI-memb-eGFP at final concentration of 2.5 μg/μl, control or Cxcl14 MOs at 1.0 mM each, and 2 μl of 2% red/blue food dye per 10 μl injection mix, diluted in EB buffer. The DNA solutions were electroporated onto one side of the embryo with the other side as an internal control.

To verify efficient knock-down with Cxcl14 MOs, a Cxcl14 UTR reporter construct was created by replacing the start codon of eGFP with the 5’UTR and signal peptide sequence of Cxcl14, and inserting the fragment into a pCAG backbone. Injection mixes were made containing the Cxcl14 UTR reporter construct at final concentration of 2.5 μg/μl, control or two Cxcl14 MOs at 1.0 mM each, and 2 μl of 2% red/blue food dye per 10 μl injection mix, diluted in EB buffer. The DNA solutions were electroporated bilaterally onto the embryo with the left side containing the control MO and right side containing Cxcl14 MOs.

Electroporations

For ex ovo experiments, embryos were incubated 19–20 h to obtain stage HH4, whereas for in ovo experiments, embryos were incubated 33 h to obtain stages HH11. Ex ovo electroporations were performed as previously described (Sauka-Spengler and Barembaum, 2008) by passing five 5.8 V pulses for 50 ms at 100 ms intervals. Embryos were then cultured in 1 ml albumin supplemented with 1% penicillin/streptomycin (PenStrep) at 37.5°C. The following day, embryos were screened for transfection efficiency (high fluorescence intensity), and unhealthy and/or poorly transfected embryos were discarded. For in ovo experiments, all constructs were introduced at stages HH11 Platinum electrodes were placed vertically across the chick embryo delivering five 5.8 V pulses for 50 ms at 100 ms intervals as previously described (Shiau et al., 2008). Incubation was then continued for ~28–36 h to reach stages HH15–16.

Hybridization chain reaction

Hybridization chain reaction (HCR) v3 was performed with Cxcl14 probes (B9 initiator) and Cxcr4 probes (B5 initiator) designed and synthesized by Molecular Technologies, and the Cxcl12 probes (B2 initiator) designed using Easy HCR (Kuehn et al., 2021; Elagoz et al., 2022), an open HCR probe designer program, and synthesized as pooled oligos by Integrated DNA Technologies (IDT). We followed published protocols by Molecular Technologies (Choi et al., 2018) with minor modifications. Briefly, embryos were fixed in 4% PFA overnight at 4°C, washed in PBS with 0.1% Tween-20 (PBSTw), dehydrated, and stored in 100% methanol overnight at −20°C. The following day, embryos were rehydrated and treated with proteinase-K for 2 min, and incubated with 12 pmol of HCR probes dissolved in 500 uL hybridization buffer overnight at 37°C. The subsequent day, following several washes in probe wash buffer and 0.1% 5x–SSC–Tween, embryos were incubated in 30 pmol of HCR amplifiers labeled with Alexa Fluor 488-, 568-, or 647 diluted in 500 uL amplification buffer at room temperature overnight. The following day, embryos were washed in 0.1% 5x–SSC–Tween and imaged. Embryos were imaged on Zeiss confocal LSM900 either directly in wholemount, or as slices after cryosectioning.

Colorimetric in situ hybridization

Colorimetric in situ hybridization against Cxcl14 was performed following described protocol (Ojeda, 2013).

Immunohistochemistry

Embryos were fixed in 4% PFA in sodium phosphate buffer for 20 min to 1 h at room temperature, washed in TBS (0.5 M Tris-HCl, 1.5 M NaCl, 10 mM CaCl2) with 0.5% Triton X-100 (TBSTr), blocked in 10% donkey serum in TBSTr for 2 h at room temperature, and incubated in primary antibody solution at 4°C for two nights. On the third day, embryos were washed in TBSTr and incubated in secondary antibody solution for two nights at 4°C. Following the secondary antibody incubation, embryos were washed in TBSTr and processed for imaging and then for cryosectioning. The following primary antibodies and concentrations were used: Goat anti-GFP (1:500; Rockland, Cat# 600-101-215); Rabbit anit-Sox10 (1:500, Sigma-Aldrich, Cat# HPA068898); Mouse anti-TuJ1 (1:100, Biolegend, Cat# 801201). Primary antibodies were detected by Alexa Fluor 488-, 568-, or 647-conjugated donkey secondary antibodies (1:500; Molecular Probes).

Cryosectioning

After staining via HCR or immunohistochemistry, embryos were serially incubated in 5%, 15%, and 30% sucrose in PBS at 4°C overnight. Embryos were subsequently incubated in 7.5% gelatin for 4–16 h at 39°C, then flash-frozen in liquid nitrogen and stored at −80°C. Embedded embryos were sectioned at −30 °C on cryostat (Epredia, HM525 NX) with a thickness of 12 μm. Transverse frozen sections were taken and allowed to dry overnight at room temperature. Gelatin was removed by incubating slides in PBS at 42°C for 10 min, washed in PBS and ddH2O, and coverslips were mounted with Fluoromount-G (SouthernBiotech).

Microscopy

Whole-mount and transverse section images were acquired at room temperature using a Zeiss Imager.M2 with an ApoTome.2 module, Axiocam 506 color and monochromatic cameras, and Zen 2 Blue software (ZEISS). Transverse section imaging was also performed using a Zeiss LSM 900 with an inverted microscope. Whole-mount images were acquired as wide-field views or displayed as a maximum intensity projection of Z-stacks, with an EC Plan-Neofluar 5 × objective/0.16 NA (ZEISS). Transverse sections were acquired as a single optical plane or maximum intensity projections of Z-stacks, using a Plan Apochromat 40 × objective/1.3 NA (ZEISS), and were imaged in Fluoromount-G (SouthernBiotech). Images were pseudocolored and minimally processed for brightness and contrast using Fiji (Schindelin et al., 2012). Image analysis and display preparation were performed using Fiji (Schindelin et al., 2012).

Image and statistical analysis

Images were analyzed and prepared for displaying using Fiji (Schindelin et al., 2012). We developed a custom FIJI macro to quantify the area and dispersion of the OpV and MmV lobes of the trigeminal ganglion on both the electroporated and unelectroporated side for each embryo. In detail, the maximum intensity projection image for each trigeminal ganglion were first pre-processed to remove speckles, using the Remove Outlier function in FIJI with radius=5 and threshold=10. The approximate boundary of the OpV and MmV lobes were manually selected, and the exact outlines of each lobe were obtained by automatic thresholding with the IsoData method. The area of each lobes were calculated using the FIJI measurement function, whereas dispersion was quantified, via a custom macro, as the standard deviation of the distances between the centroid and each pixel within the outlined lobe. Quantified data were processed and visualized through jupyter notebook scripts. Statistical significance was determined by a two-tailed paired t-test using built-in SciPy function.

Results

Cxcl14 is expressed by trigeminal placode cells as they ingress and intermingle with cranial neural crest cells that express Cxcr4

To better understand potential receptor-ligand interactions during cranial neural crest migration and the onset of trigeminal ganglion formation in the chick embryo, we examined the expression patterns of receptors Cxcr4 and Cxcr7 relative to chemokines Cxcl12 and Cxcl14 using in situ Hybridization Chain Reaction (HCR) (Choi et al., 2018). Cranial neural crest cells undergo EMT to delaminate from the neural tube at Hamburger-Hamilton stage (HH) 9, subsequently emigrating from the neural tube. At HH9, Cxcr4 expression is evident in pre-migratory neural crest cells and persists in migratory cranial neural crest cells through HH10-HH13 (Fig. 1A–C).

Fig. 1. Cxcl14 is expressed in placode cells in the developing trigeminal ganglion.

Fig. 1.

Open in a new tab

A-D. Representative images of whole mount hybridization chain reaction (HCR) in situ hybridization for Cxcr4 (red) and Cxcl14 (cyan) in stage HH9(A), HH10 (B), HH13 (C), HH16 (D) chick embryos. Dashed box in A-D indicates zoomed area in ’A′-D’. (inset). HCR for Cxcr4 (red) and Cxcl14 (cyan) reveals expression of Cxcl14 in subset of cells, nonoverlapping domains of expression are labeled with filled arrowhead. D, Dorsal; V, Ventral; A, Anterior; P, Posterior; opv, ophthalmic lobe; mmV, maxillary and mandibular lobe.

As neural crest cells emigrate from the neural tube, Cxcl14 is expressed in the dorsal neural tube, but its expression does not overlap with Cxcr4. At HH9–10, Cxcl14 is confined to the neural tube just caudal to the emigrating neural crest domain, in a non-overlapping pattern (Fig. 1A’ and 1B’, arrowheads). By HH13, Cxcl14 expression shifts and becomes evident on what appears to be ingressing placodal cells that are intermingled with Cxcr4 expressing neural crest cells (Fig. 1C–1C’, arrowheads). Additionally, Cxcl14 expression remains evident in the distal regions of the developing trigeminal ganglion at HH13 (Fig. 1C) and HH16 (Fig. 1D) as seen in more ventral region of the images (Fig. 1C’, D’). This is consistent with previous studies identifying the distal portion of the trigeminal ganglion as the final location of placode-derived neurons (Fig. 1D–1D’, arrowheads) (Begbie and Graham, 2001; D’Amico-Martel and Noden, 1983; Noden, 1978; Shiau et al., 2008).

In comparison to Cxcr4, Cxcr7 was not expressed in either pre-migratory neural crest cells at HH9 or in migratory neural crest cells (Fig. S1A). Additionally, expression of Cxcr7 was absent from cells condensing into the trigeminal ganglion (Fig. S1B–S1C). Instead, Cxcr7 was highly expressed in the frontonasal process, where its expression overlapped with Cxcl12 (Fig. S1B–S1C). Interestingly, Cxcl12 expression did not overlap with Cxcr4 in the region of ganglion formation; rather, it was predominantly localized to the frontonasal process, distant from Cxcr4-expressing cranial neural crest cells (compare Fig. 1C–1D & Fig. S1B–S1C). In contrast, in the cardiac region, Cxcl12 expression is positioned just forward of the migrating cardiac neural crest cell front at HH13 and persists to be expressed adjacent to the cardiac neural crest stream within the caudal branchial arches (compare Fig. 1C & Fig. S1B).

To determine the cell type specificity of Cxcl14 expression at high resolution, we performed ex ovo electroporations, labeling the ectoderm and presumptive placode cells using a lunatic fringe (LFNG) enhancer and then analyzed co-expression of Cxcl14 transcripts. Transverse sections through HH13 embryos revealed multiple cells co-expressing Cxcl14 transcripts and an ectoderm-specific enhancer driven membrane eGFP marker, and are in close proximity to SOX10-expressing neural crest cells (Fig. 2A & 2A’, arrowheads). These results suggest that Cxcl14 expressing cells predominantly originate from the placodal population, and indeed aggregate with neural crest cells during gangliogenesis (Fig. 2A’–2C’, arrowheads).

Fig. 2. Expression of Cxcl14 is enriched in a subset of ectodermal placodal cells.

Fig. 2.

Open in a new tab

A. Representative image of a transverse section at HH13. Hybridization chain reaction (HCR) reveals expression of Cxcl14 (red) transcripts co-localizing with cells that express eGFP mediated by an ectodermal enhancer (cyan). Immunolabeling for SOX10 (yellow) reveals that these placode cells intimately interact with SOX10 expressing neural crest cells. A’-D’. Arrowheads indicate eGFP labeled placodal cells that are close proximity to SOX10-expressing neural crest cells (yellow). Dashed box in A indicates zoomed area in A’-D’. Scale bars represent 50μm (A), NT, neural tube.

Taken together, these results suggest a possible interaction between Cxcr4 and Cxcl14 in the developing trigeminal ganglion, whereas Cxcl12 expression correlates with the presence of Cxcr7 expression in the frontonasal region. Thus, in contrast to Xenopus embryos, in which Cxcl12 has been shown to mediate interactions between cranial neural crest and placode cells, the present results suggest that Cxcl12 is not expressed at the appropriate time or place to account for this function in trigeminal ganglion formation in the developing chick embryo.

Loss of Cxcl14 disrupts trigeminal ganglion formation

Next, we examined the effects of Cxcl14 perturbation using CRISPR/Cas9-mediated knockouts. To achieve this, we utilized CRISPR/Cas9 constructs optimized based on previous designs (Gandhi et al., 2021) to deplete Cxcl14 in the developing chick embryo. Guide RNAs (gRNAs) targeting the coding sequence of Cxcl14 were electroporated unilaterally into HH4 embryos, allowing for a global Cxcl14 knockout (Fig. 3A). Loss of transcript was validated by Hybridization Chain Reaction (HCR) in situ hybridization for Cxcl14 transcripts (Fig S2). Following electroporation, treated embryos were allowed to develop to HH16, a stage when placode-derived neurons have extended axons, but neural crest-derived cells have yet to differentiate (Begbie et al., 2002; D’Amico-Martel and Noden, 1980; Moody et al., 1989; Shiau et al., 2008). To assess trigeminal ganglion formation, we performed immunolabeling using SOX10 to identify neural crest cells and TUJ1 to label placode-derived neurons and axonal processes.

Fig. 3. CRISPR/Cas9 mediated perturbation of Cxcl14 disrupts trigeminal ganglion development.

Fig. 3.

Open in a new tab

A. Schematic diagram illustrating the ex ovo electroporation to test the effects of perturbing Cxcl14. Experimental (blue) reagents were delivered unilaterally into gastrulating HH4 chick embryos. B-C”. Cxcl14 specific gRNA-CRISPR/Cas9 construct was unilaterally electroporated on the right side of the embryo. Immunohistochemistry for SOX10 (magenta) and TUJ1 (green) reveals the effects of global loss of Cxcl14 via CRISPR/Cas9-mediated knock out at HH16. Arrows indicate position of neural crest-derived cells. Arrowheads indicate position of placode-derived cells. D-E. Quantification of trigeminal ganglion area (D) and dispersion (E) for experimental (Elec.) and control (Unelec.) sides of CRISPR/Cas9 perturbed embryos. Analysis was perform separately for the ophthalmic (OpV) and maxillary and mandibular (MmV) lobes of the ganglion. Each point represents an individual embryo and p-value was determined by a two-tailed, paired t-test. Scale bars represent 200 μm.

Examination of the experimental (knockout) side of the embryo revealed defects in ganglion formation when compared to the contralateral (control) side of the same embryo. Specifically, neural crest-derived cells in both the ophthalmic and maxillomandibular lobes appeared less condensed following loss of Cxcl14 (Fig. 3C–3C”, arrows). Additionally, placode-derived neuronal processes appeared misdirected and less bundled relative to the control side (Compare Fig. 3B–3B” & 3C–3C”, arrowheads). To quantify these effects, we analyzed the area occupied by and the degree of dispersion of SOX10-expressing neural crest-derived cells and TUJ1-expressing placode-derived neurons. The results revealed a significant increase in the dispersion of both neural crest- and placode-derived cells (Fig. 3E), affecting the ganglion as a whole. On the other hand, there exist variations in the effect of knocking out Cxcl14 on the area occupied by neural crest- and placode-derived cells: placode cells occupied a significantly smaller domain in the maxillomandibular lobes, whereas the neural crest cells exhibited an increase in area in the ophthalmic lobe (Fig. 3D).

We next examined the effects of perturbing Cxcl14 in only the placodal population. To specifically knock out Cxcl14 in the ectoderm, which normally expresses this chemokine, we electroporated in ovo the ectoderm with our single-CRISPR/Cas9 construct at HH11 (Fig. 4A). The results revealed a significant decrease in placodal contribution to the maxillomandibular lobe, but not in the ophthalmic lobe (Fig. 4B, C). Furthermore, we observed minimal perturbation to neural crest-derived cells across the trigeminal ganglion (Fig. 4B’, 4C’). We similarly quantified the area and dispersion of neural crest-derived and placode-derived cells, and the results corroborated our observations (4F, G). Given that it takes several hours after electroporation to generate the Cas9 protein, this is consistent with the developmental timing of the trigeminal ganglion, as the ophthalmic lobe forms earlier than the maxillomandibular lobe and is likely not affected by late manipulations. The fact that we only detected defects in placodal-derived neurons after this manipulation raises the intriguing possibility that there may be an autoregulatory role of the chemokine in the placode. This however remains to be tested but we did note abnormal extensions of neural crest cells away from the main body of the ganglion in some perturbed embryos (Fig. 4C’).

Fig. 4. Perturbation of Cxcl14 specifically in placode cells disrupts trigeminal ganglion development.

Fig. 4.

Open in a new tab

A. Schematic illustrating the in ovo experimental design to perturb Cxcl14, specifically targeting placode cells. Experimental (red) reagents were delivered unilaterally into the ectoderm of HH11 (13 somites) chick embryos. B-E”. Either a Cxcl14 specific gRNA-CRISPR/Cas9 construct (B-C”) or Cxcl14 MO (D-E”) were introduced onto the right side of the embryo. Immunolabeling of SOX10 (magenta) and TUJ1 (green) reveals the effects of loss of Cxcl14 within the trigeminal ganglion, specifically in placode cells at HH16. Arrows indicate position of neural crest-derived cells. Arrowheads indicate position of placode-derived cells. Quantification of trigeminal ganglion area and dispersion for CRISPR (F,G) and Morpholino (H,I) between experimental (Elec.) and control (Unelec.) sides. Analysis was performed separately for the ophthalmic (OpV) and maxillary and mandibular (MmV) lobes of the ganglion. Each point represents an individual embryo and p-value was determined by a two-tailed, paired t-test. Scale bars represent 200 μm.

As a secondary approach, we performed in ovo electroporations to achieve Morpholino-mediated knockdown of Cxcl14 (Fig. 4A). The results were morphologically (Fig. 4D–E”) and quantitatively (Fig. 4H,I) similar to those obtained with the CRISPR construct, albeit not as penetrant. Collectively, these results demonstrate that loss of Cxcl14 impacts the condensation and proper formation of the trigeminal ganglion.

To control for possible effects of the electroporation itself, we repeated the above experiments comparing the unelectroporated side with the contralateral side electroporated with control plasmid or control morpholino (Fig. Sup 3). The results reveal no effects for in ovo electroporations and only mild effects of exo ovo electroporations, likely due to fragility of the early stage embryos in which these electroporations are performed. The efficacy of the translation blocking morpholino was verified by showing that it efficiently blocks UTR-mediated reporter expression after electroporation (Fig Sup 4).

Taken together, our results reveal a new in vivo developmental role for Cxcl14 during trigeminal ganglion development.

Discussion

In our search for signaling factors involved in trigeminal ganglion formation, we found that the orphan chemokine Cxcl14 is expressed by ectodermal placode cells precisely as the trigeminal ganglion begins to condense via interactions with neural crest cells. Moreover, loss of Cxcl14, either globally or specifically in the ectoderm, causes abnormalities in trigeminal ganglion formation. Surprisingly, these results are in contrast to existing data from Xenopus, where interactions between Cxcr4 and Cxcl12 drive neural crest and ectodermal placodal interactions during neural crest migration. This model proposes that Cxcr4-Cxcl12 interactions create a “chase and run” mechanism between neural crest and placode cells, facilitating neural crest migration throughout the embryonic head (Theveneau et al., 2013, 2010). In the chick embryo, we find that this scenario fits well with the migration pattern of cardiac neural crest cells in the neck region of the embryo. As they migrate toward the heart, cardiac neural crest cells interact with epibranchial placode cells (Halasy et al., 2023; Kuratani and Tanaka, 1990; Tani-Matsuhana et al., 2023). Our expression analysis suggests a close interaction between neural crest cells expressing Cxcr4 and epibranchial placode cells expressing Cxcl12, leading to migration into the heart. Consistent with this, chick Cxcl12 is critical for guiding cardiac neural crest cells to the heart (Gandhi et al., 2020; Tani-Matsuhana et al., 2023). In contrast, our study finds no evidence of Cxcl12 expression near cranial neural crest cells migrating toward the trigeminal ganglion. Instead, Cxcl12 is expressed in the ectoderm of branchial arches 1 and 2, in proximity to cells expressing Cxcr7. Conversely, Cxcl14 expression in chick placode cells at HH13 correlates strongly with Cxcr4 expression in migrating cranial neural crest cells. On this basis, we hypothesize that an interaction between Cxcr4 expressing neural crest cells and Cxcl14 expressing placode cells is critical for proper condensation of the trigeminal ganglion, as loss of Cxcl14 severely disrupts ganglion formation.

While our findings highlight an important role for chemokine signaling in trigeminal ganglion formation, other signaling pathways have also been shown to be critical for trigeminal ganglion formation. For example, Robo2 on placodal cells and Slit1 on neural crest cells are known to mediate trigeminal placode-neural crest interactions (Shiau et al., 2008; Shiau and Bronner-Fraser, 2009). In addition, previous studies have demonstrated that trigeminal ganglion formation is mediated, in part, by cadherin-based adhesion. Notably, Cadherin-7 and N-cadherin are expressed in neural crest and placode cells, respectively, during formation of the chick trigeminal ganglia (Halmi et al., 2022; Hatta et al., 1987; Nakagawa and Takeichi, 1995; Shiau and Bronner-Fraser, 2009; Wu and Taneyhill, 2019). Overall, the interactions between Cadherin-7, expressed in neural crest cells, and N-cadherin, present in placodal neurons, is required for coalescing of NC and placodal neurons during trigeminal ganglion formation (Wu et al., 2014; Wu and Taneyhill, 2019).

In summary, this present study demonstrates that the orphan chemokine Cxcl14 is expressed in placode-derived cells prior to and during ingression and at the onset of aggregation of the trigeminal ganglion of the chick embryo. In contrast, Cxcr4 is exclusively expressed by neural crest cells, whereas its proposed ligand Cxcl12 is expressed in the branchial arches, some distance away from the forming ganglion primordium. Additionally, CRISPR-Cas9 mediated knockout of Cxcl14 results in reductions of trigeminal ganglion size and axonal condensation. Taken together, we propose that Cxcl14, made by placodal cells, may facilitate interactions with migratory cranial neural crest expressing its cognate receptor Cxcr4 at the onset of condensation of the trigeminal ganglion, in turn driving the proper gangliogenesis.

Supplementary Material

SupFig 1

Fig S1. Expression patterns of Cxcr7 and Cxcl12 across a range of developmental stages from HH9 to HH16. A-C. Representative images of whole mount HCR in situ hybridization for Cxcr7, Cxcl12, and Cxcl14 at stages HH9, HH13 and HH16 chick embryos.

SupFig 2

Fig S2. Validation of CRISPR/Cas9 mediated Cxcl14 knock-out. A. Schematic diagram illustrating the ex ovo electroporation to validate CRISPR/Cas9 mediated knock-out of Cxcl14. Experimental (blue) reagents were delivered unilaterally into gastrulating HH4 chick embryos. B-C”. Representative images of perturbed embryos at HH10 (B) and HH16 (C-C’) after colorimetric in situ hybridization for Cxcl14. The unelectroporated (unelec., B left and C) sides show normal Cxcl14 expression, whereas the perturbed sides (elec., B right and C’) show marked decrease in Cxcl14 transcript level (black arrowheads), suggesting efficient knock-out of Cxcl14.

SupFig3

Fig S3. Effects of control CRISPR/Cas9 or morpholino mediated perturbations on trigeminal ganglion. A. Schematic diagram illustrating the ex ovo electroporation of control gRNA-CRISPR/Cas9 construct. Experimental (blue) reagents were delivered unilaterally into gastrulating HH4 chick embryos. B-C. Quantification of trigeminal ganglion area (B) and dispersion (C) for electroporated (Elec.) and unelectroporated (Unelec.) sides of control CRISPR/Cas9 perturbed embryos after immunohistochemistry for SOX10 and TUJ1. D. Schematic illustrating the in ovo electroporation targeting the epidermal / placode cells using control gRNA-CRISPR/Cas9 construct or standard control morpholino. Experimental (red) reagents were delivered unilaterally into the ectoderm of HH11 (13 somites) chick embryos. E-F. Quantification of trigeminal ganglion area (E) and dispersion (F) for electroporated (Elec.) and unelectroporated (Unelec.) sides of control CRISPR/Cas9 perturbed embryos after immunohistochemistry for SOX10 and TUJ1. G-H. Quantification of trigeminal ganglion area (G) and dispersion (H) for electroporated (Elec.) and unelectroporated (Unelec.) sides of standard control morpholino perturbed embryos after immunohistochemistry for SOX10 and TUJ1. All the of analysis above were performed separately for the ophthalmic (OpV) and maxillary and mandibular (MmV) lobes of the ganglion. Each point represents an individual embryo and p-value was determined by a two-tailed, paired t-test.

SupFig4

Fig S4. Validation of morpholino mediated Cxcl14 knock-down. A. Schematic diagram illustrating the ex ovo electroporation to validate morpholino mediated knock-down of Cxcl14. Reagents were delivered bilaterally into gastrulating HH4 chick embryos, with control morpholino (Ctrl MO) and reporter constructs (red) delivered to the left side and Cxcl14 morpholino (Cxcl14 MOs) and reporter constructs (blue) injected onto the right side. B-C’. Representative images of perturbed embryos at HH9 (B, B’) and HH12 (C-C’). Native GFP signals from the reporter construct were clearly and broadly visible on the control MO injected sides and were significantly repressed on the Cxcl14 MOs injected sides, suggesting efficient blockage of Cxcl14 translation.

Acknowledgement

Funding for this work is supported by the National Institutes of Health (NIH) grants R01DE024157 to M.E.B. and F31DE031154 to H.A.U.

Footnotes

Declaration of competing interest

The authors declare no competing or financial interests.

References

  1. Atanes P, Hawkes RG, Olaniru OE, Ruz-Maldonado I, Amisten S, Persaud SJ, 2019. CXCL14 inhibits insulin secretion independently of CXCR4 or CXCR7 receptor activation or cAMP inhibition. Cell. Physiol. Biochem 52, 879–892. [DOI] [PubMed] [Google Scholar]
  2. Balabanian K, Lagane B, Infantino S, Chow KYC, Harriague J, Moepps B, Arenzana-Seisdedos F, Thelen M, Bachelerie F, 2005. The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J. Biol. Chem 280, 35760–35766. [DOI] [PubMed] [Google Scholar]
  3. Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA, 1996. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J. Exp. Med 184, 1101–1109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Boldajipour B, Mahabaleshwar H, Kardash E, Reichman-Fried M, Blaser H, Minina S, Wilson D, Xu Q, Raz E, 2008. Control of chemokine-guided cell migration by ligand sequestration. Cell 132, 463–473. [DOI] [PubMed] [Google Scholar]
  5. Chen Q, Zhang M, Li Y, Xu D, Wang Y, Song A, Zhu B, Huang Y, Zheng JC, 2015. CXCR7 mediates neural progenitor cells migration to CXCL12 independent of CXCR4. Stem Cells 33, 2574–2585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choi HMT, Schwarzkopf M, Fornace ME, Acharya A, Artavanis G, Stegmaier J, Cunha A, Pierce NA, 2018. Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust. Development 145. 10.1242/dev.165753 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Collins PJ, McCully ML, Martínez-Muñoz L, Santiago C, Wheeldon J, Caucheteux S, Thelen S, Cecchinato V, Laufer JM, Purvanov V, Monneau YR, Lortat-Jacob H, Legler DF, Uguccioni M, Thelen M, Piguet V, Mellado M, Moser B, 2017. Epithelial chemokine CXCL14 synergizes with CXCL12 via allosteric modulation of CXCR4. FASEB J 31, 3084–3097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dai C, Basilico P, Cremona TP, Collins P, Moser B, Benarafa C, Wolf M, 2015. CXCL14 displays antimicrobial activity against respiratory tract bacteria and contributes to clearance of Streptococcus pneumoniae pulmonary infection. J. Immunol 194, 5980–5989. [DOI] [PubMed] [Google Scholar]
  9. D’Amico-Martel A, Noden DM, 1983. Contributions of placodal and neural crest cells to avian cranial peripheral ganglia. Am. J. Anat 166, 445–468. [DOI] [PubMed] [Google Scholar]
  10. Elagoz AM, Styfhals R, Maccuro S, Masin L, Moons L, & Seuntjens E, 2022. Optimization of Whole Mount RNA Multiplexed in situ Hybridization Chain Reaction With Immunohistochemistry, Clearing and Imaging to Visualize Octopus Embryonic Neurogenesis. Front. Physiol 13:882413. 10.3389/fphys.2022.882413 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Escot S, Blavet C, Härtle S, Duband J-L, Fournier-Thibault C, 2013. Misregulation of SDF1-CXCR4 signaling impairs early cardiac neural crest cell migration leading to conotruncal defects. Circ. Res 113, 505–516. [DOI] [PubMed] [Google Scholar]
  12. Gandhi S, Ezin M, Bronner ME, 2020. Reprogramming axial level identity to rescue neural-crest-related congenital heart defects. Dev. Cell 53, 300–315.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gandhi S, Li Y, Tang W, Christensen JB, Urrutia HA, Vieceli FM, Piacentino ML, Bronner ME, 2021. A single-plasmid approach for genome editing coupled with long-term lineage analysis in chick embryos. Development 148. 10.1242/dev.193565 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Giacobbi NS, Mullapudi S, Nabors H, Pyeon D, 2024. The chemokine CXCL14 as a potential immunotherapeutic agent for cancer therapy. Viruses 16, 302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gordon CT, Wade C, Brinas I, Farlie PG, 2011. CXCL14 expression during chick embryonic development. Int. J. Dev. Biol 55, 335–340. [DOI] [PubMed] [Google Scholar]
  16. Halasy V, Szőcs E, Soós Á, Kovács T, Pecsenye-Fejszák N, Hotta R, Goldstein AM, Nagy N, 2023. CXCR4 and CXCL12 signaling regulates the development of extrinsic innervation to the colorectum. Development 150. 10.1242/dev.201289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Halmi CA, Leonard CE, McIntosh AT, Taneyhill LA, 2024. N-cadherin facilitates trigeminal sensory neuron outgrowth and target tissue innervation. bioRxiv. 10.1101/2024.05.20.594965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Halmi CA, Wu C-Y, Taneyhill LA, 2022. Neural crest cell-placodal neuron interactions are mediated by Cadherin-7 and N-cadherin during early chick trigeminal ganglion assembly. F1000Res 11, 741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hamburger V, 1961. Experimental analysis of the dual origin of the trigeminal ganglion in the chick embryo. J. Exp. Zool 148, 91–123. [DOI] [PubMed] [Google Scholar]
  20. Hatta K, Takagi S, Fujisawa H, Takeichi M, 1987. Spatial and temporal expression pattern of N-cadherin cell adhesion molecules correlated with morphogenetic processes of chicken embryos. Dev. Biol 120, 215–227. [DOI] [PubMed] [Google Scholar]
  21. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B, 2016. Versatile protein tagging in cells with split fluorescent protein. Nat. Commun 7, 11046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kasemeier-Kulesa JC, McLennan R, Romine MH, Kulesa PM, Lefcort F, 2010. CXCR4 controls ventral migration of sympathetic precursor cells. J. Neurosci 30, 13078–13088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Knaut H, Werz C, Geisler R, Nüsslein-Volhard C, Tübingen 2000 Screen Consortium, 2003. A zebrafish homologue of the chemokine receptor Cxcr4 is a germ-cell guidance receptor. Nature 421, 279–282. [DOI] [PubMed] [Google Scholar]
  24. Kucia M, Jankowski K, Reca R, Wysoczynski M, Bandura L, Allendorf DJ, Zhang J, Ratajczak J, Ratajczak MZ, 2004. CXCR4-SDF-1 signalling, locomotion, chemotaxis and adhesion. J. Mol. Histol 35, 233–245. [DOI] [PubMed] [Google Scholar]
  25. Kuehn E, Clausen DS, Null RW, Metzger BM, Willis AD, & Özpolat BD, 2022. Segment number threshold determines juvenile onset of germline cluster expansion in Platynereis dumerilii. J. Exp. Zool. (Mol. Dev. Evol.) 338, 225–240. 10.1002/jez.b.23100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kuratani S, Tanaka S, 1990. Peripheral development of the avian vagus nerve with special reference to the morphological innervation of heart and lung. Anat. Embryol. (Berl.) 182, 435–445. [DOI] [PubMed] [Google Scholar]
  27. Levoye A, Balabanian K, Baleux F, Bachelerie F, Lagane B, 2009. CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113, 6085–6093. [DOI] [PubMed] [Google Scholar]
  28. Lu J, Chatterjee M, Schmid H, Beck S, Gawaz M, 2016. CXCL14 as an emerging immune and inflammatory modulator. J. Inflamm. (Lond.) 13, 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Memi F, Abe P, Cariboni A, MacKay F, Parnavelas JG, Stumm R, 2013. CXC chemokine receptor 7 (CXCR7) affects the migration of GnRH neurons by regulating CXCL12 availability. J. Neurosci 33, 17527–17537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Miyajima R, Tanegashima K, Naruse N, Denda M, Hara T, Otaka A, 2024. Identification of low-density lipoprotein receptor-related protein 1 as a CXCL14 receptor using chemically synthesized tetrafunctional probes. ACS Chem. Biol 19, 551–562. [DOI] [PubMed] [Google Scholar]
  31. Nakagawa S, Takeichi M, 1995. Neural crest cell-cell adhesion controlled by sequential and subpopulation-specific expression of novel cadherins. Development 121, 1321–1332. [DOI] [PubMed] [Google Scholar]
  32. Ojeda AF, Munjaal RP, Lwigale PY, 2013. Expression of CXCL12 and CXCL14 during eye development in chick and mouse. Gene Expr Patterns. 13(8), 303–310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Olesnicky Killian EC, Birkholz DA, Artinger KB, 2009. A role for chemokine signaling in neural crest cell migration and craniofacial development. Dev. Biol 333, 161–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sand LGL, Scotlandi K, Berghuis D, Snaar-Jagalska BE, Picci P, Schmidt T, Szuhai K, Hogendoorn PCW, 2015. CXCL14, CXCR7 expression and CXCR4 splice variant ratio associate with survival and metastases in Ewing sarcoma patients. Eur. J. Cancer 51, 2624–2633. [DOI] [PubMed] [Google Scholar]
  35. Shah A, Taneyhill LA, 2015. Differential expression pattern of Annexin A6 in chick neural crest and placode cells during cranial gangliogenesis. Gene Expr. Patterns 18, 21–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shiau CE, Bronner-Fraser M, 2009. N-cadherin acts in concert with Slit1-Robo2 signaling in regulating aggregation of placode-derived cranial sensory neurons. Development 136, 4155–4164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shiau CE, Lwigale PY, Das RM, Wilson SA, Bronner-Fraser M, 2008. Robo2-Slit1 dependent cell-cell interactions mediate assembly of the trigeminal ganglion. Nat. Neurosci 11, 269–276. [DOI] [PubMed] [Google Scholar]
  38. Sjöberg E, Augsten M, Bergh J, Jirström K, Östman A, 2016. Expression of the chemokine CXCL14 in the tumour stroma is an independent marker of survival in breast cancer. Br. J. Cancer 114, 1117–1124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Tani-Matsuhana S, Kawata Y, Inoue K, 2023. The cardiac neural crest gene MafB ectopically directs CXCR4 expression in the trunk neural crest. Dev. Biol 495, 1–7. [DOI] [PubMed] [Google Scholar]
  40. Theveneau E, Marchant L, Kuriyama S, Gull M, Moepps B, Parsons M, Mayor R, 2010. Collective chemotaxis requires contact-dependent cell polarity. Dev. Cell 19, 39–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Theveneau E, Steventon B, Scarpa E, Garcia S, Trepat X, Streit A, Mayor R, 2013. Chase-and-run between adjacent cell populations promotes directional collective migration. Nat. Cell Biol 15, 763–772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Waldemer-Streyer RJ, Reyes-Ordoñez A, Kim D, Zhang R, Singh N, Chen J, 2017. Cxcl14 depletion accelerates skeletal myogenesis by promoting cell cycle withdrawal. NPJ Regen. Med 2. 10.1038/npjregenmed.2016.17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Westrich JA, Vermeer DW, Colbert PL, Spanos WC, Pyeon D, 2020. The multifarious roles of the chemokine CXCL14 in cancer progression and immune responses. Mol. Carcinog 59, 794–806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Westrich JA, Vermeer DW, Silva A, Bonney S, Berger JN, Cicchini L, Greer RO, Song JI, Raben D, Slansky JE, Lee JH, Spanos WC, Pyeon D, 2019. CXCL14 suppresses human papillomavirus-associated head and neck cancer through antigen-specific CD8+ T-cell responses by upregulating MHC-I expression. Oncogene 38, 7166–7180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wu C-Y, Hooper RM, Han K, Taneyhill LA, 2014. Migratory neural crest cell αN-catenin impacts chick trigeminal ganglia formation. Dev. Biol 392, 295–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wu C-Y, Taneyhill LA, 2019. Cadherin-7 mediates proper neural crest cell-placodal neuron interactions during trigeminal ganglion assembly. Genesis 57, e23264. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SupFig 1

Fig S1. Expression patterns of Cxcr7 and Cxcl12 across a range of developmental stages from HH9 to HH16. A-C. Representative images of whole mount HCR in situ hybridization for Cxcr7, Cxcl12, and Cxcl14 at stages HH9, HH13 and HH16 chick embryos.

NIHMS2183245-supplement-SupFig_1.tiff (6.3MB, tiff)
SupFig 2

Fig S2. Validation of CRISPR/Cas9 mediated Cxcl14 knock-out. A. Schematic diagram illustrating the ex ovo electroporation to validate CRISPR/Cas9 mediated knock-out of Cxcl14. Experimental (blue) reagents were delivered unilaterally into gastrulating HH4 chick embryos. B-C”. Representative images of perturbed embryos at HH10 (B) and HH16 (C-C’) after colorimetric in situ hybridization for Cxcl14. The unelectroporated (unelec., B left and C) sides show normal Cxcl14 expression, whereas the perturbed sides (elec., B right and C’) show marked decrease in Cxcl14 transcript level (black arrowheads), suggesting efficient knock-out of Cxcl14.

NIHMS2183245-supplement-SupFig_2.tiff (18.5MB, tiff)
SupFig3

Fig S3. Effects of control CRISPR/Cas9 or morpholino mediated perturbations on trigeminal ganglion. A. Schematic diagram illustrating the ex ovo electroporation of control gRNA-CRISPR/Cas9 construct. Experimental (blue) reagents were delivered unilaterally into gastrulating HH4 chick embryos. B-C. Quantification of trigeminal ganglion area (B) and dispersion (C) for electroporated (Elec.) and unelectroporated (Unelec.) sides of control CRISPR/Cas9 perturbed embryos after immunohistochemistry for SOX10 and TUJ1. D. Schematic illustrating the in ovo electroporation targeting the epidermal / placode cells using control gRNA-CRISPR/Cas9 construct or standard control morpholino. Experimental (red) reagents were delivered unilaterally into the ectoderm of HH11 (13 somites) chick embryos. E-F. Quantification of trigeminal ganglion area (E) and dispersion (F) for electroporated (Elec.) and unelectroporated (Unelec.) sides of control CRISPR/Cas9 perturbed embryos after immunohistochemistry for SOX10 and TUJ1. G-H. Quantification of trigeminal ganglion area (G) and dispersion (H) for electroporated (Elec.) and unelectroporated (Unelec.) sides of standard control morpholino perturbed embryos after immunohistochemistry for SOX10 and TUJ1. All the of analysis above were performed separately for the ophthalmic (OpV) and maxillary and mandibular (MmV) lobes of the ganglion. Each point represents an individual embryo and p-value was determined by a two-tailed, paired t-test.

NIHMS2183245-supplement-SupFig3.tiff (56.5MB, tiff)
SupFig4

Fig S4. Validation of morpholino mediated Cxcl14 knock-down. A. Schematic diagram illustrating the ex ovo electroporation to validate morpholino mediated knock-down of Cxcl14. Reagents were delivered bilaterally into gastrulating HH4 chick embryos, with control morpholino (Ctrl MO) and reporter constructs (red) delivered to the left side and Cxcl14 morpholino (Cxcl14 MOs) and reporter constructs (blue) injected onto the right side. B-C’. Representative images of perturbed embryos at HH9 (B, B’) and HH12 (C-C’). Native GFP signals from the reporter construct were clearly and broadly visible on the control MO injected sides and were significantly repressed on the Cxcl14 MOs injected sides, suggesting efficient blockage of Cxcl14 translation.

NIHMS2183245-supplement-SupFig4.tiff (26.3MB, tiff)

RESOURCES