Skip to main content
Asian Journal of Andrology logoLink to Asian Journal of Andrology
. 2026 Jan 16;28(3):327–334. doi: 10.4103/aja202565

Novel biallelic CFAP43 mutations induce MMAF with mitochondrial abnormalities and successful ICSI outcomes

Qi Chen 1,*,#, Jie Yang 1,*,#, Sheng-Jia Shi 1, Shao-Chun Wu 1, Huan Ren 1, Yu Xue 1, Xing-Zhe Ji 1, Man Yu 2, He Cai 1, Juan-Zi Shi 1,, Sen Qiao 1,
PMCID: PMC13258283  PMID: 41549427

Abstract

Multiple morphological abnormalities of sperm flagellum (MMAF) is a rare cause of primary infertility. Genetic variants in cilia- and flagella-associated protein 43 (CFAP43) are associated with asthenoteratospermia and MMAF; however, the detailed pathogenic mechanisms are still to be completely elucidated. Here, we identified novel compound heterozygous mutations in CFAP43, c.1859_1860+8delinsGT, and c.3071A>G (p.N1024S), by whole-exome sequencing (WES). The proband had a typical MMAF phenotype; Sanger sequencing confirmed these mutations and showed that they cosegregated within the family. Further analysis of the patient’s sperm samples indicated that the CFAP43 mutations result in aberrant RNA splicing. Additionally, we observed disturbance and partial deletion of the mitochondrial sheath, along with a significant reduction in translocase of outer mitochondrial membrane 20 (TOM20) expression. This study suggests that infertility associated with CFAP43 loss of function may be linked to mitochondrial dysfunction. Finally, assisted reproductive technology using intracytoplasmic sperm injection (ICSI) resulted in a successful pregnancy and live birth. Our study expands the spectrum of pathogenic CFAP43 mutations and provides valuable insights for genetic counseling and personalized reproductive strategies in patients with MMAF.

Keywords: CFAP43, ICSI, infertility, MMAF, sperm flagella

INTRODUCTION

Human reproductive success depends on multiple parameters of the sperms, including morphology, concentration, DNA integrity, and motility. Among these, motility is a critical determinant, with flagellar malformations significantly contributing to male fertility issues.1 The sperm flagellum contains specific periaxonemal structures, absent in other motile cilia, including a spiraling mitochondrial sheath (MS) in the midpiece, the fibrous sheath (FS) in the principal piece (PP), and outer dense fibers (ODFs) in the midpiece and the proximal part of the PP. These structures are vital for providing the structural stability and energy metabolism required for sperm motility.2 Multiple morphological abnormalities of the sperm flagella (MMAF) represent one of the most severe forms of sperm defects, characterized by irregular caliber, angulation, coiled, short, or absent structures, often accompanied by disorganized axonemal structures.3,4,5,6 The internal skeleton of motile cilia and flagella, named the axoneme, is a highly evolutionary conserved structure, which consists of nine doublets of microtubules (DMTs) circularly arranged around a central pair (CP) complex of microtubules (the “9+2” structure). Ultrastructural defects in patients with MMAF, such as the absence of central microtubules, disrupted mitochondrial sheaths, or abnormalities in periaxonemal structures (e.g., ODFs and FS), impair sperm motility and result in infertility.2,7,8

Although significant advancements have been made, the exact mechanisms behind MMAF are still not fully understood. Advancements in whole-exome sequencing (WES) have identified numerous pathogenic genes associated with MMAF, including A-kinase anchoring protein (AKAP), coiled-coil domain-containing (CCDC), cilia- and flagella-associated protein (CFAP), dynein axonemal heavy chain (DNAH), and others.9,10,11,12 Recent studies have reported that WD repeat domain 63 (WDR63) mutations disrupt inner dynein arm (IDAs) assembly, whereas glutamine-rich protein 2 (QRICH2) and fibrous sheath-interacting protein 2 (FSIP2) mutations lead to MMAF.13,14 A large proportion of MMAF cases are caused by mutations in CFAP genes, such as CFAP43, CFAP44, CFAP61, CFAP65, and others.12,15,16,17 Notably, one study has found that pathogenic CFAP300 variants can cause abnormalities in respiratory cilia and sperm flagella, whereas the proband presented typical symptoms and signs of primary ciliary dyskinesia (PCD) rather than MMAF.18 The complex regulatory mechanisms of gene variants and phenotypic specificity in the CFAP family still need to be deeply explored. CFAP43, which is of concern in this study, is located on chromosome 10 and encodes a testis-specific 1665-amino acid protein critical for axonemal organization. Although mutations in CFAP43 have been associated with defects in the inner dynein arm complex, functional studies remain limited.19

In this study, we identified a novel compound heterozygous mutation of CFAP43 in a Chinese family with asthenoteratozoospermia and MMAF through WES. The clinical features of the patient are presented, along with detailed analyses of the morphology of ejaculated sperm and the ultrastructure of the flagellum to provide an accurate diagnosis of MMAF and further elucidate its pathogenesis. Notably, the patient attained a favorable reproductive outcome following assisted reproductive technology (ART) via intracytoplasmic sperm injection (ICSI). These findings contribute to clinical decision-making and have significant implications for genetic counseling and the management of MMAF patients. Additionally, we confirmed that one of the CFAP43 mutations led to abnormal RNA splicing, providing further insight into the molecular mechanisms of MMAF. Our findings offer new perspectives on the pathogenesis of MMAF and emphasize the role of ART in treating CFAP43-related infertility.

PARTICIPANTS AND METHODS

Participants

From April 2022 to March 2025, 2159 infertile Chinese males were recruited from the Reproductive Center of Northwest Women’s and Children’s Hospital (Xi’an, China) for the study. All these patients were clearly diagnosed with male factor infertility on the basis of an abnormal semen analysis and other auxiliary evaluations. Fifty-six individuals with chromosomal karyotype abnormalities and Y-chromosome microdeletions were excluded. The remaining 2103 patients were included in the subsequent analysis, comprising 54 patients with azoospermia, 197 patients with oligozoospermia (sperm concentration <16×106 ml−1), 811 patients with asthenozoospermia (progressive motility <30.0%), and 1549 patients with teratospermia (normal sperm morphology <4.0%). Among these, 182 patients presented with a combined phenotype (oligoasthenozoospermia), and 76 patients were diagnosed with MMAF. Furthermore, there were 863 healthy male controls. In accordance with the local protocols and the principles of the Declaration of Helsinki, written informed consent was obtained from all subjects involved in the study, including the patient, his family members, and healthy controls. The study protocol was reviewed and approved by the Institutional Review Board of Northwest Women’s and Children’s Hospital (Approval No. 2022020). Permission to publish the data involved in the paper has been obtained.

WES and Sanger sequencing validation

WES was conducted in 2103 infertile male patients and 863 healthy male controls. Genomic DNA was extracted from peripheral blood samples using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany). Human whole-exome sequencing was performed on an Illumina HiSeq X-TEN platform (Illumina, San Diego, CA, USA), yielding 150-bp paired-end reads. Raw sequencing data were processed using standard bioinformatics pipelines, including read alignment to the human reference genome (GRCh38; available on: https://www.ncbi.nlm.nih.gov/grc/human, last accessed on 18 July 2024) using the Burrows–Wheeler Aligner (BWA; available on: https://github.com/lh3/bwa, last accessed on 18 July 2024), and variant calling with GATK (available on: https://gatk.broadinstitute.org, last accessed on 18 July 2024). Variants were filtered on the basis of quality metrics, population allele frequency (using public databases such as gnomAD), and potential pathogenicity (using tools such as SIFT, PolyPhen-2, and ClinVar). The CFAP43 mutations in the patient with MMAF were validated by Sanger sequencing and pedigree analysis. The primer sequences are listed in Supplementary Table 1. The guidelines of the American College of Medical Genetics and Genomics (ACMG) were followed for annotating the clinical significance of the mutations. The patient with the identified compound heterozygous mutations of CFAP43 was selected for further analysis.

Supplementary Table 1.

Primer sequences for Sanger sequencing

Gene Mutation Primer sequence (5’–3’)
CFAP43 c.3071A>G (p.N1024S) Forward: CTTTGGTTTCTGCTTCTTCCTGG
Reverse: AATTGTGGGATCATGTTACCAGT
c.1859_1860+8delinsGT Forward: GCACAAGTATCAGGTTGCTCAAA
Reverse: ACAAGTGATTTCTCTTCTTTTTCCAA

Electron microscopy analysis of spermatozoa

Sperm samples were prepared for scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to examine sperm morphology and ultrastructure. To perform SEM, the sperm were washed with phosphate-buffered saline (PBS) to remove debris and fixed in 2.5% glutaraldehyde (Sigma-Aldrich, St. Louis, MO, USA) at 4°C overnight. The samples were rinsed three times with PBS, dehydrated through a graded ethanol series (30%, 50%, 70%, and 90%; 10 min each) with two final 10-min immersions in 100% anhydrous ethanol (Sigma-Aldrich), and air-dried. The prepared samples for SEM were sputter coated by an ionic sprayer meter (ACE200; Leica, Wetzlar, Germany) and observed by SEM (Nova NanoSEM 450; FEI, Hillsboro, OR, USA) at an accelerating voltage of 5 kV. To perform TEM, the sperms were fixed in 2.5% glutaraldehyde in 0.1 mol l−1 cacodylate buffer (pH 7.4) at 4°C overnight, followed by post-fixation in 1% osmium tetroxide (Sigma-Aldrich) for 1–2 h. The samples were washed with cacodylate buffer, dehydrated in a graded ethanol series, and embedded in Epon 812 (90529-77-4; SPI, West Chester, PA, USA). Ultrathin (70 nm) sections were stained with lead citrate and uranyl acetate and then observed by TEM (Tecnai G2 Spirit 120kV; Philips, Eindhoven, The Netherlands) at an accelerating voltage of 80 kV. Images from both SEM and TEM were captured to comprehensively evaluate sperm morphology and ultrastructure.

Conservation analysis and protein structure prediction

To assess the conservation of the mutated amino acids, a phylogenetic tree was generated, and evolutionary conservation analysis was done using the ConSurf server (available on: https://consurf.tau.ac.il, last accessed on 4 October 2024). The Bayesian calculation method was used to calculate the conservation score from the protein sequence. The ConSurf Server evaluated the conservation of CFAP43 across species. Highly conserved residues were identified as those with high conservation scores across species. To evaluate the structural impact of the mutations, the mutant protein models were generated and analyzed using PyMOL Molecular Graphics System (Schrödinger, LLC., New York, NY, USA). The wild-type protein structure, obtained from the Protein Data Bank (PDB; available on: https://www.rcsb.org, last accessed on 4 October 2024), was used as a template. Mutations were introduced using the mutagenesis wizard in PyMOL Molecular Graphics System (Schrödinger, LLC.). The structure around the mutated residue was then analyzed, including potential changes in hydrogen bonding or secondary structure, and compared with wild-type protein.

Semen parameter analysis

After 2–7 days of abstinence, semen samples were collected by masturbation into a sterile container and analyzed in accordance with the World Health Organization (WHO) guidelines (the 6th edition published in 2021).20 The semen was incubated at 37°C and liquefied for 30–60 min prior to analysis, then the semen samples from patients and controls were evaluated for semen volume, sperm concentration, round cells, normal morphology, and sperm motility. Morphological abnormalities of sperm flagella were divided into five categories: short, coiled, absent, angulation, and irregular caliber.

Sperm Papanicolaou staining

The modified Papanicolaou staining method was used to assess sperm morphology. Sperm samples were smeared evenly onto clean glass slides and air-dried. The slides were fixed in 95% ethanol for 10–15 min. After the fixation, the slides were stained with hematoxylin, followed by differentiation in 1% acid alcohol and bluing in tap water. Subsequently, the slides were stained with eosin and bright green for 3 min. Each staining step was followed by thorough rinsing with distilled water or an appropriate buffer. The slides were then dehydrated through a graded alcohol series; after thorough drying, more than 200 stained sperms were assessed for the morphological statistical analysis by light microscopy (TCS SP8; Leica) according to the WHO 6th edition guidelines.20 The observations and evaluations were repeated twice.

Immunofluorescence of spermatozoa

Immunofluorescence staining was performed to analyze the localization and expression of outer mitochondrial membrane 20 (TOM20) in spermatozoa from patient with MMAF and CFAP43 mutations. Sperm samples were washed twice with PBS and fixed in 4% paraformaldehyde for 20 min at room temperature. After fixation, the samples were permeabilized with 0.1% Triton X-100 in PBS for 30 min and blocked with 5% bovine serum albumin (BSA) in PBS for 1 h, incubated with primary antibodies for Acetyl-tubulin (1:200 dilution; 66200-1-Ig, Proteintech Group, Wuhan, China) and TOM20 (1:200 dilution; 11802-1-AP; Proteintech Group) at 4°C overnight. After washing three times with PBS, the samples were incubated with fluorophore-conjugated secondary antibodies for 1 h at room temperature in the dark and stained with 4’-6-diamidino-2-phenylindole (DAPI; P0131; Beyotime, Shanghai, China) for 10 min at room temperature. The images were captured and analyzed by a Leica STELLARIS 5 Confocal Microscope (Leica Microsystems CMS GmbH; Leica).

Validation of RNA splicing abnormalities

Total RNA of human spermatozoa was extracted using the RNeasyPlus Micro Kit (QIAGEN, Hilden, Germany), and approximately obtained 1 μg RNA was converted into cDNA using the PrimeScript™ RT Master Mix Kit (RR036A; Takara Bio Inc., Shiga, Japan). We then analyzed the expression of CFAP43 mRNA expression using real-time polymerase chain reaction (RT-PCR). The primers for RT-PCR are listed in Supplementary Table 2.

Supplementary Table 2.

Primer sequences for RNA splicing anomaly verification

Gene Primer sequence (5’–3’)
CFAP43 Forward: CATAGTGGAAGTGATGGTGCTTTC
Reverse: TTCCACTTTAGGTAGACAAGGGTG

Ovarian stimulation and ART

The female partner of the patient with CFAP43 mutations received ovarian stimulation and ART at the Reproductive Center of Northwest Women’s and Children’s Hospital (Xi’an, China) according to standard clinical protocols. Sperms selected for ICSI were motile and morphologically normal, as defined by the WHO 6th edition guidelines,20 and were assessed by experienced embryologists. ICSI was used for fertilization, and then, embryos were cultured in a time-lapse monitoring system (Embryoscope Plus; Vitrolife, Göteborg, Sweden). The embryos were cultured in a G1 medium (509776, Vitrolife) from day 1 to day 3. The embryos were assessed on day 3 using the European Society of Human Reproduction and Embryology (ESHRE) consensus. High-quality embryos were transferred on day 3 post-fertilization, and luteal support was provided using progesterone. Clinical pregnancy was confirmed by detecting a fetal heartbeat via ultrasound 2–3 weeks after a positive serum β-human chorionic gonadotropin (β-hCG) test.

RESULTS

Identification of CFAP43 variants

We performed WES on 2103 recruited male infertility patients and identified 1 compound heterozygous variant, 1 homozygous variant, and 13 heterozygous variants in CFAP43 among 15 unrelated individuals, accounting for 0.7% (15/2103) of the cohort, all of which have not been reported before (Supplementary Table 3). Among them, the patient with homozygous variant (from the pedigree 3) was not included in this study because he still had known pathogenic homozygous variant of CFAP58. We focused on two novel compound heterozygous variants, c.1859_1860+8delinsGT (M1) and c.3071A>G (p.N1024S; M2) in CFAP43 from the pedigree 1 with asthenoteratozoospermia. The paternal M1 mutation was predicted to disrupt splicing. The M2 mutation, inherited from the mother, is a missense variant predicted to significantly alter protein structure and function based on ACMG guidelines and multiple computational analyses (Supplementary Table 4). Both mutations were either undetected or rarely detected in public genomic databases, including ExAC, the 1000 Genomes Project, and gnomAD (Figure 1).

Supplementary Table 3.

Overview of cilia- and flagella-associated protein 43 variants in the infertile male cohort

Patients cDNA change Protein change Exon/intron Mutation type Mutation zygosity Allele frequency In silico bioinformatics prediction Known/novel


gnomAD gnomAD-EAS PolyPhen2 REVEL Mutation taster CADD
P1 c.1859_1860+8delinsGT NA Intron Noncoding Compound heterozygous ND ND NA NA NA NA Novel
P1 c.3071A>G p.N1024S Exon24 Missense Compound heterozygous 0.000001243 ND Probably_damaging Tolerable Disease_causing Damaging Novel
P2 c.944delG p.G315Afs*22 Exon7 Frameshift Heterozygous ND ND NA NA NA NA Novel
P2 c.3245_3246+1delAGG NA Intron Splicing Heterozygous 0.0003679 0.005112 NA NA NA NA Novel
P3 c.3245_3246+1delAGG NA Intron Splicing Homozygous 0.0003679 0.005112 NA NA NA NA Novel
P4 c.3415-1G>C NA Intron Splicing Heterozygous ND ND NA NA NA NA Novel
P5 c.4528G>T p.E1510* Exon35 Stopgain Heterozygous ND ND NA NA Disease_causing Damaging Novel
P6 c.2809-1G>A NA Intron Splicing Heterozygous ND ND NA NA NA NA Novel
P7 c.4506G>A p.W1502* Exon35 Stopgain Heterozygous 0.000007964 0.0001087 NA NA Disease_causing Damaging Novel
P8 c.1577_1578delCA p.T526Sfs*43 Exon13 Frameshift Heterozygous 0.00002786 0.0001631 NA NA NA NA Novel
P9 c.2809-2A>T NA Intron Splicing Heterozygous ND ND NA NA NA NA Novel
P10 c.3334-1G>C NA Intron Splicing Heterozygous 0.00001205 0.0001637 NA NA NA NA Novel
P11 c.1231G>T p.E411* Exon10 Stopgain Heterozygous ND ND NA NA Disease_causing Damaging Novel
P12 c.3334-1G>C NA Intron Splicing Heterozygous 0.00001205 0.0001637 NA NA NA NA Novel
P13 c.2612_2616del p.N871Sfs*7 Exon21 Frameshift Heterozygous ND ND NA NA NA NA Novel
P14 c.2143C>T p.R715* Exon17 Frameshift Heterozygous 0.000004158 0.000008574 NA NA Disease_causing Damaging Novel
P15 c.944delG p.G315Afs*22 Exon7 Frameshift Heterozygous ND ND NA NA NA NA Novel

The transcript used in this study was NM_173628.4. Com: compound; Het: heterozygous; Hom: homozygous; gnomAD: Genome Aggregation Database; EAS: East Asian; SIFT: sorting intolerant from tolerant; CADD: combined annotation-dependent depletion; ND: not found; NA: not available

Supplementary Table 4.

In silico missense prediction

Algorithm Score Prediction
SIFT 0.0 Damaging
Polyphen-2_HDIV 1.0 Probably_damaging
Polyphen-2_HVAR 0.999 Probably_damaging
LRT 0.000 Deleterious
MutationTaster 1.000 Disease_causing
MutationAssessor 3.44 Medium
FATHMM 0.41 Tolerable
PROVEAN −4.54 Damaging
VEST3 0.274 Tolerable
MetaSVM −0.073 Tolerable
MetaLR 0.416 Tolerable
M-CAP 0.051 Damaging
CADD 23.7 Damaging
DANN 0.999 Damaging
FATHMM_MKL 0.956 Damaging
Eigen 0.652 Damaging
GenoCanyon 0.973 Tolerable
fitCons 0.516 Tolerable
GERP++ 6.06 Conserved
phyloP 6.502 Conserved
phastCons 1.000 Conserved
SiPhy 16.286 Conserved
REVEL 0.320 Tolerable
ReVe 0.99229079 pathogenic
ClinPred 0.5028 /

SIFT: sorting intolerant from tolerant; CADD: combined annotation-dependent depletion

Figure 1.

Figure 1

Identification of CFAP43 mutations in the patient with MMAF. (a) The pedigree illustrates two generations and three individuals. The patient carries compound heterozygous mutations (c.3071A>G, c.1859_1860+8delinsGT) in the CFAP43 gene. Squares represent males, circles represent females, and black-filled symbols indicate affected individuals. (b) Sanger sequencing confirmed that the mutation (c.3071A>G) in the CFAP43 gene of the affected individual in this family was inherited from his mother. (c) Sanger sequencing confirmed that the mutation (c.1859_1860+8delinsGT) in the CFAP43 gene of the affected individual in this family was inherited from his father. CFAP43: cilia- and flagella-associated protein 43; MMAF: multiple morphological abnormalities of sperm flagellum.

Semen and morphological analysis of the proband

Semen analysis revealed severe defects in both motility and morphology. Although semen volume (3.7 ml) and the sperm concentration (22.8 × 106 ml−1) were within the normal range according to the WHO 6th edition guidelines,20 total and progressive motility were absent. Sperm vitality was measured at 65.0%, but the morphological analysis showed that 99.0% of the sperm exhibited abnormalities. These abnormalities included irregular caliber, angulation, absent, short, or coiled flagella, as well as head–tail attachment defects and cytoplasmic remnants (Table 1). Papanicolaou staining and SEM showed clearer morphological characteristics of the patient’s sperm (Figure 2a and 2b).

Table 1.

Baseline characteristics and semen parameters of the patient

Characteristic The patient Reference values (WHO 6th)
Male age (year) 29 -
Infertility duration (year) 1 -
Semen volume (ml) 3.7 ≥1.4
Sperm concentration (106 ml−1) 22.8 ≥16.0
Progressive motility (%) 0 ≥30.0
Total motility (%) 0 ≥39.0
Vitality (%) 65.0 ≥54.0
Normal sperm morphology (%) 1.0 ≥4.0
Abnormal heads (%) 98.0 -
Abnormal midpieces (%) 8.0 -
Abnormal principal pieces (%) 87.0 -
Excess residual cytoplasm (%) 0 -
Irregular caliber (%) 4.0 -
Angulation (%) 9.0 -
Coiled (%) 37.0 -
Short (%) 28.0 -
Absent (%) 21.0 -

Three independent experiments were performed; reference values were published in WHO 6th edition guidelines (2021)20. WHO: World Health Organization

Figure 2.

Figure 2

Morphology and ultrastructural defects of spermatozoa from the patient with MMAF and CFAP43 mutations. (a) Papanicolaou staining of sperm obtained from control participants and the patient harboring CFAP43 mutations. Sperms from the patient displayed typical multiple morphological abnormalities of the sperm flagella phenotypes (short, absent, coiled, angulation, and irregular caliber flagella) compared with the sperm from controls. Scale bar = 5 µm. (b) SEM analysis shows consistent results with the Papanicolaou staining. Scale bar = 5 µm (for the control sample) or 2 µm (for the patient sample). (c) The longitudinal section of sperm in the MMAF patient shows an incomplete flagellum, significantly shortened midpiece, partial absence of mitochondrial sheath and disordered arrangement, and abnormal fibrous sheath disposition. The transverse section of the flagellum shows regular microtubule organization in normal sperm, with nine MTD surrounding the central pair (“9+2” structure). In the patient, partial loss or disorganization of CP, MTD, and FS was observed. Scale bars = 2 µm or 200 nm. The red asterisk represents the anomaly. (d) Immunofluorescence staining of Acetyl-tubulin (red) and TOM20 (green) in sperm of the patient with MMAF and CFAP43 mutations. The nuclei are marked with DAPI (blue). Scale bar = 10 µm. CFAP43: cilia- and flagella-associated protein 43; MMAF: multiple morphological abnormalities of sperm flagellum; CP: central pair; FS: fibrous sheath; MTD: microtubule doublets; Mi: mitochondria; SEM: scanning electron microscopy; TOM20: translocase of outer mitochondrial membrane 20; DAPI: 4´,6-diamidino-2-phenylindole.

Ultrastructural defects in sperm flagella

We conducted subsequent experimental analyses on the patient with compound heterozygous mutations in CFAP43 from pedigree 1. TEM showed extensive abnormalities in the ultrastructural organization of the patient’s sperm. Unlike the normal “9+2” axonemal arrangement observed of the controls, the patient’s sperm showed disorganized axonemal structures, such as the absence of CP. Other defects included irregular or missing ODFs, FS, and fragmented or absent mitochondrial sheaths (Figure 2c). These ultrastructural abnormalities provide direct evidence of structural disorganization underlying the impaired motility and morphological abnormalities that are characteristics of MMAF.

Mitochondrial and axonemal abnormalities

MMAF is often associated with mitochondrial abnormalities, and TOM20 is an essential component of the outer mitochondrial membrane transposase. To further elucidate the effects of CFAP43 mutations on the mitochondrial sheath of sperm, we explored the expression and localization of TOM20 in the sperms of a patient from the pedigree 1. Immunofluorescence staining using alpha-tubulin antibodies and TOM20 antibodies showed that TOM20 was specifically expressed in the sperm midpiece in control samples, while in the patient’s sperm, its expression was markedly reduced or absent, indicating significant mitochondrial sheath disruption. This finding suggests that CFAP43 mutations may impair mitochondrial distribution and organization in sperm, contributing to impaired motility (Figure 2d).

Novel splicing mutation leads to exon skipping in CFAP43 or frameshift

In this study, we identified a novel mutation, c.1859_1860+8delinsGT, in the CFAP43 gene. In silico analysis suggested that this variant may disrupt normal RNA splicing. To investigate the effects of this mutation, we designed upstream and downstream primers targeting exons 13 and 16, respectively. Sperm-derived cDNA samples were subjected to RT-PCR amplification. Sequencing of the PCR products revealed two potential splicing variants resulting from the mutation (Figure 3a). The first variant involved the complete deletion of exon 14, leading to the absence of this exon in the mature transcript. The second variant exhibited the last two alanine deletion at the 3’ end of exon 14; this deletion caused a frameshift mutation, potentially altering the downstream amino acid sequence and affecting the protein’s function (Figure 3b and 3c). Figure 3d shows details of the frameshift variation caused by the CFAP43 mutation shown in panel 2 in Figure 3c. These findings suggest that the c.1859_1860+8delinsGT mutation in the CFAP43 gene disrupts normal splicing mechanisms, resulting in aberrant transcript isoforms that may have contributed to the observed phenotypic consequences in the patient.

Figure 3.

Figure 3

Validation of CFAP43 mutation impact on splicing. (a) PCR gel electrophoresis image demonstrates PCR products amplified from control (CON) and patient-derived mutant (P) CFAP43 transcripts. The altered band pattern in the mutant sample suggests aberrant splicing events induced by the CFAP43 mutation. M: maker. (b) Schematic diagram of CFAP43 gene structure affecting splicing variants on mRNA splicing. Exons are depicted as boxes and introns as lines. The black line at the end of exon 14 marks the two missing alanine locations, which resulted in a frameshift. The deletion of exon 14 resulting from the mutation is also illustrated. (c) Sequencing chromatogram of PCR products corresponds to the excised PCR bands from the gel in a. The sequencing results confirm the presence of abnormal splicing products in the mutant sample from the patient, with the altered sequence clearly visible compared with the wild-type control. A: The sequencing chromatogram of the normal control; B: the last two alanine deletions at the 3’ end of exon 14 in the patient’s sample, causing a frameshift mutation; and C: the complete deletion of exon 14 in the patient’s sample, leading to the absence of this exon in the mature transcript. (d) Detailed sequence alignment of the frameshift mutation. The mutation induced a frameshift, leading to a premature stop codon. CFAP43: cilia- and flagella-associated protein 43; bp: base pair; PCR: polymerase chain reaction.

Bioinformatics analysis of the CFAP43 mutations and their impact

We then performed a bioinformatics analysis, including genomic localization, structural effects, and functional consequences, of the CFAP43 mutations. CFAP43 is located on chromosome 10q25.1, and the two identified mutations, c.3071A>G (p.N1024S) and c.1859_1860+8delinsGT, are situated in exon 24 and intron, respectively. We found that the latter mutation affects RNA splicing, and the potential effect of the former mutation on protein structure and function is also investigated. The p.N1024S mutation resulted in amino acid changes within the coiled-coil domain of CFAP43, which may be essential for protein–protein interactions and structural stability (Figure 4a). Conservation analysis demonstrated that the affected residue Asn1024 is highly conserved across species, including humans, mice, and gorillas, highlighting its functional importance (Figure 4b). To further evaluate the structural impact, PyMOL simulations were performed to compare the wild-type and mutant CFAP43 protein structures. The results indicated that the p.N1024S mutation leads to the loss of two hydrogen bonds between Asn1024 and Phe908 (Figure 4c), potentially destabilizing the local protein structure and impairing CFAP43 function. These findings suggest that the compound heterozygous mutations in CFAP43 likely compromise its structural integrity and function, providing a molecular basis for further investigation into their phenotypic consequences.

Figure 4.

Figure 4

Genetic analysis of the CFAP43 mutations. (a) The location of CFAP43 on the chromosome, the gene and protein structure have shown the mutations found in the patient. The vertical bars indicate exons, and slashed lines represent introns. CFAP43 protein comprises two domains: the WD (tryptophan-aspartic acid [W-D]) repeat domain and coiled-coil domain. (b) Conservation analysis of amino acid changes across species shows that two mutation sites are located in highly conserved protein domains. (c) Protein conformation prediction of the CFAP43 mutation. The pink shows the mutant amino acid, the blue shows the amino acid with hydrogen bond, the red dashed lines represent the hydrogen bond, and the red arrows indicate the changed hydrogen bonds. CFAP43: cilia- and flagella-associated protein 43; chr: chromosome.

Successful ICSI outcome in the patient with novel CFAP43 mutations

The patient with CFAP43 compound heterozygous mutations obtained a positive reproductive outcome through ICSI. One ICSI cycle was performed, retrieving 27 oocytes, with 20 at the M2 stage (Supplementary Table 5). Motile sperm with normal morphology was injected into oocytes; 17 oocytes were successfully fertilized (with two pronuclei [2PN]), and three viable embryos were cultured on the third day of embryonic development. Following the transfer of two embryos, a singleton pregnancy was achieved, culminating in a live birth. Figure 5 provides time-lapse imaging of the embryos, illustrating the dynamic developmental progression and morphological characteristics of the embryos during the early stages of development. This case highlights the potential for successful ICSI outcomes in patients with CFAP43 mutations.

Supplementary Table 5.

In vitro fertilization outcomes of patient

Characteristics Patient
Female age (year) 29
Cycles (n) 1
Oocyte retrieved (n) 27
MII oocytes (n) 20
2PN (n) 17
Available embryos on day 3 (n) 3
Transferred embryos (n) 2
Clinical pregnancy Yes
Live birth 1

2PN: two pronuclei

Figure 5.

Figure 5

Different stages of embryo development captured with a time-lapse system. The images were captured using an EmbryoScope TLS incubator (Vitrolife, Göteborg, Sweden) at different stages of the embryo’s development post-injection. Scale bar = 50 µm.

DISCUSSION

In this study, we reported a male infertility family with MMAF caused by novel compound heterozygous mutations in the CFAP43 gene. The patient exhibited abnormal semen parameters, including reduced sperm motility and severe morphological defects in sperm flagella. Molecular investigations confirmed that one of the CFAP43 mutations disrupted RNA splicing, which likely contributed to the pathogenic mechanism. The mitochondrial protein TOM20 exhibited diminished immunofluorescence signals, pointing to possible mitochondrial dysfunction. TEM further demonstrated partial absence and disorganization of the mitochondrial sheath, as well as the absence of central microtubules in the “9+2” axonemal structure. Despite these severe defects, the patient successfully achieved fatherhood through ICSI, highlighting the potential of ART in overcoming genetic causes of male infertility.

MMAF was proposed in 2014 and has attracted increasing attention, though its underlying mechanisms remain incompletely understood.21 CFAP43 encodes a flagellar structural protein that is crucial for sperm function. The reported patient with novel compound heterozygous variants presented with MMAF features, including short, absent, curly, and irregular caliber flagella, which is consistent with the phenotypic profile described in other CFAP43-related cases.1,7 In a previous study, male mice with Cfap43 knockout were sterile, with 100.0% immobile sperm and abnormal morphology, which mirrored the human MMAF phenotype.2 Another study has indicated that CFAP43 deficiency resulted in the failure to transport key structural proteins to the flagellum assembly site via intra-manchette transport (IMT), which participates in sperm head morphogenesis.22 In this study, we demonstrated that c.1859_1860+8delinsGT mutation disrupted RNA splicing and that p.N1024S mutation likely affected the three-dimensional structure of the protein, which led to CFAP43 dysfunction. These findings provide mechanistic insight into how CFAP43 mutations contribute to sperm morphological defects in patients with MMAF.

As a key mitochondrial outer membrane protein, TOM20 plays crucial roles in energy metabolism related to sperm flagellar motility. Sperm individuals with sperm flagellar protein 2 (SPEF2) mutations exhibited significantly reduced TOM20 expression levels, suggesting potential impairment of mitochondrial protein import mechanisms.23 Since mitochondria are the primary energy source for sperm motility, their dysfunction directly compromises adenosine triphosphate (ATP) supply, which is essential for flagellar movement. A recent study revealed that in a mouse model of asthenozoospermia caused by chorein defect, abnormal TOM20 levels were accompanied by mitochondrial morphological disruption and functional abnormalities, further supporting the need for mitochondrial integrity for sperm viability.24 Moreover, accumulation of TOM20 and phosphorylated PTEN-induced putative kinase 1 (PINK1) in autophagy-inhibited models correlated with reduced sperm motility, indicating that mitophagy dysregulation may indirectly impair flagellar movement by compromising mitochondrial homeostasis.25 Collectively, the findings from these studies suggest that altered TOM20 expression likely affects structural stability and the power supply for sperm flagella through mitochondrial functional regulation, ultimately contributing to asthenozoospermia. Reduced TOM20 expression and mitochondrial sheath ultrastructural abnormalities in our patient’s sperm suggest that CFAP43 mutations impair mitochondrial organization and function, ultimately leading to reduced sperm motility owing to disrupted energy production. Additionally, the absence of central microtubules in the “9+2” structure, as shown by TEM, is consistent with previous reports of axonemal defects in patients with MMAF. These structural abnormalities likely underlie the severe motility defects observed in our patient’s sperm. Taken together, these findings provide new insights into the pathogenesis of MMAF and emphasize the critical role of CFAP43 in the structural integrity and function of sperm flagella.

In conclusion, our study highlights the importance of CFAP43 in the formation and function of sperm flagella, expanding the spectrum of gene mutations associated with MMAF. This study also provides new insights that abnormal RNA splicing caused by CFAP43 mutation may affect sperm flagella morphology and motility by disrupting the “9+2” structure and TOM20 expression in the mitochondrial sheath. However, the pathogenic evidence for the identified point mutation in this family remains limited, necessitating future mechanistic studies to validate its functional effect. The successful use of ICSI in this case indicates the potential of ART in overcoming genetic causes of male infertility. However, while ICSI offers a valuable option for achieving biological fatherhood, it is crucial to address its associated risks. In the context of genetically determined infertility, the potential transmission of pathogenic mutations to the offspring and the long-term implications of such inheritance should not be overlooked. This study further emphasizes the importance of genetic testing in male infertility, particularly in MMAF cases. Future studies should focus on elucidating the molecular mechanisms by which CFAP43 mutations lead to MMAF and exploring potential therapeutic strategies to improve sperm quality in affected individuals.

AUTHOR CONTRIBUTIONS

SQ and JZS designed the research. SQ, QC, and JY recruited subjects and sorted clinical information. JY, SJS, and MY performed WES and Sanger sequencing. QC, SJS, and SCW performed experiments. QC, HR, and YX contributed to bioinformatic analyses. QC wrote the manuscript. SQ, JZS, QC, JY, XZJ, and HC modified the manuscript. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests.

ACKNOWLEDGMENTS

We are grateful to all the patients, their families, and healthy controls for their participation in this study. This work was supported by Shaanxi Province Health and Wellness Reproductive Medicine Research Innovation Team (No. 2023TD-04), Key Industrial Chain Initiative of Shaanxi Province - Research on Advanced Technologies in Assisted Reproductive Technology and Development of a Precision Genetic Disease Prevention System Prior to Pregnancy (No. 2023-ZDLSF-48), Fundamental Research Funds for the Central Universities (xzy012023127), and Nature Science Foundation of Shaanxi Province (2024JC-YBMS-644).

Supplementary Information is linked to the online version of the paper on the Asian Journal of Andrology website.

REFERENCES

  • 1.Tang S, Wang X, Li W, Yang X, Li Z, et al. Biallelic mutations in CFAP43 and CFAP44 cause male infertility with multiple morphological abnormalities of the sperm flagella. Am J Hum Genet. 2017;100:854–64. doi: 10.1016/j.ajhg.2017.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Coutton C, Vargas AS, Amiri-Yekta A, Kherraf ZE, Ben Mustapha SF, et al. Mutations in CFAP43 and CFAP44 cause male infertility and flagellum defects in Trypanosoma and human. Nat Commun. 2018;9:686. doi: 10.1038/s41467-017-02792-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chemes HE, Brugo S, Zanchetti F, Carrere C, Lavieri JC. Dysplasia of the fibrous sheath:an ultrastructural defect of human spermatozoa associated with sperm immotility and primary sterility. Fertil Steril. 1987;48:664–9. doi: 10.1016/s0015-0282(16)59482-5. [DOI] [PubMed] [Google Scholar]
  • 4.Rawe VY, Galaverna GD, Acosta AA, Olmedo SB, Chemes HE. Incidence of tail structure distortions associated with dysplasia of the fibrous sheath in human spermatozoa. Hum Reprod. 2001;16:879–86. doi: 10.1093/humrep/16.5.879. [DOI] [PubMed] [Google Scholar]
  • 5.Sha YW, Wang X, Su ZY, Mei LB, Ji ZY, et al. Patients with multiple morphological abnormalities of the sperm flagella harbouring CFAP44 or CFAP43 mutations have a good pregnancy outcome following intracytoplasmic sperm injection. Andrologia. 2019;51:e13151. doi: 10.1111/and.13151. [DOI] [PubMed] [Google Scholar]
  • 6.Barthelemy C, Tharanne MJ, Lebos C, Lecomte P, Lansac J. Tail stump spermatozoa:morphogenesis of the defect. An ultrastructural study of sperm and testicular biopsy. Andrologia. 1990;22:417–25. doi: 10.1111/j.1439-0272.1990.tb02020.x. [DOI] [PubMed] [Google Scholar]
  • 7.Nsota Mbango JF, Coutton C, Arnoult C, Ray PF, Touré A. Genetic causes of male infertility:snapshot on morphological abnormalities of the sperm flagellum. Basic Clin Androl. 2019;29:2. doi: 10.1186/s12610-019-0083-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ma J, Long SH, Yu HB, Xiang YZ, Tang XR, et al. Patients with MMAF induced by novel biallelic CFAP43 mutations have good fertility outcomes after intracytoplasmic sperm injection. Asian J Androl. 2023;25:564–71. doi: 10.4103/aja2022118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dong FN, Amiri-Yekta A, Martinez G, Saut A, Tek J, et al. Absence of CFAP69 causes male infertility due to multiple morphological abnormalities of the flagella in human and mouse. Am J Hum Genet. 2018;102:636–48. doi: 10.1016/j.ajhg.2018.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lorès P, Coutton C, El Khouri E, Stouvenel L, Givelet M, et al. Homozygous missense mutation L673P in adenylate kinase 7 (AK7) leads to primary male infertility and multiple morphological anomalies of the flagella but not to primary ciliary dyskinesia. Hum Mol Genet. 2018;27:1196–211. doi: 10.1093/hmg/ddy034. [DOI] [PubMed] [Google Scholar]
  • 11.Turner RM, Musse MP, Mandal A, Klotz K, Jayes FC, et al. Molecular genetic analysis of two human sperm fibrous sheath proteins, AKAP4 and AKAP3, in men with dysplasia of the fibrous sheath. J Androl. 2001;22:302–15. [PubMed] [Google Scholar]
  • 12.Huang T, Yin Y, Liu C, Li M, Yu X, et al. Absence of murine CFAP61 causes male infertility due to multiple morphological abnormalities of the flagella. Sci Bull. 2020;65:854–64. doi: 10.1016/j.scib.2020.01.023. [DOI] [PubMed] [Google Scholar]
  • 13.Lu S, Gu Y, Wu Y, Yang S, Li C, et al. Bi-allelic variants in human WDR63 cause male infertility via abnormal inner dynein arms assembly. Cell Discov. 2021;7:110. doi: 10.1038/s41421-021-00327-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Shen Y, Zhang F, Li F, Jiang X, Yang Y, et al. Loss-of-function mutations in QRICH2 cause male infertility with multiple morphological abnormalities of the sperm flagella. Nat Commun. 2019;10:433. doi: 10.1038/s41467-018-08182-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Liu M, Dai S, Zhang J, Yang Y, Shen Y, et al. A novel mutation in CFAP47 causes male infertility due to multiple morphological abnormalities of the sperm flagella. Front Endocrinol. 2023;14:1155639. doi: 10.3389/fendo.2023.1155639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Khan I, Shah B, Dil S, Ullah N, Zhou JT, et al. Novel biallelic loss-of-function mutations in CFAP43 cause multiple morphological abnormalities of the sperm flagellum in Pakistani families. Asian J Androl. 2021;23:627–32. doi: 10.4103/aja.aja_26_21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.He X, Li W, Wu H, Lv M, Liu W, et al. Novel homozygous CFAP69 mutations in humans and mice cause severe asthenoteratospermia with multiple morphological abnormalities of the sperm flagella. J Med Genet. 2019;56:96–103. doi: 10.1136/jmedgenet-2018-105486. [DOI] [PubMed] [Google Scholar]
  • 18.Zhou Z, Qi Q, Wang WH, Dong J, Xu JJ, et al. A novel homozygous mutation of CFAP300 identified in a Chinese patient with primary ciliary dyskinesia and infertility. Asian J Androl. 2025;27:113–9. doi: 10.4103/aja202477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sha YW, Wang X, Xu X, Su ZY, Cui Y, et al. Novel mutations in CFAP44 and CFAP43 cause multiple morphological abnormalities of the sperm flagella (MMAF) Reprod Sci. 2019;26:26–34. doi: 10.1177/1933719117749756. [DOI] [PubMed] [Google Scholar]
  • 20.World Health Organization. WHO Laboratory Manual for the Examination and Processing of Human Semen. 6th ed. Geneva: World Health Organization; 2021. [Google Scholar]
  • 21.Wang WL, Tu CF, Tan YQ. Insight on multiple morphological abnormalities of sperm flagella in male infertility:what is new? Asian J Androl. 2020;22:236–45. doi: 10.4103/aja.aja_53_19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yu Y, Wang J, Zhou L, Li H, Zheng B, et al. CFAP43-mediated intra-manchette transport is required for sperm head shaping and flagella formation. Zygote. 2020;29:75–81. doi: 10.1017/S0967199420000556. [DOI] [PubMed] [Google Scholar]
  • 23.Li DY, Yang XX, Tu CF, Wang WL, Meng LL, et al. Sperm flagellar 2 (SPEF2) is essential for sperm flagellar assembly in humans. Asian J Androl. 2022;24:359–66. doi: 10.4103/aja202154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rotimi DE, Iyobhebhe M, Oluwayemi ET, Evbuomwan IO, Asaleye RM, et al. Mitophagy and spermatogenesis:role and mechanisms. Biochem Biophys Rep. 2024;38:101698. doi: 10.1016/j.bbrep.2024.101698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Arai K, Nishizawa Y, Nagata O, Sakimoto H, Sasaki N, et al. The role of chorein deficiency in late spermatogenesis. Biomedicines. 2024;12:240. doi: 10.3390/biomedicines12010240. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Asian Journal of Andrology are provided here courtesy of Editorial Office of AJA.

RESOURCES