SPACA4 regulates the structure and molecular basis of spermatid maturation and ultimately affects sperm quality in mice

Abstract

Sperm quality is crucial for sperm function and can even affect embryo quality and offspring health. Spermatid maturation is extremely complex, as spermatids undergo morphological changes, laying the foundation for the execution of sperm function. The function of sperm acrosome-associated 4 (SPACA4) in spermatogenesis is not well known. The present study revealed that SPACA4 was specifically expressed in the acrosomes and cytoplasm of mouse spermatids. Spaca4 knockout mice demonstrated that the loss of SPACA4 led to male subfertility. The quality of mature sperm was abnormal in Spaca4^−/− mice, manifested by decreased motility and multiple deformities. Spaca4^-/- sperm exhibited irregular nuclear shapes, abnormal nuclei with vacuoles, missing or incompletely fused acrosomes, and multiple cross-sections enclosed in the same sperm cell membrane. Electron microscopy and molecular expression analyses of testicles revealed that the loss of SPACA4 affected the differentiation of the acrosome, acroplaxome, and manchette, resulting in abnormalities in nuclear elongation, chromatin condensation, and flagellar development. Interestingly, SPACA4 did not regulate spermiogenesis via the acetylcholine signaling pathway. Analysis of the differential protein expression profile revealed that the expression of 9 proteins was significantly decreased in Spaca4^−/− spermatids. A decreased protein, transformation-related protein 53 target 5 (TRP53TG5), was knocked down in spermatids and found that the phenotype was consistent with Spaca4 knockout mice. These results revealed that the absence of SPACA4 leads to abnormal spermatid maturation and affects sperm quality in mice. Abnormal sperm quality in Spaca4^−/− mice results in decreased sperm capacitation and a decreased acrosome response, ultimately affecting the fertility of male mice.

INTRODUCTION

Infertility is a growing health problem that affects 70 million people worldwide.1,2 Sperm are the ultimate executors of male fertility, and a sufficient quantity and high quality of sperm are fundamental guarantees of male fertility.3,4 Clinically, male infertility patients, in addition to azoospermia and/or severe oligospermia, often present with asthenospermia and/or teratospermia. In patients with asthenospermia and/or teratospermia, the spem count is not reduced but the sperm shows decreased quality and dysfunction.5,6 Assisted reproductive technology (ART) is becoming more widely used to help infertile male patients give birth to offspring without the need for a natural conception process.7,8 However, sperm quality affects the fertilization rate, pregnancy outcome, and health of offspring, including decreased blastocyst rate, decreased embryo implantation rate, and increased risk of birth defects.9,10,11,12

Spermatogenesis is a complex process of cell division and differentiation. The spermatogenic cycle begins with spermatogonial stem cells (SSCs) maintaining self-renewal through mitosis, while some SSCs continue to differentiate into spermatocytes. The spermatocytes produce haploid spermatids through meiosis, after which the spermatids undergo dramatic characteristic changes to form sperm. The sperm are transported to the epididymis to develop into fertile mature sperm.13,14,15 In the process of spermatid maturation, round spermatids undergo substantial structural and functional alterations, representing the most critical and direct biological processes that affect sperm morphology and quality.16,17 Spermatid maturation involves multiple steps, including nuclear elongation and condensation, acrosome development, mitochondrial remodeling, and central microtubule assembly.18,19,20 At present, little is known about the molecular regulatory mechanism of spermatid maturation. Revealing and explaining the key molecules will help to further clarify the regulatory mechanism of spermiogenesis and may provide certain ideas for the evaluation and improvement of clinical ART outcomes.

To this end, we constructed protein profiles of mouse spermatids (unpublished data) to elucidate the molecular networks involved in spermatid maturation. We focused on sperm acrosome-associated 4 (SPACA4), a testicle-specific protein that belongs to the Ly6/urokinase-type plasminogen activator receptor (Ly6/uPAR) family. The Ly6/uPAR family members, which are highly conserved across species, are usually associated with cell differentiation and play important roles in different physiological or pathological processes.21,22 In the Ly6/uPAR family, five members (acrosomal vesicle protein 1 [ACRV1], lymphocyte antigen 6 family member K [LY6K], LY6/PLAUR domain containing 4 [LYPD4], testis expressed 101 [TEX101], and SPACA4) are specifically expressed in testicular tissue. Previous studies have reported that ACRV1, LY6K, LYPD4, and TEX101 are involved in sperm-specific functions, such as zona pellucida penetration, sperm-oocyte interactions, and spermatozoa migration into the oviduct.23,24,25,26 Fujihara et al.27 reported that the absence of SPACA4 affects the fertility of male mice and influences zona pellucida penetration. A recent clinical study has reported that incubating human sperm with an SPACA4 antibody inhibits the binding of sperm and the zona pellucida,28 further demonstrating that SPACA4 is involved in sperm function and may affect male fertility.

However, we identified SPACA4 in round spermatids and elongated spermatids in mouse testes, indicating that it not only plays a role in sperm function but is also likely to participate in spermatid maturation. Ly6/uPAR contains an Ly6/uPAR (LU) domain composed of 60–90 amino acids,29 and it regulates protein receptors, such as nicotinic acetylcholine receptors (nAChRs), muscarinic acetylcholine receptors (mAChRs), and acetylcholinesterase (AChEs).30 Ly6/uPAR is involved in several biological processes by regulating the function of cholinergic receptors, especially nAChRs.29,31,32 Whether SPACA4, as a Ly6/uPAR family member, regulates nAChRs and the acetylcholine signaling pathway remains to be verified. Therefore, the present study explored the function and molecular mechanism of SPACA4 in spermatid maturation.

MATERIALS AND METHODS

Mouse model and genotype identification

The mouse Spaca4 gene (NC_000073.7) has one transcript and is located on chromosome 7. The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) technique was used to generate Spaca4 knockout mice on a C57BL/6NJ background.33 The animals were kept in a specific pathogen-free environment (12 h light/12 h dark cycle, constant temperature at 22°C, constant humidity of 45%, and sufficient water and food) at the Animal Core Facility of Nanjing Medical University (Nanjing, China). All animal study protocols and disclosure of data covered in this article were approved by the Institutional Animal Care and Use Committee of Nanjing Medical University (Approval No. 1809030).

DNA was extracted from the toes with 50 mmol l⁻¹ NaOH. Polymerase chain reaction (PCR) amplification was performed with genotyping primers (Supplementary Table 1), and the products were run on a 2% (w/v) agarose gel.

Supplementary Table 1.

The forward primer sequence and reverse primer sequence of each gene

Gene name	Primer sequences (5’–3’)
Spaca4-genotyping	AGGACTGAAGAGCTTCTGAA
	GTGGTGAGACTGTATGTGAG
Gapdh	ACCCTTAAGAGGGATGCTGC
	CCCAATACGGCCAAATCCGT
Akt	CCGCCTGATCAAGTTCTCCT
	AGAGGGAGAGGGCCAGTTAG
Stat3	AGGACATCAGTGGCAAGACC
	AACTTGGTCTTCAGGTACGGG
Pi3k	GGGGAGACATCTCAAGGGAAGAA
	TGACAACTTGATCCTGCTGGT
Jak2	GTGTCGCCGGCCAATGT
	CCTGATTCGCTTCCGGGTTA
Sirt1	TCGGCTACCGAGGTCCATA
	CCGCAAGGCGAGCATAGATA

Complementary DNA (cDNA) synthesis and quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from tissues via TRIzol reagent (15596-026; Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. In accordance with the concentration of RNA, total RNA (1 μg) was reverse transcribed into cDNA with HiScript II Q RT SuperMix (R232-01; Vazyme, Nanjing, China). qRT-PCR analysis of cDNA was performed using ChamQ Blue Universal SYBR qPCR Master Mix (Q312-02; Vazyme) and an Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The sequences of primers used for these experiments are listed in Supplementary Table 1. The reference gene for data normalization was glyceraldehyde-3-phosphate dehydrogenase (Gapdh).

Fertility analysis

Knockout male mice and wild-type male mice (8–10 weeks old) in the same litter were mated with fertile C57BL/6NJ female mice for 5–6 months. The vaginal plugs, pregnancies, and litter dates of the females were monitored. The average litter size from each pregnant female was calculated.

Morphological and histological analyses

Spaca4 knockout mice and wild-type littermates were subjected to gross morphological analyses, including body weight, testis weight, epididymis weight, and appearance of the testes and epididymides. Testes and epididymides were fixed with modified Davidson’s fluid for 48 h,34 dehydrated with gradient alcohol, hyalinized in xylene, and embedded in paraffin. The whole tissue was sectioned (5 -µm thickness) consecutively and collected on slides. The sections were placed in a 65°C incubator (DNP-9052BS; CIMO, Shanghai, China) for 2 h, dewaxed with xylene, and hydrated with gradient alcohol. Testis sections were stained with periodic acid-Schiff (PAS; G1281; Solarbio, Beijing, China), whereas epididymis sections were stained with hematoxylin (G1004, Servicebio, Wuhan, China) and eosin (G1002; Servicebio).35

For sperm morphology analysis, sperm from testis suspensions, the caput epididymis, the corpus epididymis, and the cauda epididymis were applied to slides after washing three times in phosphate-buffered saline (PBS). After drying naturally, the sperm were fixed with 4% (w/v) paraformaldehyde (PFA) and subjected to hematoxylin and eosin staining (H&E). At least 200 sperm were analyzed per sample.

Immunohistochemistry and immunofluorescence staining

In accordance with our previously published protocols,36 dewaxed and rehydrated tissue sections were heated in 0.1 mol l⁻¹ citric acid buffer for 10 min for heat-induced antigen repair. After three washes with PBS, the sections were blocked in 1% (w/v) bovine serum albumin (BSA; V900933; Sigma-Aldrich, St. Louis, MO, USA) for 2 h and then incubated overnight at 4°C with primary antibodies. The sections were then incubated with horseradish peroxidase (HRP) or fluorescently coupled secondary antibodies for 1 h at room temperature. For immunohistochemistry, positive immunostaining was developed using a DAB kit (ZLI9018; ZSGB-BIO, Beijing, China) and observed under a microscope (Nikon, Tokyo, Japan). The immunofluorescence slides were viewed with confocal microscopy (Zeiss, Oberkochen, Germany). The antibodies used are listed in Supplementary Table 2.

Supplementary Table 2.

Primary and secondary antibodies and their applications in this study

Designation	Source or reference	Identifiers
GAPDH	Proteintech, Chicago, IL, USA	60004-1-Ig
Rabbit IgG	Proteintech, Chicago, IL, USA	30000-0-AP
Mouse-HRP	Proteintech, Chicago, IL, USA	SA00001-1
Rabbit-HRP	Proteintech, Chicago, IL, USA	SA00001-2
Rabbit-488	Proteintech, Chicago, IL, USA	SA00013-2
Mouse-555	Proteintech, Chicago, IL, USA	RGAM003
Hoechst 33342	Thermo Fisher Scientific, Waltham, MA, USA	H1399
PNA-FITC	Sigma-Aldrich, St. Louis, MO, USA	L7381
SPACA4	Abcam, Cambridge, UK	ab122758
SPACA4	Made in Abclonal, Wuhan, China
AGFG1	Abclonal, Wuhan, China	A13500
VAMP4	Santa Cruz, Dallas, Texas, USA	sc-365332
Keratin5	Affinity Biosciences, Cincinnati, Ohio, USA	AF5479
TNP1	Proteintech, Chicago, IL, USA	17178-1-AP
CLIP170	GeneTex, Irvine, CA, USA	GTX85030
IFT88	Proteintech, Chicago, IL, USA	13967-1-AP
α7nAChR	Santa Cruz, Dallas, Texas, USA	sc-58607

Count spermatogenic cells

Testicular tissue was stained with PAS, and the stages of spermatogenesis were identified according to the order of spermatogenic cells.37 The spermatogenic cells in stages VII–VIII and XI with better lumen morphology were counted. The pachytene spermatocytes, preleptotene spermatocytes, and round spermatids in stages VII–VIII were counted. The zygotene spermatocytes, diplotene spermatocytes, and elongated spermatids in stage XI were counted.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assays

The testis sections were evaluated via TUNEL assay (A113-01; Vazyme) according to the manufacturer’s specifications. Briefly, standard techniques (xylene, anhydrous ethanol, 90% [v/v] ethanol, 80% [v/v] ethanol, 70% [v/v] ethanol, and sterile water) were used to dewax and hydrate testicular sections. The sections were equilibrated with terminal deoxynucleotidyl transferase (TdT) buffer for 10 min, and the sections were incubated with the terminal transferase reaction mixture for 1 h at 37°C. All spermatogenesis tubules were analyzed using confocal microscopy (Zeiss). The nuclei of TUNEL-positive cells were indicated by red fluorescence.

Computer-assisted sperm analysis (CASA)

The sperm were collected from the cauda epididymis and subsequently incubated in prewarmed human tubal fluid (HTF) culture medium (M1130; AibeiBio, Nanjing, China) maintained at 37°C for 5 min. The sperm suspension was lightly mixed with a wide-bore pipette, and the sperm count and motility were measured using CASA (Hamilton Thorne, Beverly, MA, USA).

Protein extraction and western blot analysis

Proteins from testes were extracted using radio immunoprecipitation assay (RIPA) lysis buffer (P0013C; Beyotime, Shanghai, China) containing 1% (v/v) protease inhibitor cocktail (B14001; Bimake, Houston, TX, USA). After 30 min of centrifugation at 12 000g (75002407; Thermo Fisher Scientific), the supernatant was collected, and the protein concentration was determined using a BCA protein assay kit (P0010; Beyotime) according to the manufacturer’s protocol. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (WB2001; New Cell & Molecular Biotech, Suzhou, China) was added to the protein samples, which were boiled at 95°C for 5 min. Proteins were electrophoresed on SDS-PAGE gels (P2014; New Cell & Molecular Biotech) and transferred to nitrocellulose membranes (1620177; Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% (w/v) nonfat dry milk (P0216; Beyotime) for 2 h at room temperature and incubated with primary antibodies overnight at 4°C, followed by incubation with HRP-conjugated secondary antibodies and detection using a Tanon 5200 chemiluminescence imaging system (Tanon, Shanghai, China). The antibodies used in this study are listed in Supplementary Table 2.

Transmission electron microscopy

Testis tissue was dissected into small chunks with a blade and immediately immersed in ice-cold 2.5% (v/v) glutaraldehyde for primary fixation at 4°C. The sperm suspensions were pelleted by centrifugation at 1000g for 5 min (75002407; Thermo Fisher Scientific), washed three times with PBS (pH 7.2), and fixed in fresh 2.5% (v/v) glutaraldehyde. Following primary fixation, the samples were rinsed with 0.1 mol l⁻¹ cacodylate buffer (97068; Sigma-Aldrich), fixed with 2% (w/v) osmium tetroxide (OsO₄; 201030; Sigma-Aldrich) for 2 h, and embedded in araldite (10951; Sigma-Aldrich). Images of ultrathin sections, which were stained with uranyl acetate (U25690; Acmec Biochemical Technology Co., Ltd., Shanghai, China) and lead citrate (L26640; Acmec Biochemical Technology Co., Ltd.), were acquired using a Tecnai G2 electron microscope (FEI, Hillsboro, OR, USA).

Spermatid isolation and mass spectrometry analysis

Spermatids were isolated and collected from adult mouse testes (one mouse as a sample) by the STA-PUT velocity sedimentation method.38 In brief, the testes were collected in ice-cold PBS, and the tunica albuginea was carefully removed. Collagenase IV (1 g l⁻¹; 17104019; Invitrogen) was used to digest the tissues for 15 min at 37°C. The tissues were then placed on ice for 5 min to extract the supernatant. All seminiferous tubules were subsequently digested with 0.25% (w/v) trypsin containing DNase I (1 g l⁻¹; B002004; Sangon-Biotech, Shanghai, China) at 37°C. A pipette gun was used to blow the tissue repeatedly until all lumens were digested within 10 min. A single-cell suspension was prepared with a 40 μm nylon filter and further loaded above a 2%–4% (w/v) BSA gradient (ProScience, Inc., Toronto, Canada). After 2 h of precipitation, the components were slowly collected from the bottom. Spermatid purity was determined by specific peanut agglutinin (PNA, marked acrosome; L7381; Sigma-Aldrich) and Hoechst (marked nucleus; H1399; Thermo Fisher Scientific) staining. At least 200 cells were analyzed by a LSM800 confocal microscope (Zeiss), and the proportion of PNA-positive cells was determined to be at least 80%.

For mass spectrometry (MS), proteins in spermatids were extracted with protein extraction buffer (8 mol l⁻¹ urea; 75 mmol l⁻¹ NaCl; 50 mmol l⁻¹ Tris, pH 8.2; and 1% [v/v] ethylenediaminetetraacetic acid-free [EDTA-free] protease and phosphatase inhibitor [A32961; Thermo Fisher Scientific]), after which the proteins were reduced, alkylated, digested overnight with trypsin at 37°C, and labeled with tandem mass tag (TMT). The labeled peptides were then separated by a high-pH reversed-phase separation microcapillary column (ACQUITY BEH C18 Column; 186009259; Waters Corporation, Milford, MA, USA) and analyzed using an Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific) coupled with an EASY-nLC 1200 System (Thermo Fisher Scientific).

Intratesticular injection

The small interfering RNAs (siRNAs) were diluted to a final concentration of 20 µmol l⁻¹ and mixed with 0.1% (w/v) Fast Green (A610452; Sangon-Biotech). Each mouse was anesthetized with 1.25% (w/v) tribromoethanol (M2920; AibeiBio, Nanjing, China). The abdomen was cleaned and disinfected, and a small incision was made. The testicles were removed from the abdomen, and the efferent ductules were identified using a stereomicroscope (SMZ1000; Nikon) and injected with siRNA. After the injection was completed, the testes were returned to their physiological position, and the abdomen was sutured. Control testes were injected with negative control RNA. The following siRNA sequences were used: Trp53tg5-siRNA-sense, 5’-GGCAGAGUCCGUAAAGGAA(dT)(dT)-3’; and Trp53tg5-siRNA-antisense, 5’-UUCCUUUACGGACUCUGCC(dT)(dT)-3’.

Statistical analyses

All experiments included at least three biological replicates. The data were compared for statistical significance using GraphPad software (GraphPad, San Diego, CA, USA). Unpaired, two-tailed Student’s t-test was used for statistical analysis between two groups, and one-way analysis of variance (ANOVA) was used for analysis among three or more groups. All data represent mean ± standard deviation (s.d.), and statistically significant differences are represented as P < 0.05.

RESULTS

SPACA4 is specifically expressed in the acrosome and cytoplasm of spermatids in mouse testes

SPACA4 expression in multiple mouse tissues, including the heart, liver, spleen, lung, kidney, brain, muscle, and testis, was detected by western blot analysis with specific antibodies. SPACA4 was expressed in the testis (Figure 1a). Analysis of SPACA4 abundance in mouse testes of different ages after birth revealed that SPACA4 was weakly expressed from 2 weeks and increased with the first wave of spermatid maturation and was maintained into adulthood (Figure 1b). Further immunohistochemical tests revealed that SPACA4 expression was detected mainly in the acrosome and weakly in the cytoplasm of testicular spermatids (Figure 1c). The expression pattern of SPACA4 in mouse testes suggested that SPACA4 plays a potentially important role in mouse spermatid maturation.

Figure 1.

SPACA4 is specifically expressed in spermatids and is necessary for male fertility. (a) Western blot analysis of multiple tissues from adult mice revealed that the SPACA4 protein was expressed in the testis. (b) Western blot analysis of SPACA4 expression levels in the testes of mice at different postnatal weeks. (c) Expression patterns of SPACA4 during spermatogenesis were analyzed by immunohistochemistry. IgG was used as a control. Scale bar = 10 µm. (d) Schematic diagram of the targeting strategy involving CRISPR/Cas9. Sanger sequencing confirmed a 68-bp deletion in Spaca4 knockout mice (Spaca4^−/−). (e) The genotype of each Spaca4^−/− mouse was confirmed using PCR. (f) SPACA4 protein was completely absent in the testes of Spaca4^−/− mice. GAPDH was used as a loading control. (g) Litter size of adult Spaca4^+/+ and Spaca4^−/− mice (n=5). ^***P<0.001. Statistical significance was calculated using one-way ANOVA. SPACA4: sperm acrosome-associated 4; IgG: immunoglobulin G; CRISPR/Cas9: clustered regularly interspaced short palindromic repeats/ CRISPR-associated protein 9; sgRNA: single guide RNA; PCR: polymerase chain reaction; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; ANOVA: analysis of variance; bp: base pair.

Loss of SPACA4 decreases sperm quality and affects male fertility

To determine the role of SPACA4 in male fertility and spermatid maturation, CRISPR/Cas9 technology was used to knockout SPACA4 (Figure 1d). DNA and Sanger sequencing revealed that the deletion of 68 bp in Spaca4 knockout mice (Spaca4^−/−) caused frameshift mutations (Figure 1d and 1e). Furthermore, western blot analysis verified that SPACA4 was knocked out at the protein level in the testes (Figure 1f). The fertility of Spaca4^−/− mice was tested for 5-6 months, and wild-type littermates (Spaca4^+/+) were used as controls. Female Spaca4^−/− mice were fertile and exhibited litter sizes comparable to those of female Spaca4^+/+ mice. In contrast, fertility was severely impaired in Spaca4^−/− male mice (P < 0.001; Figure 1g). These results suggested that SPACA4 is required for male mouse fertility.

To explore the possible reasons for subfertility in Spaca4^−/− male mice, the sperm number was assessed. Morphological observations revealed that the weight and size of the epididymis (Figure 2a and 2b) were not significantly different between Spaca4^−/− and Spaca4^+/+ mice. The sperm count (Figure 2c) and sperm density in the epididymal duct (Figure 2d) were not significantly reduced in Spaca4^−/− mice. These results suggested that the absence of SPACA4 does not affect sperm production. The comparison of spermatogenic cell counts and apoptosis detection in testes between Spaca4^−/− and Spaca4^+/+ mice indirectly confirmed the above conclusion. Compared with Spaca4^+/+ mice, the numbers of spermatocytes, round spermatids, and elongated spermatids were not reduced in Spaca4^−/− mice (Figure 2e), and the proportions of apoptotic lumens and apoptotic cells were similar in these two groups (Figure 2f–2i).

Figure 2.

Loss of SPACA4 decreases sperm quality and affects male fertility. (a) Epididymal morphology and size of both Spaca4^+/+ and Spaca4^−/− mice (n=3). (b) Epididymis/body weight ratios of Spaca4^+/+ and Spaca4^−/− mice (n=3). (c) Sperm count in the caudal epididymis of Spaca4^+/+ and Spaca4^−/− mice (n=6). (d) H&E-stained cauda epididymides of Spaca4^+/+ and Spaca4^−/− mice (n=3). Scale bars=50 µm. (e) Statistical results for the number of spermatocytes, round spermatids and elongated spermatids per tubule (n=3). (f) Testicular tissue was subjected to TUNEL staining. The negative control resulted in no positive cells, whereas the positive control resulted in apoptotic cells after DNase I treatment. Scale bar = 20 µm. Blue: Hoechst; red: apoptotic cells. (g) TUNEL staining of Spaca4^+/+ and Spaca4^−/− testes. Scale bar = 50 µm. Blue: Hoechst; red: apoptotic cells. (h) Percentage of TUNEL-positive tubules (n=3). (i) Quantification statistics of TUNEL-positive cells per tubule (n = 3). (j) Computer-assisted sperm analysis of sperm motility from the cauda epididymis of Spaca4^+/+ and Spaca4^−/− mice (n=6). (k) Computer-assisted sperm analysis of sperm progressive motility in Spaca4^+/+ and Spaca4^−/− mice (n=6). (l) Representative images of sperm under a light microscope. Scale bars=20 µm. Black arrowhead: sperm with anomalous heads; red arrowhead: sperm with folded tails. (m) The percentage of head defects in Spaca4^+/+ and Spaca4^−/− sperm (n=6). (n) The percentage of folded tails in Spaca4^+/+ and Spaca4^−/− sperm (n=6). NS: not significant, ^**P<0.01, and ^***P<0.001. Statistical significance was calculated using two-tailed Student’s t-test. Spaca4: sperm acrosome-associated 4; H&E: hematoxylin and eosin; Pl: preleptotene spermatocytes; Z: zygotene spermatocytes; P: pachytene spermatocytes; D: diplotene spermatocytes; Rst: round spermatids; Est: elongated spermatids; TUNEL: terminal deoxynucleotidyl transferase dUTP nick end labeling.

We further assessed sperm quality in Spaca4^−/− mice. Evaluation by CASA revealed significantly decreased sperm motility and progressive motility in Spaca4^−/− mice (both P < 0.001; Figure 2j and 2k). Under a light microscope, Spaca4^−/− sperm presented multiple abnormalities (Figure 2l), including irregular head morphology and tail folding, and the sperm malformation rate was significantly increased (both P < 0.01; Figure 2m and 2n). Electron microscopy analysis revealed several abnormalities in the ultrastructure of Spaca4^−/− sperm (Figure 3a), which manifested primarily as irregular nuclear shapes, abnormal nuclei with vacuoles, missing or incompletely fused acrosomes, and multiple cross-sections enclosed in one cell membrane. These results suggested that low sperm quality impairs the fertility of Spaca4^−/− male mice.

Figure 3.

Spaca4^−/− sperm present low quality and multiple abnormalities. (a) Ultrastructural analysis of Spaca4^+/+ and Spaca4^−/− sperm by transmission electron microscopy (n = 3). Scale bars=1 µm. Red arrowhead: abnormal nuclei with vacuoles; blue arrowhead: missing or incompletely fused acrosomes; yellow arrowhead: nuclear and flagellar structures in the same cross section; green arrowhead: irregular nuclear shapes. (b) Testis morphology and size of both Spaca4^+/+ and Spaca4^−/− mice (n=3). (c) Statistical analysis of adult Spaca4^+/+ and Spaca4^−/− testis/body weight ratios (n=3). (d) Paraffin sections of testicular tissues from Spaca4^+/+ and Spaca4^−/− male mice were stained with PAS (n=3). Scale bars=50 µm. (e) Twelve stages of spermatogenesis in Spaca4^+/+ and Spaca4^−/− male mice are presented as PAS-stained paraffin sections of seminiferous tubules (n=3). Scale bar = 10 µm. (f) The morphologies of sperm in the corpus epididymides, caput epididymides and testicular suspensions as determined by H&E staining (n=3). Scale bar = 20 µm. Red arrowhead: sperm with anomalous head; green arrowhead: sperm with folded tails. NS: not significant. Statistical significance was calculated using two-tailed Student’s t-test. Spaca4: sperm acrosome-associated 4; H&E: hematoxylin and eosin; PAS: periodic acid-Schiff.

Deletion of SPACA4 affects spermatid maturation and decreases sperm quality

Because sperm are generated in the testis, the structure and function of the testis were evaluated. The testis weight and size did not significantly differ between Spaca4^+/+ and Spaca4^−/− mice (Figure 3b and 3c), and PAS staining revealed similar thicknesses and arrangements of seminiferous epithelia between these two groups (Figure 3d and 3e). Analysis of spermatozoa in testicular suspensions, caput epididymides, and corpus epididymides from Spaca4^−/− mice revealed deformities consistent with the sperm in cauda epididymides (Figure 3f), suggesting that the sperm deformity originated from abnormal differentiation of spermatids in the testes.

To determine whether sperm malformation is caused by impaired spermatid maturation, specific molecules involved in spermatid maturation in the testis, including acrosome development, chromatin condensation, and flagellum assembly, were examined. ArfGAP with FG repeats 1 (AGFG1) and vesicle-associated membrane protein 4 (VAMP4) are key proteins involved in acrosome vesicle secretion fusion, and Keratin 5 is essential for the acroplaxome. Western blot analysis revealed that the expression of these proteins decreased in the testes of Spaca4^−/− mice (all P < 0.05; Figure 4a and 4b). Transition protein 1 (TNP1) is a molecule related to sperm nuclear protein transformation, and CAP-Gly domain containing linker protein 1 (CLIP170) is critical for the manchette structure. Moreover, intraflagellar transport 88 (IFT88) plays an important role in flagellum assembly. These three proteins were expressed at lower levels in Spaca4^−/− testes (all P < 0.05; Figure 4c and 4d). To further demonstrate that the loss of SPACA4 affects the development of key structures during spermatid maturation, the ultrastructure of spermatids was observed in testes. Several abnormal ultrastructures were observed in Spaca4^−/− spermatids, such as abnormal nuclear elongation, abnormal chromatin concentration with vacuoles, and defects in the acroplaxome and manchette (Figure 4e).

Figure 4.

Deletion of SPACA4 affects spermatid maturation and leads to low-quality sperm. (a) Western blot analysis of AGFG1, VAMP4, and Keratin5 in Spaca4^+/+ and Spaca4^−/− testes (n=3). (b) The density ratio of AGFG1, VAMP4, and Keratin5 to GAPDH is shown as the relative expression. (c) Western blot analysis of TNP1, CLIP170, and IFT88 in Spaca4^+/+ and Spaca4^−/− testes (n=3). (d) The density ratio of TNP1, CLIP170, and IFT88 to GAPDH is shown as the relative expression. (e) Ultrastructural analysis of Spaca4^+/+ and Spaca4^−/− spermatids in the testis by transmission electron microscopy. Scale bar = 1 µm. Red arrowhead: acroplaxome defect; blue arrowhead: abnormal acrosome development; yellow arrowhead: abnormal nucleus with vacuoles; green arrowhead: irregular nuclear shape; white arrowhead: abnormal manchette formation. ^*P<0.05, ^**P<0.01, and ^***P<0.001. Statistical significance was calculated using two-tailed Student’s t-test. Ac: acrosome; N: nucleus; G: Golgi apparatus; Spaca4: sperm acrosome-associated 4; AGFG1: ArfGAP with FG repeats 1; VAMP4: vesicle-associated membrane protein 4; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; TNP1: transition protein 1; CLIP170: CAP-Gly domain containing linker protein 1; IFT88: intraflagellar transport 88.

Taken together, these results revealed that SPACA4 deficiency may affect multiple aspects of spermatid maturation in mice, resulting in decreased sperm quality.

SPACA4 plays a role in the mouse testis by regulating the expression of proteins associated with spermatid maturation instead of affecting α7 nicotinic acetylcholine receptor (α7nAChR)

Many neuronal receptors have been implicated in sperm function.39,40 Nicotinic acetylcholine receptors (nAChRs), such as α7nAChR, influence motility and initiate acrosome reactions.41,42 Thus, the expression of α7nAChR in the testis and sperm was examined. Interestingly, α7nAChR was expressed normally in the testes of Spaca4^−/− mice (Figure 5a and 5b) but was expressed at lower levels in Spaca4^−/− sperm than that in Spaca4^+/+ sperm (P < 0.05; Figure 5a and 5c). Furthermore, detection of the mRNA expression levels of downstream molecules in the acetylcholine signaling pathway, including protein kinase B (Akt), signal transducer and activator of transcription 3 (Stat3), phosphoinositide 3-kinase (Pi3k), janus kinase 2 (Jak2), and sirtuin 1 (Sirt1), revealed that the expression of Pi3k, Jak2, and Sirt1 decreased in the sperm of Spaca4^−/− mice (all P < 0.05; Figure 5d). These results suggested that SPACA4 affects sperm function through the acetylcholine signaling pathway.

Figure 5.

SPACA4 plays a role in the testis by regulating the expression of proteins associated with spermatid maturation instead of affecting α7nAChR. (a) Western blot analysis of α7nAChR in Spaca4^+/+ and Spaca4^−/− testes and sperm (n=3). (b) The density ratio of α7nAChR to GAPDH in testes is shown as the relative expression. Statistical significance was calculated using two-tailed Student’s t-test. (c) The density ratio of α7nAChR to GAPDH in sperm is shown as the relative expression. Statistical significance was calculated using two-tailed Student’s t-test. (d) qRT–PCR analysis of the mRNA expression levels of downstream molecules in the acetylcholine signaling pathway (n=3). Statistical significance was calculated using two-tailed Student’s t-test. (e) Round spermatids and elongated spermatids were isolated from the testis by STA-PUT and observed under a microscope. Scale bar = 20 µm. Blue: Hoechst; green: PNA. (f) Round spermatids and elongated spermatids were tested for purity. Scale bar = 20 µm. Blue: Hoechst; green: PNA. (g) Volcano plot for the comparison of protein expression differences between spermatids from the testes of Spaca4^+/+ and Spaca4^−/− mice. Cut-off values (fold change >2 and P < 0.05) were utilized to show protein expression with differential levels. Unchanged proteins are shown in gray. The blue and red dots indicate significant downregulated and upregulated proteins, respectively. (h) Knockdown of Trp53tg5 mRNA expression in spermatids via siRNA (n=3). Statistical significance was calculated using one-way ANOVA. (i) Analysis of the sperm count after TRP53TG5 was knocked down (n=3). (j) Motility of sperm after TRP53TG5 was knocked down (n=3). (k) Analysis of the progressive motility of sperm (n=3). (l) Sperm morphology was analyzed by H&E staining (n=3). Scale bar = 20 µm. (m) Ultrastructural analysis of sperm after TRP53TG5 knockdown. Scale bars=500 nm. Red arrowhead: abnormal nuclei with vacuoles; blue arrowhead: increased flagellar cross sections in one cell membrane. NS: not significant. ^*P<0.05 and ^**P<0.01. Spaca4: sperm acrosome-associated 4; α7nAChR: α7 nicotinic acetylcholine receptor; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; qRT–PCR: quantitative real-time polymerase chain reaction; DIC: digital image correlation; PNA: peanut agglutinin; Rst: round spermatids; Est: elongated spermatids; TRP53TG5: transformation-related protein 53 target 5; NC: negative control; siRNA: small interfering RNA; ANOVA: analysis of variance; FC: fold change; H&E: hematoxylin and eosin; Akt: protein kinase B; Stat3: signal transducer and activator of transcription 3; Pi3k: phosphoinositide 3-kinase; Jak2: janus kinase 2; Sirt1: sirtuin 1; CCDC88A: coiled-coil domain containing 88A; THRAP3: thyroid hormone receptor-associated protein 3; UROC1: urocanate hydratase 1; TNP1: transition protein 1; RPL29: ribosomal protein L29; H1FNT: testis-specific H1 histone; CYPT3: cysteine-rich perinuclear theca 3; PPP1R35: protein phosphatase 1 regulatory subunit 35.

To elucidate the molecular mechanism of spermatid maturation regulated by SPACA4, STA-PUT was used to isolate spermatids from the testes of Spaca4^−/− and Spaca4^+/+ mice (Figure 5e and 5f). Protein expression profiles revealed that 88 proteins were upregulated and 10 proteins (including SPACA4) were downregulated (fold change>2, P < 0.05) in Spaca4^−/− spermatids (Figure 5g and Supplementary Table 3). Gene ontology (GO) analysis of the upregulated proteins revealed that the enriched proteins were involved mainly in the regulation of collagen fibril organization, the steroid biosynthetic process, and the androgen biosynthetic process. In terms of cell components, GO analysis revealed that the enriched proteins were involved mainly in the regulation of mitochondria and extracellular space. Moreover, GO analysis revealed that the enriched proteins were involved in the following molecular functions: extracellular matrix structural constituent, oxidoreductase activity, and glutathione transferase activity (Supplementary Figure 1 ^{(94.6KB, tif)} ). Because the biological processes and molecular functions of the upregulated proteins were not significantly associated with Spaca4^−/− sperm malformation, we focused on the following 9 downregulated proteins: coiled-coil domain containing 88A (CCDC88A), thyroid hormone receptor associated protein 3 (THRAP3), urocanate hydratase 1 (UROC1), transition protein 1 (TNP1), ribosomal protein L29 (RPL29), testis-specific H1 histone (H1FNT), transformation related protein 53 target 5 (TRP53TG5), cysteine-rich perinuclear theca 3 (CYPT3), and protein phosphatase 1 regulatory subunit 35 (PPP1R35), as shown in Figure 5g. Among these proteins, THRAP3, UROC1, TRP53TG5, CYPT3, and PPP1R35 have not been reported to exhibit reproductive function.

Supplementary Table 3.

Quantitative proteomic analysis of spermatids in Spaca4^−/− and Spaca4^+/+ mice

Protein names	Spaca4−/− rep1	Spaca4−/− rep2	Spaca4−/− rep3	Spaca4+/+ rep1	Spaca4+/+ rep2	Spaca4+/+ rep3	FC (Spaca4−/−/Spaca4+/+)	P
CCDC88A	0	0	0	38211	48641	24397	0.0	0.0
SPACA4	614980	665680	741410	9428100	8518400	9112400	0.1	0.0
THRAP3	1854300	1388900	1299200	5627100	4079900	6385400	0.3	0.0
UROC1	524930	441000	391230	1425400	972420	1517500	0.3	0.0
TNP1	8372700	11399000	9572300	26965000	18047000	33162000	0.4	0.0
RPL29	14826000	14150000	15220000	39157000	34035000	40394000	0.4	0.0
H1FNT	29755000	30073000	30674000	73889000	71261000	70300000	0.4	0.0
TRP53TG5	687780	802480	823810	1777600	1716300	1654400	0.4	0.0
CYPT3	9158300	9068200	8855300	19100000	17722000	20074000	0.5	0.0
PPP1R35	1116800	1011000	1121600	2389300	1947400	2254600	0.5	0.0
ACSBG1	76585000	77685000	81299000	41150000	37539000	38657000	2.0	0.0
PECR	5921400	5544000	6216200	3227600	2687700	2867300	2.0	0.0
PRDX3	36826000	35785000	39251000	19630000	17360000	18133000	2.0	0.0
MSMO1	1535900	1470100	1627500	878350	689890	708360	2.0	0.0
COL3A1	554070	581100	572600	282870	254630	298350	2.0	0.0
ABHD3	3209900	3271400	3523500	1820700	1479300	1588400	2.0	0.0
DPT	1378100	1346300	1379000	676120	667430	657480	2.1	0.0
GSTM2	535460000	560160000	573490000	278510000	265480000	266680000	2.1	0.0
CA1	1709000	1694100	1788700	859620	838640	817170	2.1	0.0
EPB42	733660	832700	835860	394290	364170	404010	2.1	0.0
IGHG2B	957130	993120	890700	484300	447830	430310	2.1	0.0
SULT1E1	17704000	18395000	19217000	9370500	8329900	8698400	2.1	0.0
ALDH1L1	47756000	48045000	51014000	24693000	22459000	22808000	2.1	0.0
HP	3530600	3502400	3793600	1883800	1580400	1688000	2.1	0.0
PM20D1	3392200	4123300	3758700	1959000	1532400	1868100	2.1	0.0
KRT84	833930	883000	1284700	557450	369730	493480	2.1	0.0
ZAN	561640	717600	726370	359460	307680	280390	2.1	0.0
CTSH	4402000	4384700	4481900	2203000	2121500	1943300	2.1	0.0
C4B	631290	627330	681980	301180	313760	298500	2.1	0.0
AASS	3556600	4007700	3864100	1946100	1684300	1737000	2.1	0.0
ALDH1A1	184690000	201820000	197340000	96934000	86257000	90039000	2.1	0.0
TECR	18585000	18341000	19214000	9372800	8216600	8603600	2.1	0.0
UGT3A2	830120	833510	876620	439470	315270	411310	2.2	0.0
PRELP	5153300	4605900	5592500	2487900	2164400	2382200	2.2	0.0
FADS2	13429000	13849000	13721000	6719200	5812100	6211100	2.2	0.0
SMOC1	9129500	9665400	9686300	4649900	4138200	4221300	2.2	0.0
OCIAD2	2031500	2223700	2307500	1064600	929710	998120	2.2	0.0
PTPN18	96052	76216	99804	43883	52189	27404	2.2	0.0
GJA1	6285200	6612900	6514700	3040500	2688300	3057800	2.2	0.0
ALDH2	163560000	168460000	176260000	81043000	73813000	75083000	2.2	0.0
ARG1	569520	517350	532510	258140	210110	262300	2.2	0.0
PIPOX	402490	443940	499740	214910	219190	165130	2.2	0.0
SMPD4	2575900	2719600	3044300	1285300	1212000	1205400	2.3	0.0
NUDT19	5386300	5356600	5522700	2631300	2154200	2399500	2.3	0.0
ECHDC3	3455600	3263000	3446400	1621500	1319700	1548200	2.3	0.0
PLD3	7237900	7494200	7714900	3476700	3196100	3202600	2.3	0.0
PPP1R36	1609600	1220900	1534400	692590	480960	744780	2.3	0.0
FDX1	23013000	23176000	23938000	10767000	10102000	9921100	2.3	0.0
CYP21	2783900	2961100	2952900	1289200	1172800	1291800	2.3	0.0
GSTA2	27322000	31045000	30078000	13362000	12045000	12645000	2.3	0.0
LCN2	2535600	2631400	2783700	1165700	1047200	1207600	2.3	0.0
SLC4A1	6632500	6577600	6953000	3036700	2633100	2941100	2.3	0.0
AKR1CL	39838000	42730000	41443000	18493000	16467000	17495000	2.4	0.0
MMD2	635660	593560	781960	293300	290520	259290	2.4	0.0
SUGCT	2612500	2750600	2668800	1239500	983710	1056700	2.4	0.0
HSD17B3	12868000	12543000	13801000	5732200	4854700	5338400	2.5	0.0
GPT2	22138000	22666000	23166000	9959300	8641800	8960500	2.5	0.0
FN1	32225000	33186000	34091000	14170000	12634000	13539000	2.5	0.0
PTGDS	20043000	18215000	21079000	8266900	7684400	7982500	2.5	0.0
GSTM1	358980000	420010000	380200000	160640000	1.49E+08	1.55E+08	2.5	0.0
EHHADH	12258000	12587000	12756000	5345700	4559300	5078200	2.5	0.0
HMGCS2	106030000	108650000	109520000	45159000	40917000	41848000	2.5	0.0
UGT1A6B	903620	833060	941670	416110	282260	348620	2.6	0.0
MYH4	6062300	6483000	6640600	2382700	2504900	2543400	2.6	0.0
ARL5A	46615	71347	68358	32242	19828	19362	2.6	0.0
ARHGEF40	1426200	1522600	1562600	621550	559090	537750	2.6	0.0
MGARP	4805900	4951300	4633200	1925000	1663500	1851000	2.6	0.0
TMEM35	4937700	4817400	5036800	1964100	1917800	1669200	2.7	0.0
PON3	13472000	13095000	13871000	5363600	4962500	4809200	2.7	0.0
ASS1	59873000	58532000	62582000	23469000	21829000	21802000	2.7	0.0
HAO2	2932400	2922200	3025300	1066000	1015500	1163800	2.7	0.0
COL5A1	1349400	1277200	1257800	509660	401620	498210	2.8	0.0
ACOX3	39632000	41096000	43428000	15478000	14085000	14509000	2.8	0.0
MYH7	44691000	45287000	47386000	17118000	15370000	15881000	2.8	0.0
FABP3	116020000	114190000	122600000	43581000	40790000	39625000	2.8	0.0
GSTK1	33404000	33248000	34860000	12475000	10829000	11848000	2.9	0.0
SLC7A8	3276100	3127500	3327400	1312800	1021600	1020300	2.9	0.0
EPHX1	90029000	92524000	95745000	33799000	30969000	30824000	2.9	0.0
INSL3	3411200	3581500	3638600	1309000	1094900	1230500	2.9	0.0
ALDH3A1	26011000	27721000	28025000	9875200	8562700	9338500	2.9	0.0
FEZ2	66788	74829	42149	30430	0	31447	3.0	0.0
ASPN	566330	550490	610400	210120	163130	201270	3.0	0.0
HBBT1	168860000	205820000	187880000	63860000	61731000	59327000	3.0	0.0
PUS3	3672600	3715100	3982900	1345200	1120700	1134000	3.2	0.0
UGT1A7C	58277000	58187000	63542000	19758000	18348000	18625000	3.2	0.0
CES1D	27949000	28207000	29143000	9138700	8755500	8665200	3.2	0.0
COL5A2	527570	560430	556570	184340	150020	177510	3.2	0.0
HSD3B1	35995000	35330000	38608000	11482000	10400000	11244000	3.3	0.0
GSTA3	15096000	14526000	15176000	4754100	4171400	4347700	3.4	0.0
MGST1	19921000	19910000	21115000	6528100	5518300	5938900	3.4	0.0
IGHV1-31	1392300	1525600	1536700	454930	401910	451810	3.4	0.0
COL1A2	19099000	19615000	20565000	6051800	5435800	5790000	3.4	0.0
CYP17A1	76467000	78631000	82852000	23928000	21754000	22574000	3.5	0.0
UGT1A6	13643000	14638000	15128000	4458300	3916300	3991100	3.5	0.0
FGG	29482000	28689000	31822000	9140800	8338400	8122400	3.5	0.0
HBA	393850000	425410000	443650000	119300000	1.12E+08	1.11E+08	3.7	0.0
KRT76	3204600	4347900	3268100	994950	919240	1016100	3.7	0.0
COL1A1	18549000	19972000	19843000	5623700	4889300	5182900	3.7	0.0
APCS	947640	841650	1006100	233970	168990	298020	4.0	0.0
PTN	2908500	2933900	3067300	748910	700400	733100	4.1	0.0
BHMT	89046000	92008000	94990000	19293000	19421000	18606000	4.8	0.0
HSD3B6	52975000	52751000	56322000	11085000	10160000	11110000	5.0	0.0
ITIH4	29782	41109	21678	16757	0	0	5.5	0.0
CYP2D11	2516900	5749500	2916800	663890	496190	695110	6.0	0.0

FC >2, P<0.05. FC: fold change

According to the high-precision transcriptome of mouse male germ cells,43 Trp53tg5 and Cypt3 were highly expressed in spermatids (Supplementary Figure 2 ^{(167.5KB, tif)} ), which was consistent with the expression characteristics of SPACA4 in the testis. To explore the function of TRP53TG5 and CYPT3, we sought to knock down their expression in spermatids via siRNA. However, CYPT family members are highly similar, and specific siRNAs to knock down Cypt3 cannot be designed.44 Thus, we focused on TRP53TG5. In TRP53TG5 knockdown mice (P < 0.05; Figure 5h), sperm motility and progressive motility were decreased (all P < 0.05; Figure 5i–5k), and sperm tail showed curling and folding to varying degrees (Figure 5l), suggesting that TRP53TG5 is involved in the tail assembly of spermatids, thereby affecting sperm quality. Transmission electron microscopy revealed that nuclear vacuoles and multiple flagellar cross-sections were wrapped in the same cell membrane in TRP53TG5 knockdown sperm (Figure 5m). These results are consistent with the weak malformation phenotype of Spaca4^−/− sperm, suggesting that TRP53TG5 may be a downstream molecule of SPACA4 that regulates mouse spermatid maturation.

Abnormal spermatid maturation affects sperm function in Spaca4^−/− mice

Theoretically, impaired quality can affect sperm function. Given the significant expression of SPACA4 in the acrosome of spermatids, the effect of SPACA4 deficiency on acrosome-related function was investigated by testing sperm capacitation ability and acrosomal reactions in vitro. Sperm capacitation was detected by chlortetracycline (CTC) staining, which revealed that the capacitation rate was significantly decreased in Spaca4^−/− mouse sperm (all P < 0.05; Supplementary Figure 3a ^{(230.2KB, tif)} and 3b ^{(230.2KB, tif)} and Supplementary Materials and Methods). Similarly, the incidence of acrosome reactions after capacitation was also reduced (all P < 0.05; Supplementary Figure 3a ^{(230.2KB, tif)} and 3b ^{(230.2KB, tif)} and Supplementary Materials and Methods). These findings may partially explain the inability of sperm to cross the zona pellucida in the absence of SPACA4 (all P < 0.05; Supplementary Figure 3c ^{(94.6KB, tif)} –3e and Supplementary Materials and Methods). Overall, these results indicated that the loss of SPACA4 in mice leads to decreased sperm quality, which affects sperm function. Abnormalities in sperm function, such as sperm capacitation, the acrosome reaction, and zona pellucida binding and penetration, ultimately impair male fertility.

DISCUSSION

With the development of the social economy, the number of male infertility patients is gradually increasing. The fundamental cause of male infertility is abnormal sperm quantity and quality. Although some infertile male patients can obtain offspring through ART, abnormal sperm quality affects embryo quality and offspring health. Spermatid maturation is a key and direct process that affects the quantity and quality of sperm.

The present study revealed that SPACA4 was expressed in the acrosome and cytoplasm of spermatids in the mouse testis. This expression pattern suggested an important role of SPACA4 in spermatid maturation. Deletion of SPACA4 severely impaired male fertility, which is consistent with previous results.27 Analysis of the morphology of reproductive organs, the number and structure of spermatids, and various sperm parameters in Spaca4^−/− mice revealed that the decline in male fertility was caused by impaired sperm quality, manifested as abnormal morphology and a decrease in motility.

Spermatid maturation is the final stage of spermatogenesis, in which the nucleus is remodeled by chromatin condensation, the excess cytoplasm is removed, and the acrosome and sperm tail are formed. The cytoskeleton is a crucial unit in this process, as the acroplaxome and manchette are two structures that cooperate with various functional proteins to ensure the correct formation of the acrosome, nucleus, and flagellum.45,46 The acroplaxome, a circular basement belonging to the acrosome, is composed of microfilaments with associated motor molecules.47 During spermatid maturation, the acroplaxome maintains the acrosome at the nuclear anchoring site during nuclear elongation, promoting sperm acrosome formation and nuclear shaping.48 Manchette is the earliest cytoskeleton element observed in spermatids, which rapidly forms a microtubular platform between the perinuclear ring and the axoneme.49 The manchette can help shape the sperm head and deliver the particles required for the sperm tail in an orderly manner to the axoneme to facilitate flagellum assembly.20,50 In the present study, SPACA4 deletion in mice resulted in multiple malformations of sperm. The ultrastructure of Spaca4^−/− sperm exhibited irregular nuclear shapes and vacuoles, missing or incompletely fused acrosomes, and increased cross-sections of the flagellum in the one-cell membrane. These Spaca4^−/− sperm malformations were due to abnormal spermatid maturation in the testis. The ultrastructures of spermatids in Spaca4^−/− mice presented defects in the acroplaxome and manchette structures, which are involved in the development of the acrosome, nucleus, and flagella. Similarly, the expression of the following molecules related to these structures was decreased: AGFG1 and VAMP4, which are associated with acrosome development; Keratin 5, which is associated with the acroplaxome; CLIP170, which is associated with manchette formation; and TNP1, which is associated with nuclear condensation. Defects in the acroplaxome-manchette system result in abnormal spermatid maturation, leading to the production of low-quality sperm. The decrease in sperm quality affects sperm capacitation and the acrosomal reaction in Spaca4^−/− mice, which may explain why Spaca4^−/− sperm reported by Fujihara et al.27 cannot cross the zona pellucida.

The LU domain in Ly6/uPAR family members interacts with several nAChRs, such as secreted LY6/PLAUR domain containing 1 (SLURP1) and Ly6/neurotoxin 1 (LYNX1).51,52 nAChR subunits, including α3, α5, α7, α9, and β4, are expressed in human sperm. Previous studies have reported that α7nAChR is expressed in the postacrosomal and neck regions of human sperm and that its activity is involved in human sperm motility, acrosome reactions, and zona pellucida penetration.41,53 In mice, the loss of α7nAChR affects sperm motility and function, including capacitation and the acrosome reaction.42,54 Surprisingly, male mice lacking α7nAChR have normal sperm morphology and are fertile.42,55 These reports suggest that while α7nAChR deficiency affects mouse sperm motility and function, it is not a key factor affecting fertility in male mice. In the present study, there was a marked reduction in the expression levels of α7nAChR and its downstream molecules, such as Akt, Jak2, and Sirt1, in Spaca4^−/− sperm, but there was no significant difference in α7nAChR expression in Spaca4^+/+ and Spaca4^−/− testes. These results suggested that SPACA4 may affect sperm motility and function by regulating the α7nAChR pathway, but that it is not the key factor that damages fertility in Spaca4^−/− male mice. The low fertility of SPACA4-deficient male mice may be due to abnormal spermatid maturation.

To gain a deeper understanding of the molecular function of SPACA4 in spermatid maturation, spermatid differential protein expression profiles were constructed, which revealed a significant decrease in the expression of 9 proteins. Among these potential downstream proteins, TNP1 and H1FNT play key roles in the replacement of histones with protamine during sperm head shaping.56,57 Moreover, CCDC88A and RPL29 are essential for male fertility because they regulate flagellar development and affect sperm motility.58,59 CYPT3 and TRP53TG5 are specifically expressed in the testis. In situ hybridization has revealed that CYPT members 1–10 are strongly expressed in spermatids and are expressed earlier than other sperm-specific genes, such as transition protein 2 (Tnp2) and protamine 1 (Prm1).44 The CYPT family may function in the remodeling of the spermatid nucleus, but the sequences of its members are highly similar, which may need to be explored in specific knockout mouse models. In the present study, the function of TRP53TG5, which is a potential downstream target of SPACA4, was explored. TRP53TG5 knockdown affected chromatin condensation and flagellar development, resulting in increased tail malformation and decreased sperm motility.

In summary, SPACA4 is essential for the structural differentiation of spermatids, including acrosome formation, nuclear shaping, and flagellum development, in mice (Figure 6). Deletion of SPACA4 decreases sperm quality and impairs sperm motility, capacitation, and acrosomal reactions, which ultimately leads to impaired male mouse fertility. During spermatid maturation, SPACA4 does not regulate the acetylcholine signaling pathway but regulates the expression of spermatid-related molecules. The present findings provide a detailed mechanism of male subfertility in Spaca4 knockout mice.

Figure 6.

Schematic diagram of the role of SPACA4 in spermiogenesis. Spermatids lacking SPACA4 exhibit abnormal differentiation during acrosomal development, manchette formation, chromatin condensation, nuclear elongation, and flagellum development, ultimately affecting sperm quality and function. Spaca4: sperm acrosome-associated 4.

In human sperm, SPACA4 is expressed in the acrosome. Inhibition of SPACA4 affects the binding of sperm to the zona pellucida in vitro.28 However, there is no difference in SPACA4 expression in the sperm of males with oligospermia, asthenospermia, or oligoasthenospermia.28 The significance of SPACA4 in the clinical diagnosis and treatment of male infertility still needs more clinical samples and further studies, such as exploring the mutation of SPACA4 in infertile patients and the expression level of SPACA4 in the sperm of patients with teratozoospermia. Using a mouse model, the present study provides a new perspective on the role of SPACA4 in regulating sperm quality through spermatid maturation in male fertility.

AUTHOR CONTRIBUTIONS

HZ conceived and designed the research. XC, HQW, DYW, XZZ and XLZ performed the experiments. XC, HQW, DYW, XLZ, and HZ analyzed the data. XC, XJG, and HZ interpreted the results of the experiments. XC and HQW prepared the figures and edited and revised the manuscript. XC and HZ drafted the manuscript. HZ provided critical insights and feedback that enhanced the overall quality of the manuscript. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests.

Supplementary Figure 1

Gene Ontology analysis of up-regulated proteins in Spaca4^-/- spermatids. BP: Biological process; CC: Cell component; MF: Molecular function; Spaca4: sperm acrosome-associated 4.

Supplementary Figure 2

The expression of proteins associated with spermatid differentiation in male germ cells. Analysis of high-precision transcriptome of mouse male germ cells revealed the expression abundance of Uroc1 (a), Cypt3 (b), Thrap3 (c), Ppp1r35 (d), and Trp53tg5 (e) in a variety of male germ cells. PGC: primordial germ cells; PMC: peritubular myoid cell; IP: interstitial progenitor; Thrap3: thyroid hormone receptor-associated protein 3; Uroc1: urocanate hydratase 1; Trp53tg5: transformation-related protein 53 target 5; Cypt3: cysteine-rich perinuclear theca 3; Ppplr35: protein phosphatase 1 regulatory subunit 35.

Supplementary Figure 3

Abnormal spermatid differentiation affects sperm function in Spaca4^−/− mice. (a) CTC staining of sperm capacitation and acrosome reaction after capacitation. Scale bars = 50 μm. (b) Quantification of the percentage of sperm capacitation, acrosomal reactions, and acrosome reaction after capacitation from Spaca4^+/+ and Spaca4^−/− mice. (c) Representative images of fertilization and fertilization without zona pellucida in vitro of Spaca4^+/+ and Spaca4^−/− mice. Scale bars = 100 μm. (d) Quantification of the percentage of fertilization in vitro (n = 3). (e) Quantification of the percentage of fertilization without zona pellucida in vitro (n = 3). NS: not significant, **P < 0.01, ***P < 0.001. Statistical significance was calculated using two-tailed Student's t-test. Spaca4: sperm acrosome-associated 4; CTC: chlortetracycline.

SUPPLEMENTARY MATERIALS AND METHODS

In vitro fertilization

Sperm from the cauda epididymis of adult male mice were absorbed into TYH (Toyoda, Yokoyama, Hoshi) (M2050, AibeiBio, Nanjing, China) and cultured 1.5 h at 37 °C and 5% CO₂ for capacitation. Female mice with 8-12 weeks old were injected pregnant mare serum gonadotropin (PMSG) (Sansheng Biological Technology, Ningbo, China) for superovulation, and human chorionic gonadotropin (HCG) (Sansheng Biological Technology, Ningbo, China) was injected 48 h later. The cumulus-oocyte complexes (COCs) were taken from the ampulla of the oviduct after 13-14 h. For cumulus cell–free oocytes, COCs were digested in M2 medium (M1250, AibeiBio, Nanjing, China) containing hyaluronidase (H3884, Sigma-Aldrich, St. Louis, MO, USA) to remove cumulus cells, then oocytes were washed in M2 medium. For zona pellucida removal, the cumulus cell–free oocytes were moved to a droplet of Tyrode's solution (T1788, Sigma-Aldrich, St. Louis, MO, USA). Once the zona pellucida was shed, the oocytes were immediately transferred to M2 medium and washed three times. The capacitated sperm was added in oocytes and incubated at 37 °C under 5% CO₂ for 3-4 h. The fertilized eggs were washed in potassium simplex optimization medium (KSOM) (M1450, AibeiBio, Nanjing, China) to remove excess sperm and observed under microscope.

Acrosomal reaction and CTC staining

The sperm were released from cauda epididymis, and cultured in TYH (Toyoda, Yokoyama, Hoshi) (M2050 , AibeiBio, Nanjing, China) at 37 °C, 5% CO₂ for 1.5 h to induce capacitation. To induce the acrosome reaction, the calcium ionophore A23187 (100107, Sigma-Aldrich, St. Louis, MO, USA) was added and continued to culture for 1 h. Sperm samples were added with equal volume of CTC solution (750 mM CTC, 20 mM Tris, 130 mM NaCl, and 5 mM cysteine, pH 7.4) and appropriate amount of stationary liquid (2.5M Tris and 5% [v/v] formaldehyde in PBS). The sample was gently mixed and was left at 4°C overnight. Next day, the stained sperm was applied to the slides and observed under confocal microscope (Zeiss, Oberkochen, Germany). At least 400 sperm were measured from each sample and evaluated for four groups: live acrosome-reacted sperm (AR pattern), live capacitated sperm (B pattern), live non-capacitated sperm (F pattern), and dead sperm (D pattern).