Skip to main content
Asian Journal of Andrology logoLink to Asian Journal of Andrology
. 2026 Jan 13;28(3):267–275. doi: 10.4103/aja202558

Methamphetamine-induced inhibition of Mettl21c in undifferentiated spermatogonia impairs male fertility in mice

Xue-Heng Zhao 1,2, Dai Zhou 1,3, Shuang Lu 4, Wei-Tao Yan 4,5,, Li-Qing Fan 1,2,
PMCID: PMC13258334  PMID: 41527958

Abstract

Chronic methamphetamine (Meth) exposure has been recognized as a critical risk factor for male reproductive dysfunction, yet its mechanistic underpinnings remain elusive. This study elucidates the molecular pathways through which Meth compromises spermatogenesis in a murine model. Male mice subjected to 15 days of chronic Meth administration presented severe testicular atrophy, characterized by seminiferous epithelial disorganization and diminished sperm reserves in both the testes and epididymides. Quantitative assessments revealed marked reductions in sperm motility and increased tail abnormalities. Transcriptomic profiling revealed significant down-regulation of methyltransferase-like 21C (Mettl21c), an undifferentiated spermatogonial-enriched methyltransferase, within pathways governing germ cell differentiation. Immunofluorescence analysis revealed predominant Mettl21c colocalization with undifferentiated spermatogonial marker ubiquitin carboxyl-terminal hydrolase L1 (Uchl1), with minimal overlap in tyrosine-protein kinase Kit (Kit) positive differentiated populations. In vitro suppression of Mettl21c in C18-4 lines triggered proliferation arrest and increased apoptosis. These findings establish Mettl21c as a pivotal mediator of Meth-induced spermatogenic failure through spermatogonial maintenance pathways. Our work provides novel insights into the epigenetic regulation of drug-associated male infertility and identifies Mettl21c as a potential therapeutic target for preserving fertility in substance abuse cases.

Keywords: male infertility, methamphetamine, Mettl21c, survival, undifferentiated spermatogonia

INTRODUCTION

Methamphetamine (Meth) is a potent psychostimulant known for its high potential for addiction, leading to severe health consequences, including vascular and neuropsychiatric disorders, and, in extreme cases, fatality.1 Recent studies indicate a rising trend in the misuse of Meth, particularly among adolescents in various regions worldwide.2,3 While it is true that Meth can initially cause an increase in sexual arousal and activity, as well as a sense of euphoria, these effects come with significant risks and negative consequences.4 Meth use can have long-term detrimental effects on sexual health and function. Chronic use can lead to sexual dysfunction, including erectile dysfunction in men and decreased lubrication and sensation in women. The drug can also cause significant damage to the brain’s pleasure system, which can lead to a decreased ability to experience pleasure from natural rewards, including sexual activity.5,6 Meth has been shown to be testicular toxic, which can lead to testicular damage and a reduction in sperm quality.7,8 Previous studies have shown that Meth abuse can lead to apoptosis in the seminiferous tubules of male mouse testes, resulting in decreased sperm motility, reduced plasma testosterone levels, abnormal sperm morphology, and a low sperm concentration in male rats.8,9 Histopathological analysis revealed significant distortion of the testicular histoarchitecture, featuring tubular degeneration and interstitial edema.10,11 Meth exposure has been associated with sex hormone imbalances and a reduction in the expression of estrogen and progesterone receptors within the testis.12 In addition, Meth-induced impairments in sperm quality may be associated with disrupted ion homeostasis. This disruption results in altered intracellular calcium and chloride ion levels.13 Evidence from rodent studies indicates that Meth can impact male fertility potential by triggering oxidative stress, autophagy, apoptosis, DNA damage, and abnormal spermatogenesis.14 Nonetheless, the precise mechanism underlying Meth-induced damage to reproductive capacity remains largely elusive.

Numerous studies have revealed a correlation between alterations in methyltransferase activity and the toxicity of Meth.15,16,17 Methyltransferases are essential for the process of spermatogenesis. For example, conditional knockout of methyltransferase-like 16 (Mettl16) in the germline of male mice has been shown to impair spermatogonial differentiation and the initiation of meiosis.18 Research suggests that methyltransferase-like 3 (Mettl3) is crucial in spermatogenesis, as it regulates the differentiation of spermatogonia and the onset of meiosis.19,20 The expression of Mettl3 mRNA is significantly greater in patients with asthenospermia than that in controls, affecting sperm motility and exacerbating asthenospermia.21 Notably, our findings indicate that the expression of methyltransferase-like 21C (Mettl21c) is reduced in spermatogonial stem cells (SSCs) of the mouse testis following Meth treatment.

This raises the question of whether Mettl21c, as a methyltransferase, also plays a critical role in spermatogenesis and whether it is involved in Meth-induced reproductive toxicity by regulating the proliferation of mouse spermatogonial cells. To address this, we established a male mouse model of Meth poisoning to measure fertility, spermatogenesis, and sperm concentration indices in the testis. Additionally, we selected mouse SSC-derived C18-4 cells for in vitro experiments to verify the impact of Mettl21c on spermatogenesis. The objective of this study was to explore potential target genes affected by Meth that influence male mouse reproductive function. This study aimed to provide a preliminary experimental foundation for the development of new therapeutic strategies and targets for treating reproductive dysfunction caused by Meth in the future.

MATERIALS AND METHODS

Ethics statement

The animal experimental study was authorized by the Experimental Animal Welfare Ethics Committee of Central South University (Changsha, China; Approval No. XMSB-2022-0053). C57BL/6J mice (8–10 weeks old) were selected on the basis of their genetic homogeneity. Intraperitoneal injection was chosen to ensure dose consistency and comparability with established protocols for Meth exposure. All procedures strictly adhered to the Guide of Implementation Rules for the Management of Laboratory Animals (Central South University, 2022), with measures to minimize distress (e.g., ultrafine needles and operator training).

Establishment of the Meth animal model

Male mice were divided into two groups: the control group and the subacute Meth group. Over the course of 15 days, the latter received an intraperitoneal injection of 5 mg kg−1 Meth. During the experimental period, the mice were humanely sacrificed via cervical dislocation. The bilateral testes and epididymis were subsequently excised by an ice bath. These tissues were then meticulously separated, with both sets of testes and epididymides being individually weighed.

Assessment of sperm motility and concentration

The epididymis, as previously mentioned, was weighed and promptly utilized for sperm collection. The 1.5-ml volume of semen buffer (G-IVF™ PLUS; Vitrolife, Uppsala, Sweden) was prewarmed to 37°C in saline and placed into 2-ml EP tube prior to the collection process. Next, the epididymis and its tail were separated, weighed, and submerged in buffer. The epididymal tail was then longitudinally sectioned using ophthalmic scissors and subsequently immersed in a water bath maintained at 37°C for 30 min. This procedure facilitated the gentle agitation required to permit the full emergence of spermatozoa, culminating in the creation of a sperm suspension. This suspension was then aspirated using a glass siphon tube and deposited onto a sterile slide. Observations of sperm morphology were conducted within a window of 30 min to 1 h using a high-magnification microscopy (Carl Zeiss, Oberkochen, Germany). The sperm density and viability were assessed using a computer-assisted semen analysis (CASA; SAS Medical, Beijing, China).

Sperm morphology evaluation

Fresh semen was washed and prepared, followed by treatment with a sperm morphology staining kit (Ankebio, Hefei, China). The samples were subsequently fixed in 90% ethanol solution and rehydrated using a descending gradient of ethanol solutions (80%, 70%, and 50%) for 1 min each. The sections were then washed with distilled water for 1 min, stained with hematoxylin solution for 3–5 min, rinsed, and differentiated with acidic ethanol differentiation solution for approximately 4–5 s. The samples were visualized under a microscope to the appropriate degree and stained in a bluing solution for 4 min. After rinsing, the samples were dehydrated in a series of 50%, 70%, 80%, and 95% ethanol for 1 min per gradient, followed by incubation with orange G6 staining solution (Ankebio) for 2 min. Finally, after rinsing and dehydration with ethanol, the sperm morphology was observed, and the types and percentages of sperm abnormalities were determined.

Embedding and sectioning of testicular tissue

The testicular tissues were meticulously cut into appropriate sizes using sharp scissors or razor blades to preserve the original morphology. The tissues were subsequently rinsed twice with phosphate-buffered saline (PBS; Gibco, Grand Island, NY, USA) and then immersed in Bouin’s fixative (FeiJing, Fuzhou, China) or 4% paraformaldehyde (SangGong, Shanghai, China) fixative. The tissues were fixed at 4°C for approximately 24–48 h. Afterward, they were placed in a tissue embedding box, dehydrated through a series of graded ethanol solutions, cleared in xylene, and embedded in paraffin wax. Serial sections with a thickness of 5 μm were obtained using a microtome (Leica, Wetzlar, Germany) and mounted on glass slides (Citotest, Nanjing, China). The prepared slides were then stored at −20°C.

Hematoxylin and eosin (H&E) staining

Testicular tissue sections were baked in an oven at 65°C for 1 h. The sections were deparaffinized using xylene, rehydrated through a series of graded ethanol solutions, and then stained with hematoxylin (Beyotime, Shanghai, China) for 8 min at room temperature. This was followed by a rinse with running water. The sections were subsequently stained with eosin (Beyotime) for 3–10 s at room temperature, followed by another rinse with running water for approximately 30 s, ensuring thorough removal of the eosin from the slide. The slides were quickly passed through solutions of 70%, 80%, 95%, and 100% ethanol, made transparent by three 2-min immersions in xylene, and finally sealed with neutral resin (Sinopharm Chemical Reagent, Shanghai, China).

Immunofluorescence

To enhance immunofluorescence, Alexa Fluor-conjugated secondary antibodies (Thermo Fisher Scientific, Waltham, MA, USA) were incubated for 1 h at room temperature, followed by restaining with 4’,6-diamidino-2-phenylindole (DAPI). Subsequent to this process, the tissue sections were imaged and analyzed using a Zeiss microscope (Carl Zeiss). The antibodies used in this assay are listed in Supplementary Table 1.

Supplementary Table 1.

Antibodies applied in western blots and immunofluorescence

Antibodies Source Dilution Incubation
Western blot
 Mettl21c Huabio#ER1912-97 1:800 12 h at 4°C
 Thy1 Abcam#ab225 1:1000 12 h at 4°C
 Actb Promab cat#20270 1:2000 12 h at 4°C
 Gfra1 R and D cat#AF560 1:500 12 h at 4°C
Immunofluorescence
 Mettl21c Sinobiological cat# 310259 1:50 16 h at 4°C
 Uchl1 Abcam cat#ab108986 1:50 16 h at 4°C

Mettl21c: methyltransferase-like 21C; Gfra1: glial cell line-derived neurotrophic factor family receptor alpha 1; Thy1: Thy-1 cell surface antigen; Uchl1: ubiquitin carboxyl-terminal hydrolase L1

RNA extraction and quantitative polymerase chain reaction (qPCR)

Cellular and tissue RNA was isolated using the TRIzol method. One microliter of total RNA was sampled, and its optical density (OD) and concentration were determined using a NanoDrop 1000 spectrophotometer. A 1% agarose gel was subsequently prepared, and 5 µl of the total RNA was loaded to assess its integrity via electrophoresis.

The gene expression results were detected using a real-time qPCR system (LightCycler 480; Roche, Penzberg, Germany). The expression level of the internal reference gene (β-actin) served as the standard reference. The reaction conditions included initial predenaturation at 95°C for 5 min, followed by 45 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s. The cycle threshold (CT) value was analyzed using LightCycler 480 software (Roche), and the 2−ΔΔCT method was used to calculate the relative gene expression levels. These data were further analyzed statistically using the Student’s t-test in GraphPad Prism software (version 8.0; GraphPad Software, Carlsbad, CA, USA). The primers for the genes were sourced from PrimerBank (https://pga.mgh.harvard.edu/primerbank/, last accessed on 2025 June 15) and are listed in Supplementary Table 2.

Supplementary Table 2.

The primers used for quantitative polymerase chain reaction and reverse transcription-polymerase chain reaction

Genes Sequence
Mettl2 Foreword: GGACCCTCAGTAGAGTTCG
Reverse: GTAGCTGGCATAGTCTGTAGG
Efna4 Foreword: ACTACTACATCTCGGTGCC
Reverse: GCTGACTCATGTGATGACC
Hoxc10 Foreword: AGCTAAAGAGGAGATAAAGGC
Reverse: CGTCTGGTGTTTAGTATAGGG
Tnnt1 Foreword: AGGCAGAAGATGAGGAAGC
Reverse: GAATCAAAGGAGGCACCAC
Fgg Foreword: GCTAAGCAGCAGTTCTTAGTG
Reverse: GCCATCAATCCTCTTCTGC
Klf14 Foreword: CATCCAAGCGACATCAGTG
Reverse: TGCGACGACTTGTAGTAGG

Mettl21c: methyltransferase-like 21C; Efna4: ephrin A4; Hoxc10: homeobox C10; Tnnt1: troponin T type 1; Fgg: fibrinogen gamma chain; Klf14: Kruppel-like factor 14

Cell culture and transfection

The mouse C18-4 cell line was cultured in medium consisting of Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) and, when necessary, antibiotics. The cells were subcultured every 2-3 days at 34°C and 5% CO2.

A total of 2.5 μg of plasmid DNA was transfected into the mouse C18-4 cell line using the Liposome 3000 Transfection Reagent (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s protocol. Dual transfection with a green fluorescent protein (GFP) reporter plasmid resulted in an approximate transfection efficiency of 75%. Protein and gene expression was analyzed 48 h post-transfection.

Protein extraction and immunoblotting

Total protein was extracted from cells and tissues using radioimmunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific). Briefly, RIPA buffer was added to the samples, which were subsequently homogenized and lysed on ice for 15 min. The supernatant was then centrifuged (Centrifuge 5424R; Eppendorf, Hamburg, Germany) at 12 000g for 15 min. Approximately 30 mg of total protein was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; Bio-Rad, Hercules, CA, USA) electrophoresis, and after the proteins were transferred to polyvinylidene fluoride (PVDF) membranes, the membranes were incubated with primary antibodies for 16 h at 4°C, followed by incubation with secondary antibodies. The bands were visualized and analyzed using a chemiluminescence system (Bio-Rad). The antibodies used in this assay are listed in Supplementary Table 1.

Cell Counting Kit-8 (CCK8) assay

The proliferation rate of the C18-4 cell line was assessed using a CCK8 assay, following the protocol described in our previous study.22 Briefly, 10% CCK8 reagent was added, and the samples were incubated for 3 h. The absorbance of the medium at a wavelength of 450 nm was subsequently measured using an enzyme marker from Thermo Fisher Scientific.

5-ethynyl-2’-deoxyuridine (EdU) incorporation assay

According to the operation manual, 50 μmol l−1 EdU (RiboBio, Guangzhou, China) reagent was added to the cell culture medium, and the mixture was incubated for 12 h. The human SSC cell lines were then washed with DMEM and fixed with 4% PFA. Following neutralization with glycine (2 mg ml−1), the cells were permeabilized by incubation with 0.5% Triton X-100 for 10 min at room temperature. Apollo was used for color development, and the cell nuclei were counterstained with DAPI. Images were captured and analyzed using a fluorescence microscope (Carl Zeiss). At least 500 cells were included for statistical analysis.

Flow cytometry for detecting apoptosis

The C18-4 mouse cell line was harvested 48 h post-transfection and subsequently washed twice with ice-cold PBS. Following centrifugation, a minimum of 1 million cells were resuspended in Annexin V binding buffer (BD Biosciences, San Jose, CA, USA) according to the manufacturer’s instructions. The cells were then incubated with 10 μl of propidium iodide (PI) and 5 μl of APC-labeled Annexin V reagent for 15 min at room temperature in the dark. The stained cells were analyzed using a C6 flow cytometer (BD Biosciences).

Statistical analyses

The R language (R Foundation, Kaysville, UT, USA), which uses the dplyr package for data manipulation and analysis, was used to conduct at least three replicates for each experimental trial. The outcomes are reported as the mean ± standard deviation (s.d.). A t-test was applied to assess the variance differences between the groups, with a significance level defined as P < 0.05.

RESULTS

Meth exposure impairs fertility and spermatogenesis

To investigate the effects of Meth on testicular function and spermatogenesis, we administered Meth (5 mg kg−1) intraperitoneally to male mice for 15 days. After one treatment cycle, we assessed the fertility and litter size of the Meth-injected mice by mating them with females. The number of pups per litter was significantly lower in the Meth group than that in the control group (injected with dimethyl sulfoxide; Figure 1a). Meth treatment markedly reduced the sizes of the testes and epididymides (Figure 1b and 1c). The results of H&E staining revealed that Meth exposure caused extensive thinning of the seminiferous epithelium and vacuolization, with more than 40% of tubules exhibiting spermatid loss. This suggests failure in late spermatogenesis, where elongating spermatids are shed, and may reflect upstream SSC dysfunction. H&E staining of epididymal sections also revealed a severe reduction in the sperm count in Meth-treated mice (Figure 1d and 1e). These results suggest that Meth impairs fertility in male mice by affecting spermatogenesis.

Figure 1.

Figure 1

Meth impairs male fertility in mice. (a) Dot plot showing the number of pups per litter in the Meth (n = 9) and control (n = 9) groups. Meth exposure resulted in a significant reduction in litter size in the mice. (b) Images of testes and epididymides from the control and Meth groups. Meth exposure resulted in a significant reduction in testicular and epididymal volume. (c) Dot plot showing the ratio of testes weight to body weight in the Meth (n = 10) and control (n = 10) groups. (d) H&E staining of the testis and epididymis in each group. Scale bars = 100 µm. (e) Bar graph showing the proportion of damaged seminiferous tubules and abnormal epididymal tubules (n = 3) in d. Meth exposure resulted in a significant increase in the proportion of abnormal seminiferous and epididymal tubules. *P < 0.05; **P < 0.01; ***P < 0.001. Meth: methamphetamine; H&E: hematoxylin and eosin.

Meth reduces the sperm concentration and causes tail damage

To further characterize the sperm alterations induced by Meth, we isolated sperm from the epididymides of the mice and analyzed their concentration, viability, and motility using CASA. These results revealed that Meth exposure led to a drastic reduction in the sperm concentration and compromised sperm motility. However, there were no significant changes (all P > 0.05) in the percentage of progressive motility, straight line velocity, or curved line velocity (Figure 2a). We then assessed the morphology of the spermatozoa using Papanicolaou staining and found that Meth caused more tail damage to the spermatozoa, especially tail curling, which might have contributed to impaired sperm viability (Figure 2b and 2c). We further examined the ultrastructure of the spermatozoa by transmission electron microscopy and observed that more microtubules in the “9+2” arrangement of the sperm tail were missing in the Meth group, especially in the middle and principal pieces of the sperm tail (Figure 2c2f).

Figure 2.

Figure 2

Effects of Meth on the sperm concentration, motility, and morphology. (a) Computer-assisted sperm analysis of concentration and motility. Meth exposure resulted in a significant reduction in the sperm concentration. Data are presented as mean ± s.d. (b) Pap staining of spermatozoa. Scale bars = 10 µm. (c) Results of the morphological analysis of spermatozoa in b. Sperm tail damage was significantly increased in the Meth-exposed group. Data are presented as mean ± s.d. (d) Pictures of sperm tail transmission electron microscopy. Scale bars = 10 nm. Bar graph demonstrating the proportion of abnormalities in the (e) midpiece and (f) principal piece of the sperm tail in d, respectively. *P < 0.05 (the value in the Meth group compared with that in the control group). Meth: methamphetamine; ERC: excess residual cytoplasm; s.d.: standard deviation.

Screening of Meth downstream target genes

To elucidate the molecular mechanisms of Meth-induced impairment of fertility and spermatogenesis, we performed RNA sequencing of testicular tissue from Meth-treated and control mice. RNA sequencing revealed approximately 20 000 genes, 41 of which were significantly down-regulated and 33 of which were significantly up-regulated by Meth treatment (all P < 0.05, fold change ≥2; Figure 3a). The expression patterns of all the genes are shown as volcano plots, and the top 10 differentially expressed genes (DEGs) are labeled (Figure 3b). We then validated the expression of selected DEGs by qPCR and confirmed that genes such as Mettl21c, fibrinogen gamma chain (Fgg), and Kruppel-like factor 14 (Klf14) were significantly down-regulated in Meth-exposed testicular tissues (Figure 3c). We further classified all genes into six clusters (C1 to C6) on the basis of their expression trends using the Mfuzz algorithm. Interestingly, Cluster C1 contained 2947 genes whose expression was down-regulated in the Meth group and whose expression was enriched for processes such as spermatid differentiation, which is consistent with the phenotypic observations. In Cluster C1, we highlighted 19 genes that were significantly down-regulated, including suppression of glutaminase activity 3 (Soga3), Mettl21c, and Klf14 (Figure 3d). To further investigate which genes might mediate the spermatogenic abnormalities caused by Meth, we analyzed single-cell sequencing data from GSM6450466 and examined the distribution of all DEGs. The results indicated that among the genes significantly down-regulated in Cluster C1, Mettl21c was highly expressed in the testis and was predominantly localized in SSCs (a subset of undifferentiated spermatogonia; Supplementary Figure 1 (220.5KB, tif) ). Previous studies19,23 have reported that the homologous family protein of Mettl3 plays a regulatory role in mouse spermatogenesis; however, whether Mettl21c affects spermatogenesis by modulating the dynamics of SSCs remains to be verified.

Figure 3.

Figure 3

RNA sequencing was used to detect testicular transcriptome changes induced by Meth exposure. (a) The bar graph shows the number of DEGs resulting from Meth exposure. (b) Volcano map showing the distribution of all identified genes. (c) qPCR validation of the expression of randomly selected DEGs. (d) Clustering heatmap and GO enrichment analysis for all genes. All the genes were categorized into 6 clusters on the basis of their expression trends. Left: line graph showing the expression trends of the genes for each cluster in the two groups. Middle: clustered heatmap of all genes. The top 20 down-regulated DEGs associated with spermatogenesis in Cluster 1 are labeled. Right: the top 5 GO (biological process) terms enriched in the DEGs of each cluster. #P < 0.05 represents significant up-regulation compared with the control. *P < 0.05 indicates significant down-regulation compared with the control. Meth: methamphetamine; DEG: differentially expressed gene; GO: Gene Ontology.; Efna4: ephrin A4; Hoxc10: homeobox C10; Tnnt1: troponin T type 1; Fgg: fibrinogen gamma chain; Klf14: Kruppel-like factor 14; qPCR: quantitative polymerase chain reaction; ncRNA: non-coding RNA.

Meth exposure down-regulates Mettl21c and disrupts spermatogonial homeostasis

The regulation of spermatogenesis by methyltransferases has been extensively documented, where the differentiation of SSCs was shown to be severely impaired upon Mettl3 deletion in murine models.19 Among these regulatory enzymes, Mettl21c was identified as another testis-enriched methyltransferase, although its functional role in spermatogonial dynamics and maintenance remains to be fully elucidated. Two-color immunofluorescence analysis revealed that Mettl21c was predominantly colocalized with ubiquitin carboxyl-terminal hydrolase L1 (Uchl1; mean ± s.d.: 80.5% ± 6.5%, n = 20), a marker characteristic of undifferentiated spermatogonia, whereas minimal overlap was observed with Kit (mean ± s.d.: 16.0% ± 3.9%, n = 20), a differentiation marker of committed spermatogonia (Figure 4a and 4b). Given the exceptionally rare SSC population (<0.03% of testicular cells), it was suggested that Mettl21c expression is not strictly confined to the stem cell compartment but rather broadly maintained within the undifferentiated spermatogonial reservoir.

Figure 4.

Figure 4

Distribution pattern of Mettl21c and the roles of Meth in spermatogonial homeostasis. (a) Spatiotemporal distribution of Mettl21c in testicular germ cells revealed by two-color immunofluorescence. Top: colocalization of Mettl21c (green) with Uchl1+ undifferentiated spermatogonia (red). Bottom: minimal overlap between Mettl21c (green) and Kit+-differentiated spermatogonia (red). Nuclei were counterstained with DAPI (blue). The white arrows denote double-positive cells. Scale bars = 50 µm. (b) Bar graphs showing the percentage of Mettl21c co-expressed with each cellular marker in a (n = 20 for each group). Each dot represents a counting result. (c) Two-color fluorescence detection of Mettl21c and Uchl1 coexpression in the control and Meth groups. Scale bars = 50 µm. The bars show the number of (d) Uchl1-positive cells and (e) Mettl21c-positive cells, and (f) the proportion of Uchl1/Mettl21c double-positive cells in each group in c (n = 20 for each group), respectively. (g) Western blot detection of Kit, Gfra1, and Mettl21c expression in the control and Meth groups. (h) Bar graphs showing the relative expression levels of Kit, Gfra1, and Mettl21c in each group in g (n = 3 for each group). *P < 0.05; ***P < 0.001. Meth: methamphetamine; Mettl21c: methyltransferase-like 21C; Uchl1: ubiquitin carboxyl-terminal hydrolase L1; Kit: tyrosine-protein kinase Kit; DAPI: 4’,6-diamidino-2-phenylindole.

Similarly, the results of two-color immunofluorescence also revealed that Meth exposure resulted in a significant reduction in the number of both Uchl1- and Mettl21c-positive cells in the mouse testis, as well as a significant decrease in the ratio of double-positive Uchl1 cells to Mettl21c cells (Figure 4c4f). In addition, the western blot results revealed that Meth exposure significantly decreased the overall levels of Mettl21c, Gdnf family receptor alpha 1 (Gfra1; a marker protein for SSCs), and Kit (a marker for differentiated spermatogonia; Figure 4g and 4h). These results suggest that Meth exposure significantly down-regulates Mettl21c, impairs spermatogonial function, and may result in abnormalities in subsequent spermatogenesis.

Mettl21c knockdown inhibits the proliferation of mouse spermatogonial cell lines

To further examine the function of Mettl21c in undifferentiated spermatogonia, we used mouse SSC-derived C18-4 cells for in vitro experiments. We knocked down Mettl21c in C18-4 cells using small interfering RNA (siRNA) and assessed its knockdown efficiency by qPCR (Figure 5a) and western blot (Figure 5b and 5c), which revealed that Mettl21c-siRNA3 had the greatest inhibitory effect. After 48 h of transfection, we measured cell proliferation by a CCK8 assay and found that knockdown of Mettl21c significantly inhibited cell growth (Figure 5d). Similarly, the results of the EdU assay revealed that Mettl21c deficiency impaired cellular DNA synthesis (Figure 5e and 5f). The western blot results revealed that Mettl21c deficiency also led to the down-regulation of the SSC marker molecules Gfra1 and Thy-1 cell surface antigen (Thy1), as shown in Figure 5g and 5h. In addition, the results of flow cytometry revealed that silencing mettl21c also induced a significant increase in apoptosis (Figure 5i). These data indicate that a reduction in Mettl21c severely compromises spermatogonial survival.

Figure 5.

Figure 5

The effects of Mettl21c on the proliferation and apoptosis of C18-4 cells. (a) qPCR was performed to detect the mRNA level of Mettl21c after siRNA transfection. KD3 has the greatest inhibitory effect on Mettl21c mRNA. (b) Western blot detection of Mettl21c protein levels after siRNA transfection. (c) Bar graph demonstrating the relative protein levels of Mettl21c. The level of the Mettl21c protein was most significantly reduced after KD3 transfection. (d) CCK8 was used to detect SSC proliferation from Day 1 to Day 5 after KD3 transfection. (e) EdU assays for DNA synthesis in C18-4 lines. (f) Bar graph showing the proportion of EdU-positive cells in each group. Mettl21c knockdown significantly inhibited DNA synthesis. (g) Western blot analysis of the expression of SSC self-renewal-related proteins. Gfra1 and Thy1 levels were significantly down-regulated after Mettl21c knockdown. (h) Bar graphs showing the relative levels of Gfra1 and Thy1. (i) Flow cytometry was used to detect apoptosis after Mettl21c knockdown. Flow cytometry was used to detect apoptosis after Mettl21c knockdown. Mettl21c knockdown resulted in a significant increase in both early and late apoptosis. *P < 0.05; ***P < 0.001. Mettl21c: methyltransferase-like 21C; KD: knockdown; OD: optical density; EdU: 5-ethynyl-2’-deoxyuridine; CCK8: Cell Counting Kit 8; Gfra1: glial cell line-derived neurotrophic factor family receptor alpha 1; Thy1: Thy-1 cell surface antigen; A450: absorbance 450; APC: allophycocyanin; PI: propidium iodide; qPCR: quantitative polymerase chain reaction; siRNA: small interfering RNA.

DISCUSSION

Meth has a profound stimulating effect on the central nervous system. Its consumption leads to severe psychiatric disorders, significantly damages heart and brain tissues, and can even result in death.1 Here, we report that Meth exposure can impair fertility and spermatogenesis, reduce the sperm concentration, and cause tail damage. Moreover, we screened 74 differentially expressed genes by RNA sequencing of testicular tissue treated with Meth. By combining the DEGs with the single-cell sequencing data from GSM6450466, we found that Mettl21c may be a potential target gene. We found that Meth exposure can down-regulate the expression of Mettl21c. We also demonstrated that Mettl21c knockdown can inhibit the proliferation of mouse spermatogonial cells in vitro. These findings indicate that Mettl21c may play a vital role in Meth-triggered reproductive toxicity.

The results of this study indicate that consecutive administration of Meth at a dose of 5 mg kg−1 for 15 days significantly altered the structural integrity of the testes and impaired spermatogenesis in adult male mice. Compared with those of the control group, the seminiferous epithelium of the mouse seminiferous tubules was damaged, with a marked reduction in the sperm count and curvature of the sperm tails following Meth treatment. These findings align with previous research, which has demonstrated that both prenatal (intrauterine) exposure and adult exposure to Meth can have detrimental effects on male fertility parameters.24,25 In our study, Meth exposure resulted in a significant decrease in the sperm concentration, compromised sperm motility, and curled sperm tails. However, there were no significant changes in the percentage of progressive motility, straight line velocity, or curvilinear velocity. This finding contrasts with that of Mojdeh Sabour’s research, which reported that Meth dosages of 8 mg kg−1 per day or 15 mg kg−1 per day for 35 days reduced sperm progressive motility.24 The discrepancies in these results may be attributed to differences in the Meth exposure dose, individual animal variability, and methodologies employed for sperm analysis. Despite the minimal effect of Meth on sperm motility, its significant impact on sperm density suggests that Meth has a considerable influence on sperm viability.

By using RNA sequencing (RNA-seq), we identified a novel molecule, Mettl21c, a methyltransferase that is significantly associated with spermatogenesis. Protein methylation, a process known to modulate a myriad of biological functions, including signal transduction, DNA repair, transcription, and gene expression, is mediated by methyltransferases such as Mettl21c. This enzyme, a distant relative within the methyltransferase family, primarily catalyzes methylation reactions in nonhistone proteins and has a propensity for binding with specific molecular partners.26 To date, research on Mettl21c has focused predominantly on its role in skeletal muscle.27 Mettl21c trimethylates p97 at the Lys315 residue, thereby modulating the degradation of autophagy-related proteins. The loss of this modification impairs the formation of p97 hexamers and reduces adenosine triphosphatase activity in vivo.28 In muscle tissue, Mettl21c is specifically expressed in mature type I (slow) myofibers and methylates heat shock protein 8 (Hspa8) at Lys-561, increasing its stability and function in chaperone-mediated autophagy.29 Additionally, Mettl21c influences protein synthesis by mediating the methylation of Lys-943 on Alanyl-tRNA synthetase 1 (Aars1) in mouse skeletal muscle.30 A partial reduction in Mettl21c expression inhibits myoblast differentiation, impairs calcium release from the sarcoplasmic reticulum, and increases cell death.26

Other methyltransferases, such as Mettl3 and Mettl14, have been shown to regulate murine spermatogenesis through the mediation of mRNA N6-methyladenosine.23 Importantly, we found that Mettl21c is also highly expressed in undifferentiated mouse spermatogonia. The expression of Mettl21c was markedly reduced following Meth treatment. These findings suggest that Mettl21c may methylate specific proteins and play crucial roles in spermatogenesis and the homeostasis of undifferentiated spermatogonia. Our findings indicate that siRNA-mediated knockdown of Mettl21c in mouse SSC-derived C18-4 cells led to decreased expression of the SSC marker molecules Gfra1 and Thy1 and increased cell apoptosis. Collectively, these findings suggest that Mettl21c may contribute to the reproductive toxicity of Meth. Future research endeavors will focus on conducting more comprehensive and robust experiments to validate this hypothesis.

This study elucidates the role of Mettl21c in Meth-induced reproductive toxicity, a finding with potential translational significance for human males. Although our experiments were conducted in mice, the conservation of spermatogenic pathways across mammals supports the relevance of these findings to human infertility. Clinical reports indicate that Meth abuse in men is associated with reduced sperm counts and motility, mirroring our observations in mice.5,8 The down-regulation of Mettl21c in Meth-exposed undifferentiated spermatogonia suggests that this methyltransferase may serve as a biomarker or therapeutic target for Meth-associated infertility in humans. Future studies should validate Mettl21c expression in human sperm or testicular biopsies from Meth users and explore pharmacological strategies to restore its activity. For example, methyltransferase activators, such as S-adenosylmethionine (SAMe), could be tested for their ability to counteract Meth’s effects on spermatogenesis.

The hypothesis that overexpression of Mettl21c could mitigate the damaging effects of Meth on fertility and spermatogenesis remains to be experimentally tested. These experiments provide a more complete understanding of the molecular mechanisms underlying Meth-induced reproductive toxicity. While specific siRNAs can effectively reduce Mettl21c expression, they do not result in complete deletion of the gene. This partial reduction in expression may influence the experimental outcomes, highlighting the need for additional approaches, such as gene knockout techniques, to assess the role of Mettl21c fully.

CONCLUSION

In summary, this research significantly contributes to our understanding of how Meth exposure can impair fertility and spermatogenesis. This study addresses a gap in knowledge regarding the adverse effects of Meth on the expression of genes, such as Mettl21c, in the testis. Moreover, this study demonstrated that knocking down Mettl21c inhibits spermatogonial proliferation and disrupts spermatogenesis, suggesting that it is a potential target gene for the reproductive effects of Meth in male mice.

AUTHOR CONTRIBUTIONS

LQF and WTY were responsible for the experimental design and supervised the conduct of the experiment. XHZ performed cell and animal experiments and wrote the manuscript. DZ performed bioinformatics analysis. SL performed sample collection. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests.

Supplementary Figure 1

Expression of genes down-regulated in Cluster 1 in single-cell transcriptional profiles of mouse testis. Among these genes, Mettl21c and Xlr5a were significantly enriched in SSCs. Mettl21c: methyltransferase-like 21C; SSC: spermatogonial stem cell.

AJA-28-267_Suppl1.tif (220.5KB, tif)

ACKNOWLEDGMENTS

We thank ProMab Biotechnologies and Top-Notch Innovation Base of Basic Medicine (Central South University, Changsha, China) for providing the antibody and molecular detection platforms. This study was supported by grants from the National Natural Science Foundation of China (No. 32270912, No. 82201771, and No. 32401046), Natural Science Foundation of Hunan Province (No. 2024JJ6083 and No. 2024JJ6550), Health Research Project of Hunan Provincial Health Commission (No. W20243143), Natural Science Foundation of Changsha (No. kq2202491), and the Open Projects of Key Laboratory of Brain Science Research & Transformation In Tropical Environment Of Hainan Province (No. 2023001).

Supplementary Information is linked to the online version of the paper on the Asian Journal of Andrology website.

REFERENCES

  • 1.Coffin PO, Suen LW. Methamphetamine toxicities and clinical management. NEJM Evid. 2023;2 doi: 10.1056/EVIDra2300160. EVIDra2300160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Guerin AA, Bridson T, Plapp HM, Bedi G. A systematic review and meta-analysis of health, functional, and cognitive outcomes in young people who use methamphetamine. Neurosci Biobehav Rev. 2023;153:105380. doi: 10.1016/j.neubiorev.2023.105380. [DOI] [PubMed] [Google Scholar]
  • 3.Wu LT, Schlenger WE, Galvin DM. Concurrent use of methamphetamine, MDMA, LSD, ketamine, GHB, and flunitrazepam among American youths. Drug Alcohol Depend. 2006;84:102–13. doi: 10.1016/j.drugalcdep.2006.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kelly BC, LeClair A, Parsons JT. Methamphetamine use in club subcultures. Subst Use Misuse. 2013;48:1541–52. doi: 10.3109/10826084.2013.808217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Aryan A, Abdollahifar MA, Karbalay-Doust S, Forozesh M, Mahmoudiasl GR, et al. Methamphetamine can induce alteration of histopathology and sex determination gene expression through the oxidative stress pathway in the testes of human post-mortem. Andrologia. 2022;54:e14441. doi: 10.1111/and.14441. [DOI] [PubMed] [Google Scholar]
  • 6.Chen Q, Wang L, Zhang J, Cheng J, Lin J, et al. Toxic effects of methamphetamine on reproductive systems, embryo development, and newborns:an evidence-based review. Curr Med Chem. 2024 doi: 10.2174/0109298673299759240603091021. Doi:10.2174/0109298673299759240603091021. [Online ahead of print] [DOI] [PubMed] [Google Scholar]
  • 7.Lin JF, Lin YH, Liao PC, Lin YC, Tsai TF, et al. Induction of testicular damage by daily methamphetamine administration in rats. Chin J Physiol. 2014;57:19–30. doi: 10.4077/CJP.2014.BAB155. [DOI] [PubMed] [Google Scholar]
  • 8.Nudmamud-Thanoi S, Thanoi S. Methamphetamine induces abnormal sperm morphology, low sperm concentration and apoptosis in the testis of male rats. Andrologia. 2011;43:278–82. doi: 10.1111/j.1439-0272.2010.01071.x. [DOI] [PubMed] [Google Scholar]
  • 9.Yamamoto Y, Yamamoto K, Hayase T, Abiru H, Shiota K, et al. Methamphetamine induces apoptosis in seminiferous tubules in male mice testis. Toxicol Appl Pharmacol. 2002;178:155–60. doi: 10.1006/taap.2001.9330. [DOI] [PubMed] [Google Scholar]
  • 10.Barenys M, Macia N, Camps L, de Lapuente J, Gomez-Catalan J, et al. Chronic exposure to MDMA (ecstasy) increases DNA damage in sperm and alters testes histopathology in male rats. Toxicol Lett. 2009;191:40–6. doi: 10.1016/j.toxlet.2009.08.002. [DOI] [PubMed] [Google Scholar]
  • 11.Hamed MA, Ekundina VO, Akhigbe RE. Psychoactive drugs and male fertility:impacts and mechanisms. Reprod Biol Endocrinol. 2023;21:69. doi: 10.1186/s12958-023-01098-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Nudmamud-Thanoi S, Sueudom W, Tangsrisakda N, Thanoi S. Changes of sperm quality and hormone receptors in the rat testis after exposure to methamphetamine. Drug Chem Toxicol. 2016;39:432–8. doi: 10.3109/01480545.2016.1141421. [DOI] [PubMed] [Google Scholar]
  • 13.Kaewman P, Nudmamud-Thanoi S, Thongleart J, Charoenlappanit S, Roytrakul S, et al. Differential protein expression of GABA A receptor alpha 1 subunit and calbindin in rat spermatozoa associated with proteomic analysis in testis following methamphetamine administration. PLoS One. 2023;18:e0273888. doi: 10.1371/journal.pone.0273888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Peirouvi T, Razi M. Molecular mechanism behind methamphetamine-induced damages in testicular tissue:evidences for oxidative stress, autophagy, and apoptosis. Andrologia. 2022;54:e14534. doi: 10.1111/and.14534. [DOI] [PubMed] [Google Scholar]
  • 15.Kitanaka N, Hall FS, Kobori S, Kushihara S, Oyama H, et al. Metoprine, a histamine N-methyltransferase inhibitor, attenuates methamphetamine-induced hyperlocomotion via activation of histaminergic neurotransmission in mice. Pharmacol Biochem Behav. 2021;209:173257. doi: 10.1016/j.pbb.2021.173257. [DOI] [PubMed] [Google Scholar]
  • 16.Numachi Y, Shen H, Yoshida S, Fujiyama K, Toda S, et al. Methamphetamine alters expression of DNA methyltransferase 1 mRNA in rat brain. Neurosci Lett. 2007;414:213–7. doi: 10.1016/j.neulet.2006.12.052. [DOI] [PubMed] [Google Scholar]
  • 17.Kitanaka J, Kitanaka N, Hall FS, Uhl GR, Takemura M. Brain histamine N-methyltransferase as a possible target of treatment for methamphetamine overdose. Drug Target Insights. 2016;10:1–7. doi: 10.4137/DTI.S38342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ma Q, Gui Y, Ma X, Zhang B, Xiong W, et al. N6-methyladenosine writer METTL16-mediated alternative splicing and translation control are essential for murine spermatogenesis. Genome Biol. 2024;25:193. doi: 10.1186/s13059-024-03332-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xu K, Yang Y, Feng GH, Sun BF, Chen JQ, et al. Mettl3-mediated m6A regulates spermatogonial differentiation and meiosis initiation. Cell Res. 2017;27:1100–14. doi: 10.1038/cr.2017.100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bernabò N, Mattioli M, Barboni B. The spermatozoa caught in the net:the biological networks to study the male gametes post-ejaculatory life. BMC Syst Biol. 2010;4:87. doi: 10.1186/1752-0509-4-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yang Y, Huang W, Huang JT, Shen F, Xiong J, et al. Increased N 6-methyladenosine in human sperm RNA as a risk factor for asthenozoospermia. Sci Rep. 2016;6:24345. doi: 10.1038/srep24345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhou D, Liu B, Liu L, Liu G, Zhu F, et al. Essential regulation of spermatogonial stem cell fate decisions and male fertility by APBB1 via interaction with KAT5 and GDF15 in humans and mice. Research (Wash D C) 2025;8:0647. doi: 10.34133/research.0647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lin Z, Hsu PJ, Xing X, Fang J, Lu Z, et al. Mettl3-/Mettl14-mediated mRNA N6-methyladenosine modulates murine spermatogenesis. Cell Res. 2017;27:1216–30. doi: 10.1038/cr.2017.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sabour M, Khoradmehr A, Kalantar SM, Danafar AH, Omidi M, et al. Administration of high dose of methamphetamine has detrimental effects on sperm parameters and DNA integrity in mice. Int J Reprod Biomed. 2017;15:161–8. [PMC free article] [PubMed] [Google Scholar]
  • 25.Li Z, Liu D, Wang G, Zheng Y, Chen L, et al. METH exposure alters sperm DNA methylation in F0 mice and mPFC transcriptome in male F1 mice. Psychopharmacology (Berl) 2024;241:897–911. doi: 10.1007/s00213-023-06516-2. [DOI] [PubMed] [Google Scholar]
  • 26.Huang J, Hsu YH, Mo C, Abreu E, Kiel DP, et al. METTL21C is a potential pleiotropic gene for osteoporosis and sarcopenia acting through the modulation of the NF-κB signaling pathway. J Bone Miner Res. 2014;29:1531–40. doi: 10.1002/jbmr.2200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chen S, Chen J, Wang C, He T, Yang Z, et al. Betaine attenuates age-related suppression in autophagy via Mettl21c/p97/VCP axis to delay muscle loss. J Nutr Biochem. 2024;125:109555. doi: 10.1016/j.jnutbio.2023.109555. [DOI] [PubMed] [Google Scholar]
  • 28.Wiederstein JL, Nolte H, Günther S, Piller T, Baraldo M, et al. Skeletal muscle-specific methyltransferase METTL21C trimethylates p97 and regulates autophagy-associated protein breakdown. Cell Rep. 2018;23:1342–56. doi: 10.1016/j.celrep.2018.03.136. [DOI] [PubMed] [Google Scholar]
  • 29.Wang C, Arrington J, Ratliff AC, Chen J, Horton HE, et al. Methyltransferase-like 21c methylates and stabilizes the heat shock protein Hspa8 in type I myofibers in mice. J Biol Chem. 2019;294:13718–28. doi: 10.1074/jbc.RA119.008430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zoabi M, Zhang L, Li TM, Elias JE, Carlson SM, et al. Methyltransferase-like 21C (METTL21C) methylates alanine tRNA synthetase at Lys-943 in muscle tissue. J Biol Chem. 2020;295:11822–32. doi: 10.1074/jbc.RA120.014505. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure 1

Expression of genes down-regulated in Cluster 1 in single-cell transcriptional profiles of mouse testis. Among these genes, Mettl21c and Xlr5a were significantly enriched in SSCs. Mettl21c: methyltransferase-like 21C; SSC: spermatogonial stem cell.

AJA-28-267_Suppl1.tif (220.5KB, tif)

Articles from Asian Journal of Andrology are provided here courtesy of Editorial Office of AJA.

RESOURCES