Table 1. PCR amplification conditions for exons 1–11 of TP53 and their corresponding DHPLC analysis conditions.
Exon | Primer sequences (5′-3′) | PCR product size, bp | PCR Tm, °C | DHPLC denaturating temperature, °C/gradient initial buffer B, % |
---|---|---|---|---|
1 | cacagctctggcttgcaga | 442 | 66 | 60/58, 64/52 |
agcgattttcccgagctga | ||||
2 | agctgtctcagacactggca | 317 | 64* | 65/47 |
gagcagaaagtcagtcccatg | ||||
3-4 | agacctatggaaactgtgagtgga | 631 | 56* | N/A |
gaagcctaagggtgaagagga | ||||
5-6 | cgctagtgggttgcagga | 550 | 64 | 61/57, 66/49 |
cactgacaaccacccttaac | ||||
7 | ctgcttgccacaggtctc | 283 | 64 | 58/54, 66/46 |
tggatgggtagtagtatggaag | ||||
8-9 | gttgggagtagatggagcct | 455 | 64 | 57/57, 63/50 |
ggcattttgagtgttagactg | ||||
10 | ctcaggtactgtgtatatacttac | 351 | 59 | 57/55, 65/46 |
atactacgtggaggcaagaat | ||||
11 | tcccgttgtcccagcctt | 476 | 58 | 56/58, 62/53 |
taacccttaactgcaagaacat |
With the addition of 0.5 × Q (Qiagen PCR amplification kit).