Table 1. Nucleotide insertions and deletions observed in E. coli GR536 compared to E. coli W3110.
| GR536 location* | Change in GR536 | W3110 location* | Notes |
|---|---|---|---|
| 146605–147833 | IS2 insertion | 3903280 | bax disruption |
| 202776 | 34 bp deletion in dctA | 3958123–3958156 | Truncated DctA (390 aa vs 428 aa) |
| 342070–342153 | ∆feoABC deletion | 4097445–4100172 | Scar from cat removal† |
| 552344 | IS5 deletion | 4310363–4311451 | yjcS alsK intergenic region |
| 571542 | 72 bp deletion | 4330755–4330826 | phnA phnB intergenic region |
| 756063–757538 | ∆fecABCDE disruption | 4515470–4521238 | kan cassette inserted† |
| 1430473 | 1 nt insertion (aggggga) | 547835 | Restores ylbE reading frame |
| 1506696–1506899 | ∆entC deletion | 624171–625204 | Scar from cat removal† |
| 1535916 | IS5 deletion | 654214–655407 | Restores dcuC |
| 1898129 | 26 bp deletion in ycbZ | 1017631–1017656 | tcggtcattgaatttccgggtcatcc |
| 1978457–1978637 | 2×181 bp insertion | 1097805 | serX ycdU intergenic region‡ |
| 2078784 | Excised e14 prophage | 1197952–1212989 | Restores icd |
| 2166668 | IS5 deletion | 1301041–1302370 | ychE oppA intergenic region |
| 2176594–2222714 | ϕ80 phage insertion | 1312283–1312309 | attB site within 3′ end of yciI§ |
| 2561189–2561353 | Orf insertion (6.3 kDa) | Between ydcF and dicF | |
| 3088751 | IS5 deletion | 2176984–2178176 | Restores gatA |
| 3231306 | IS2 deletion | 2320739–2322124 | Restores rcsC |
| 3426216–3426269 | ∆mntH deletion | 2516948–2518121 | Scar from cat removal† |
| 3472298–3479079 | CPZ-55 prophage | 3472298 | Between eutB and eutA |
| 3515392–3156729 | IS186 insertion | 2600452 | Disrupts hyf |
| 4097541–4098563 | ∆zupT disruption | 3181244–3181948 | cat cassette inserted† |
| 4177745 | IS5 deletion | 3261134–3262328 | Restores tdcD |
| 4428177–4429507 | IS3 insertion | 3512759 | Disrupts cytR |
| 4514042–4514048 | rrlA 2 bp deletion | 3597289–3597294 | gccgcaagg to gcgcaag |
| 4659688 | IS2 deletion | 3742396–3744263 | yidZ-yieE intergenic region |
| 4662321 | IS5 deletion | 3746911–3748105 | Restores tnaB |
| 4664802 | IS5 deletion | 3750591–3751785 | tnaA tnaC intergenic region |
*Number range indicates deletion of this region in the observed other strain (single number indicates nucleotide at which deletion begins).
†Scar nucleotide sequence can be found in Fig. 3, [10].
‡tacgaaaaaaaagcccgtactttcgtacgagctcttctttaaatatggcggtgagggggggattgactcgcttcgctcgccctgcgggcagcccgctcactgcgttcacggtctgtccaactggctgtcgccagttgtcgaaccccggtcggggcttctcatccccccggtgtgtgcaata.
§ɸ80 attB sequence: gtgaaaccatttaagaaagtgttctga.