TABLE 3.
Derepression of the ytfE promoter by repressor titration
| Plasmid | Promoter | Inverted repeat sequencea | Mean β-galactosidase activityb ± SD |
|---|---|---|---|
| None | None | 73 ± 5 | |
| pSTBlue-1 | None | 51 ± 1 | |
| pGIT1 | ytfE | AAGATGCATTTAAAATACATCTT | 2,738 ± 426 |
| pGIT8 | ytfE ΔA deletion | AAGATGCATTT-AAATACATCTT | 80 ± 6 |
| pGIT2 | hmpA | AAGATGCATTTGAGATACATCAA | 2,832 ± 291 |
| pGIT4 | ygbA | AAGATGTAATATAAATACATCTT | 1,426 ± 329 |
| pGIT5 | tehA | AAAATGCATTTCAAATATACTTT | 1,477 ± 92 |
a
Inverted repeat sequences similar to that in the ytfE promoter region are shown; underlined nucleotides match those at equivalent positions in ytfE.
b
Cultures were grown aerobically in L broth for 16 h. β-Galactosidase activity was assayed in duplicate in three independently grown cultures. Units of activity are as defined by Miller (26).