TABLE 1.
Microorganisms and plasmids used in the study
| Species and strain or plasmid | Relevant characteristic(s) or description and/or constructionb | Source or reference |
|---|---|---|
| Escherichia coli | ||
| DH5α | φ80dlacZΔM15 Δ(lacZYA-argF)U169 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 | 8 |
| DH5α/λpir | λpir/φ80dlacZΔM15 Δ(lacZYA-argF)U169 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 | 18 |
| DH10B | φ80dlacZαM15/araD139 Δ(ara leu)7697 ΔlacX74 galU galK rpsL deoR endA1 nupG recA1 mcrA Δ(mrr hsdRMS mcrBC) | 8 |
| BW10244 | proC::Tn5-132 | 15 |
| BW21116 | Δ(lacZYA-argF)U169 creC510 hsdR514 uidA(ΔMluI)::pir+ | 14 |
| XS72a | Δ(lacZYA-argF)U169 creC510 hsdR514 uidA(ΔMluI)::pir+proC::Tn5-132 | This study |
| GM119 | dam3 dcm9 metB1 galK2 galT27 lacY1 tsx-78 supE44 thi-1 mel1 tonA31 | 21 |
| Salmonella enterica serovar Typhimurium | ||
| MST951 | proA41 | 11 |
| MST952 | proB8 | 11 |
| MST953 | proC90 | 11 |
| TR5877 | hsdL6 hsdSA29 ilv-452 metA22 trpC2 metE551 xly-404 fla-66 rpsL120 H1-b H2-e,n,x (Fels2)−nml | 20 |
| M. acetivorans C2A | Wild type (DSM2834) | Lab stock |
| M. thermophila TM1 | Wild type (DSM1825) | Lab stock |
| M. barkeri Fusaro | Wild type (DSM804) | Lab stock |
| Plasmid | ||
| pBace3.6 | Cmr, oriF vector | 7 |
| Supercos1 | Dual cos vector | Stratagene; La Joya, Calif. |
| pBluescript KS(+) | Apr cloning vector | Stratagene; La Joya, Calif. |
| pSL1180 | Apr cloning vector | 4 |
| pPB35 | Par AprMethanosarcina-Escherichia shuttle vector | 3 |
| pWM321 | Pur AprMethanosarcina-Escherichia shuttle vector | 16 |
| pJK5 | pac-ori-aph cassette plasmid | 24 |
| pBEND2 | Apr symmetrical polylinker vector | 12 |
| pPB12 | Par AprMethanosarcina/Escherichia shuttle vector | 3 |
| pWM353 | Eco47III deletion of Supercos1 | This study |
| pWM357 | oriF, dual cos vector; XhoI-cut (added restriction sites shown in bold) dual-cos PCR fragment from pWM353 using primers CGCGCGCTCGAGCCTATAAAAATAGGCGTATCACGAGG and CGCGCGCTCGAGTTGAAGGCTCTCAAGGGCATCGGTCG ligated to a 6.3-kbp SalI fragment from pBace3.6 | This study |
| pJK201 | Pro+ clone from M. acetivorans in pWM367 | This study |
| pAW1 | proB-complementing subclone; Sau3AI partial of pJK201 in BamHI-cut pBluescript KS(+) | This study |
| pAW2 | proB-complementing subclone; Sau3AI partial of pJK201 in BamHI-cut pBluescript KS(+) | This study |
| pAW3 | proA-complementing subclone; Sau3AI partial of pJK201 in BamHI-cut pBluescript KS(+) | This study |
| pAW4 | proA-complementing subclone; Sau3AI partial of pJK201 in BamHI-cut pBluescript KS(+) | This study |
| pCK1 | proC-complementing subclone; Sau3AI partial of pJK201 BamHI cut in pSL1180 | This study |
| pCK2 | proC-complementing subclone; Sau3AI partial of pJK201 BamHI cut in pSL1180 | This study |
| pJK68 | M. acetivorans proABC subclone; 4,611-bp NdeI of pJK201 into NdeI-cut pSL1180 | This study |
| pJK69 | M. acetivorans proABC subclone; 4,611-bp NdeI of pJK201 into NdeI-cut pSL1180 (orientation opposite to that of pJK68) | This study |
| pJK72 | M. acetivorans proABC subclone; NotI-to-AvrII insert from pJK68 into NotI- and AvrII-cut pWM321 | This study |
| pPB36 | M. acetivorans proABC subclone; BamHI-to-MluI insert from pJK72 into BamHI- and MluI-cut pPB35 | This study |
| pJK74 | M. acetivorans proAB subclone; KpnI deletion of pJK72 | This study |
| pJK75 | M. acetivorans proA subclone; BclI deletion of pJK72 | This study |
| pJK76 | M. acetivorans proA subclone; BclI deletion of pPB36 | This study |
| pWM403 | Apr vector with unique PvuII site; PvuII deletion of pBluescript KS(+) | This study |
| pWM404 | PvuII-cut PCR product of EZ::TN <KM-1> (Epicentre, Madison, Wis.) with the primer GAATTCCAGCTGTCTCTTATACACATCTCAACC into PvuII-cut pWM403 | This study |
| pWM407 | 2.9-kbp KpnI-to-XbaI pac-ori-aph cassette of pJK5 into KpnI-XbaI-deleted pWM404 | This study |
| pTn5-407 | Tn5-407 vector; circularization of the PvuII fragment from pWM407 | This study |
| pJK70 | Tn5-ileS12 vector; the XbaI-SphI fragment from pPB12 was cloned into XbaI-SphI-digested pWM404 | This study |
| pJK71 | Tn5-ileS12 vector; the XbaI-SphI fragment from pPB12 was cloned into the XbaI-SphI-digested pWM405 | This study |
| pJK61 | pac-ori-aph cassette plasmid with symmetrical flanking sites; XbaI fragment of pJK5 into XbaI-cut pBend2 | This study |
| pCK11 | BamHI fragment of pCK1 into BamHI-cut pBluescript KS(+) | This study |
| pCK12 | BamHI fragment of pCK1 into BamHI-cut pBluescript KS(+) (orientation opposite to that of pCK11) | This study |
| pCK14 | proC1::pac-ori-aph plasmid; BamHI cassette from pJK61 into BglII-cut pCK12 | This study |
| pCK16 | proC2::pac-ori-aph plasmid; BamHI cassette from pJK61 into BglII-cut pCK11 | This study |
| pJK68- proA1::Tn5-407 | In vitro transposon mutagenesis of pJK68 with Tn5-407c | This study |
| pJK68- proA2::Tn5-407 | In vitro transposon mutagenesis of pJK68 with Tn5-407c | This study |
| pJK68- proA3::Tn5-ileS12 | In vitro transposon mutagenesis of pJK68 with Tn5-ileS12c | This study |
| pJK68- proA4::Tn5-ileS12 | In vitro transposon mutagenesis of pJK68 with Tn5-ileS12c | This study |
| pJK68- proB1::Tn5-407 | In vitro transposon mutagenesis of pJK68 with Tn5-407c | This study |
| pJK68- proB2::Tn5-ileS12 | In vitro transposon mutagenesis of pJK68 with Tn5-ileS12c | This study |
| pJK68- proB3::Tn5-ileS12 | In vitro transposon mutagenesis of pJK68 with Tn5-ileS12c | This study |
| pJK68- proC3::ileS12 | In vitro transposon mutagenesis of pJK68 with Tn5-ileS12c | This study |
| pJK68- proC4::ileS12 | In vitro transposon mutagenesis of pJK68 with Tn5-ileS12c | This study |
The proC::Tn5-132 allele of BW10244 was moved into BW21116 by P1 kc transduction to construct XS72. Tetracycline-resistant transductants were selected on TYE-tetracycline agar (22) and screened for Pro− phenotype on glucose-MOPS agar with and without proline.
Standard methods were used throughout for isolation and manipulation of plasmid DNA from E. coli (1). E. coli strains DH5α and DH10B were used as the hosts for most cloning experiments; DH5α/λpir was used as the host for cloning experiments involving pir-dependent replicons. Plasmids used for constructions involving BclI were isolated from E. coli GM119. Plasmids to be transformed into Salmonella serovar Typhimurium that were originally isolated from E. coli were usually passed through Salmonella serovar Typhimurium TR5877 first, to avoid problems associated with host restriction systems.
In vitro mutagenesis was performed using EZ::TN transposase (Epicentre) as recommended. Transposon Tn5-407 as used in these reactions was prepared by linearization of pTn5-407 with PvuII; transposon Tn5-ileS12 was prepared by purification of the 6.8-kbp FspI fragment from either pJK70 or pJK71. Mutagenized plasmids were recovered from Ampr and Kanr transformants of DH10B. The orientation and insertion site of each mutation were verified by DNA sequencing and are shown in Fig. 1. The primers used for determining the DNA sequences of transposon insertion junctions were pJK5forI (5"-GTATATTACGAATAGGGCG-3") and pJK5revI (5"-AGCTGCTGGTGAAAGAGAC-3") for Tn5-407 and EZTNkanrev (5"-GGTACCGAGCTCGAATTCAT-3") and ileS12rev (5"-CGAGCAGGTGATGAAAAGG-3") for Tn5-ileS12.