Table 2.

Regulatory elements in the 3′UTR of the female-specific exon in Agdsx. A) Sequence of six putative AgdsxRE elements with high homology to the splice enhancer dsxRE elements from Dmdsx, identified near the end of the female-specific exon 5. The upper case letters match the consensus dsxRE from Dmdsx. The distance of these elements from the 3′ splice acceptor site of intron 4 (bp to 3′) and the 5′ splice donor site of intron 5 (bp to 5′) are indicated, as well as the distance of the dsxRE region from the weak 3′ acceptor site of intron 3 in Dmdsx (Fig. 3). The dsxRE elements in Agdsx are found much further downstream from the 3′ splice acceptor site than in Drosophila, immediately upstream of the 5′ donor site of intron 5, a situation seen in the sex-specific splicing of the D. melanogaster fruitless gene (Dmfru). The D. melanogaster fruRE elements are shown as well as their distance from the alternative 3′ splice acceptor and the female-specific 5′ donor site of the following intron (33). B) Sequence of two potential purine-rich PREs identified in the region of the dsxRE in Agdsx, and their comparison with the Dmdsx PRE.

A)
	Gene	dsxRE Sequence	Identity	bp to 3′	bp to 5′
	Dmdsx	UC(U/A)(U/A)CAAUCAACA		295-566	-
	Agdsx	UCgcCgAUCAACc	9/13	1176	544
		cCAUCguUCAACc	9/13	1197	523
		UCAACA-UCAuCg	10/13	1220	500
		UCUcCAAUCAAuc	10/13	1343	377
		aCAUCAAUCAAuA	11/13	1606	114
		aCAUCAAUCAAuc	10/13	1694	26
	Dmfru	UCAUCAAUCAACA	13/13	1352	238
		UCUUCAAUCAACA	13/13	1387	203
		aCUUCAAUCAACA	12/13	1540	50
B)
	Gene	PRE Sequence
	Dmdsx	AAAGGACAAAGGACAAAA
	Agdsx	CGAGAAAAGGGGAGAGCAAA
		ACAAACGAGAGCAAGGAAAA