Skip to main content
. Author manuscript; available in PMC: 2006 Apr 1.
Published in final edited form as: J Exp Biol. 2005 Oct;208(Pt 19):3701–3709. doi: 10.1242/jeb.01819

Table 2.

Regulatory elements in the 3′UTR of the female-specific exon in Agdsx. A) Sequence of six putative AgdsxRE elements with high homology to the splice enhancer dsxRE elements from Dmdsx, identified near the end of the female-specific exon 5. The upper case letters match the consensus dsxRE from Dmdsx. The distance of these elements from the 3′ splice acceptor site of intron 4 (bp to 3′) and the 5′ splice donor site of intron 5 (bp to 5′) are indicated, as well as the distance of the dsxRE region from the weak 3′ acceptor site of intron 3 in Dmdsx (Fig. 3). The dsxRE elements in Agdsx are found much further downstream from the 3′ splice acceptor site than in Drosophila, immediately upstream of the 5′ donor site of intron 5, a situation seen in the sex-specific splicing of the D. melanogaster fruitless gene (Dmfru). The D. melanogaster fruRE elements are shown as well as their distance from the alternative 3′ splice acceptor and the female-specific 5′ donor site of the following intron (33). B) Sequence of two potential purine-rich PREs identified in the region of the dsxRE in Agdsx, and their comparison with the Dmdsx PRE.

A)
Gene dsxRE Sequence Identity bp to 3′ bp to 5′
Dmdsx UC(U/A)(U/A)CAAUCAACA 295-566 -
Agdsx UCgcCgAUCAACc 9/13 1176 544
cCAUCguUCAACc 9/13 1197 523
UCAACA-UCAuCg 10/13 1220 500
UCUcCAAUCAAuc 10/13 1343 377
aCAUCAAUCAAuA 11/13 1606 114
aCAUCAAUCAAuc 10/13 1694 26
Dmfru UCAUCAAUCAACA 13/13 1352 238
UCUUCAAUCAACA 13/13 1387 203
aCUUCAAUCAACA 12/13 1540 50
B)
Gene PRE Sequence
Dmdsx AAAGGACAAAGGACAAAA
Agdsx CGAGAAAAGGGGAGAGCAAA
ACAAACGAGAGCAAGGAAAA