Skip to main content
. 2002 Aug;184(16):4630–4635. doi: 10.1128/JB.184.16.4630-4635.2002

FIG. 1.

FIG. 1.

Organization of the Helicobacter pylori RR0166/HK0164 response regulator/histidine kinase locus and mapping of the RR0166 transcriptional start point. (A) Configuration of the RR0166/HK0164 locus in the genome of H. pylori 26695. The location of the experimentally determined promoter (P) is indicated. The location of the CAT cassette insertion into the histidine kinase gene for HK0164 is also shown. Arrows indicate the direction of transcription of each gene. (B) Primer extension was accomplished with a primer specific for RR0166 (5′ AACTCGCTCAAAAACTCGGC) (lane 1). A sequencing ladder used to determine the location of the transcriptional start point is shown to the right. (C) The sequence of the deduced RR0166 promoter region is shown. The transcriptional start point is underlined and italicized, and the arrow indicates the direction of transcription. The −10 promoter element is underlined, and the number of nucleotides (N) between the transcriptional start point and the translational start codon is indicated.