Skip to main content
. 2002 Aug;184(16):4630–4635. doi: 10.1128/JB.184.16.4630-4635.2002

FIG. 4.

FIG. 4.

(A and B) Quantitative primer extension analysis of two genes identified as putative members of the H. pylori HK0164/RR0166 regulon. Transcriptional start points, indicated by arrows, were mapped for genes HP0682 (A) and HP1432 (B). Primers specific for each gene (5′ CCACTACACAACTAAATGTTC and 5′CCGTAGTAATGGTGGTGGTGCG, respectively) were annealed to identical quantities of RNA from H. pylori 26695/HK0164 (lanes 1) and H. pylori 26695 CAT Control (lanes 2). Sequencing ladders used to determine the exact transcriptional start point are shown as well. Each primer extension was repeated with independently derived RNA, and similar results were obtained. The differences in observed primer extension signal intensities were consistent with results obtained by analysis of genome-wide transcriptional profiles. (C) The deduced promoter sequences for HP0682 and HP1432 are shown. The transcriptional start points are underlined and italicized, and the bent arrow indicates the direction of transcription. The −10 promoter elements are underlined, and the number of nucleotides (N) between the transcriptional start point and the translational start codons are indicated.