TABLE 1.
Oligonucleotide primers for DNA amplification
| Region | Specificity | Primer | Sequence (5" → 3") | Orientation | Positions | Location | Size (bp)a | [Mg2+] (mM)b |
|---|---|---|---|---|---|---|---|---|
| pX | Types 1 and 2 | ATLpX1 | CCCACTTCCCAGGGTTTGGACAGAGTCTT | Sense | 7432-7461c | |||
| ATLpX5 | GGAGGGGAGTCGAGGGATAAGG | Antisense | 7637-7658c | Outer | 226 | 6 | ||
| SK43 | CGGATACCCAGTCTACGTGT | Sense | 7466-7485c | |||||
| SK44 | GAGCCGATAACGCGTCCATCG | Antisense | 7604-7624c | Inner | 158 | 6 | ||
| Type L | AV45Ld | GGACGCGTTGTCAGCTC | Sense | 7432-7448e | ||||
| AV46Ld | GGGGGAGAGCTGGTAGAGGTA | Antisense | 7714-7734e | Outer | 302 | 4 | ||
| AV42Ld | CTCCCCTCCTTCCCCAC | Sense | 7474-7490e | |||||
| AV43Ld | CCACATGGTGTATACGTTTTGG | Antisense | 7671-7692e | Inner | 218 | 4 | ||
| AV51Ld | ACAATTGCCTCGAGCTCACCC | Sense | 7601-7621e | |||||
| AV82Ld | GAGGCACACGACGGA | Antisense | 7696-7713e | Inner | 112 | 6 | ||
| LTR | Type 1 | ATLTR1 | TGACACTGACCATGAGCCCCAAAT | Sense | 130-153c | |||
| ATLTR2 | TCGTATCCCGGACGAGCCCCCAA | Antisense | 886-908c | Outer | 778 | 6 | ||
| ATLTR11 | ACTAAGGCTCTGACGTCTCCCCC | Sense | 228-250c | |||||
| ATLTR12 | CGGTACTTGGCCGTGGGCCAAGCCG | Antisense | 790-814c | Inner | 586 | 6 | ||
| Type L | LTR-1L | CAACAACCACCAACTAGGGG | Sense | 8260-8279e | ||||
| LTR-2L | AATGTTACAGGCGCTGG | Antisense | 8841-8857e | Outer | 597 | 3 | ||
| LTR-3L | CAAATAGCTGAATCATCCGTCTG | Sense | 8281-8303e | |||||
| LTR-4L | GCAACAGAAGTGCTACTTTCG | Antisense | 8797-8817e | Inner | 536 | 3 |
Size indicates the expected fragment size.
[Mg2+], MgCl2 concentrations for PCR.
Nucleotide positions correspond to the full genome sequence of ATK, the prototype strain of HTLV-1 (J02029).
These primers, originally developed as a generic PCR system for PTLV, were modified to specifically amplify STLV-L.
Nucleotide positions corresponds to the full genome sequence of PH969, the prototype strain of PTLV-L (Z29673).