Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| rabbit monoclonal anti-Histone H4K12ac | EpiCypher | Cat# 13-0037 |
| rabbit polyclonal anti-Histone H4K16ac | Acitve Motif | Cat# 39068; RRID:AB_2636968 |
| Histone H4 antibody | Abcam | Cat# ab17036; RRID:AB_1209245 |
| m-IgGκ BP-HRP antibody | Santa Cruz Biotechnology | Cat# sc-516102; RRID:AB_2687626 |
| Bacterial and virus strains | ||
| E. coli BL21(DE3)pLysS | Invitrogen | Cat# C602003 |
| Rosetta 2(DE3)pLysS Singles | MilliporeSigma | Cat# 71401-3 |
| E. coli TG1 | Toby Gibson | |
| E. coli HB101 | ATCC | Cat# 67593 |
| C321.ΔA.exp | Addgene | Cat# 49018 |
| Chemicals, peptides, and recombinant proteins | ||
| Q5 High-Fidelity DNA polymerase | New England Biolabs | Cat# M0491L |
| Benzamidine-HCl | RPI | Cat# B12000100.0 |
| 2-mercaptoethanol | Acros | Cat# 12547-0010 |
| TEV protease | This study | N/A |
| 1,4-Dithio-DL-thretiol | Gold Bio | Cat# DTT100 |
| Nε-Acetyl-L-lysine | Chem Impex | Cat# 05364 |
| Nicotinamide | Millipore Sigma | Cat# N3376 |
| UREA | Fisher Scientific | Cat# U15-50 |
| Guanidine Hydrochloride | Fisher Scientific | Cat# BP178-1 |
| (+)-JQ1 | Selleck Chemical | Cat# S7110 |
| Sodium phosphate, dibasic, anhydrous | Fisher Scientific | Cat# S374-1 |
| Potassium phosphate, monobasic | Fisher Scientific | Cat# BP362-1 |
| NP-40 | CalBioChem | Cat# 492015 |
| CHAPS | VWR | Cat# 97061-716 |
| LANCE Ultra ULight-anti-6xHIS | Revvity, Inc. | Cat# TRF0134-M |
| LANCE Eu-8044 streptavidin | Revvity, Inc. | Cat# AD0060 |
| Histone H3, H3 mutants | This study | N/A |
| Histone H4, H4 mutants | This study | N/A |
| Histone H2A | This study | N/A |
| Histone H2B | This study | N/A |
| Human BRD4, BRD4 mutants | This study | N/A |
| Critical commercial assays | ||
| West Pico PLUS Chemiluminescent Substrate | Thermo Scientific | Cat# 34580 |
| Deposited data | ||
| BRD4 BD1-acetylated nucleosome complex | This study | PDB: 36IV |
| BRD4 BD1 with basic patch 1-acetylated nucleosome complex | This study | PDB: 36IU |
| BRD4 BD1-acetylated nucleosome complex Cryo-EM map | This study | EMDB: EMD-77606 |
| BRD4 BD1 with basic patch 1-acetylated nucleosome complex Cryo-EM map | This study | EMDB: EMD-77605 |
| TR-FRET raw data, blot images and uncropped gel | This study | DOI:10.17632/c5pwxv8c2s.1 https://data.mendeley.com/preview/c5pwxv8c2s?a=45bd27b8-8459-41cbbcf8-4ff7292a5990 |
| Oligonucleotides | ||
| 177 bp 601 Cy5 forward primer (ATCATGTGATGGACCCTATACGCGGCCGCCCTGGAG) | IDT | N/A |
| Recombinant DNA | ||
| pGEX-6P-1 BRD4 full-length | Addgene | Plasmid #14447 |
| pST50Tr-HISNhBRD4t1 | This study | expresses HISNhBRD4Δ1 and hBRD4Δ1=hBRD4 (2–722) |
| pST50Tr-HISNhBRD4t1x2 | This study | expresses HISNhBRD4Δ1m2 (Y97F,N140A) |
| pST50Tr-HISNhBRD4t1x3 | This study | expresses HISNhBRD4Δ1m3 (A80V) |
| pST50Tr-HISNhBRD4t1x8 | This study | expresses HISNhBRD4Δ1m8 (Y390F,N433A) |
| pST50Tr-HISNhBRD4t1x9 | This study | expresses HISNhBRD4Δ1m9 (K283A,K285A,K286A,K289A,R290A, K291A) |
| pST50Tr-HISNhBRD4t1x10 | This study | expresses HISNhBRD4Δ1m10 (K283E,K285E,K286E,K289E,R290E, K291E) |
| pST50Tr-HISNhBRD4t1x11 | This study | expresses HISNhBRD4Δ1m11 (177A,R179A,R181A,R183A,K184A) |
| pST50T r-HISNhBRD4t1 x12 | This study | expresses HISNhBRD4Δ1m12 (K177E,R179E,R181E,R183E,K184E) |
| pST50Tr-HISNhBRD4t1x13 | This study | expresses HISNhBRD4Δ1m13 (K314A,K317A,R321A,R322A,R326A, K329A,K332A,K333A) |
| pST50T r-HISNhBRD4t1 x14 | This study | expresses HISNhBRD4Δ1m14 (K314E,K317E,R321E,R322E,R326E, K329E,K332E,K333E) |
| pST50Tr-HISNhBRD4t1x15 | This study | expresses HISNhBRD4Δ1m15 (K535A,K537A,K538A,K539A,K541A, K543A,K544A,K546A,K547A,K548A, K550A,K552A,R553A,K554A) |
| pST50T r-HISNhBRD4t1x16 | This study | expresses HISNhBRD4Δ1m16 (K561A,K562A,K564A,K566A,K571A, K572A,K574A,K575A) |
| pST50Tr-HISNhBRD4t1x19 | This study | expresses HISNhBRD4Δ1m19 (K283A,K285A,K286A,K289A,R290A, K291A,K314A,K317A,R321A,R322A, R326A,K329A,K332A,K333A) |
| pST50Tr-HISNhBRD4t1x20 | This study | expresses HISNhBRD4Δ1m20 (K283E,K285E,K286E,K289E,R290E, K291E,K314E,K317E,R321E,R322E, R326E,K329E,K332E,K333E) |
| pST50Tr-HISNhBRD4t1x21 | This study | expresses
HISNhBRD4Δ1m21 (K177A,R179A,R181A,R183A,K184A, K283A,K285A,K286A,K289A,R290A, K291A,K314A,K317A,R321A,R322A, R326A,K329A,K332A,K333A) |
| pST50Tr-HISNhBRD4t1x26 | This study | expresses HISNhBRD4Δ1m26 (K177E,R179E,R181E,R183E,K184E, K283E,K285E,K286E,K289E,R290E, K291E,K314E,K317E,R321E,R322E, R326E,K329E,K332E,K333E,K535A, K537A,K538A,K539A,K541A,K543A, K544A,K546A,K547A,K548A,K550A, K552A,R553A,K554A,K561A,K562A, K564A,K566A,K571A,K572A,K574A, K575A) |
| pST50Tr-HISNhBRD4t1x27 | This study | expresses HISNhBRD4Δ1m27 (K99E,K102E) |
| pST50Tr-HISNhBRD4t1x28 | This study | expresses HISNhBRD4Δ1m28 (R68E,K72E,K76E) |
| pST50Tr-HISNhBRD4t1x37 | This study | expresses HISNhBRD4Δ1m37 (W75A) |
| pST50Tr-HISNhBRD4t1x38 | This study | expresses HISNhBRD4Δ1m37 (R179E,R181E,R183E) |
| pST50Tr-HISNhBRD4t1x42 | This study | expresses HISNhBRD4Δ1m42 (R179A,R181 A,R183A) |
| pST50Tr-HISNhBRD4t1x43 | This study | expresses HISNhBRD4Δ1m43 (R179K,R181 K,R183K) |
| pST50Tr-HISNhBRD4t1x45 | This study | expresses HISNhBRD4Δ1m45 (R181E) |
| pST50Tr-HISNhBRD4t1x46 | This study | expresses HISNhBRD4Δ1m46 (K561A,K562A,K564A,K566A,K571A, K572A,K574A,K575A) |
| pST50Tr-HISNhBRD4t6 | This study | expresses HISNhBRD4Δ6=HISNhBRD4 (40– 170) |
| pST50Tr-HISNhBRD4t11 | This study | expresses HISNhBRD4Δ11=HISNhBRD4 (349– 470) |
| pST101-15xNCP601 a165M | This study | to isolate 165 bp 601 sequence |
| pST50T rc2-xH4t13 | This study | express Xenopus H4 (24–102) |
| pCDF_PylT-HISNxH3 | gift from Jason Chin | N/A |
| pBK-AcKRS3 | gift from Jason Chin | N/A |
| pCDF_PylT-HISNxH3x55 | This study | expresses Xenopus H3 with acetylated K18 |
| pBAD-CDF-xH3(Δ93-98)-TEV-xH4 | gift from Heinz Neumann | N/A |
| pBAD-CDF-HISxH3t14NxH4x51 | This study | expresses Xenopus H4 with acetylated K12 and K16. |
| Software and algorithms | ||
| CryoSparc V 4.6 | Punjani et al. | https://cryosparc.com |
| UCSF Chimera X | Pettersen et al. | https://www.cgl.ucsf.edu/chimerax/ |
| Phenix v1.20 | Afonine et al. | https://phenix-online.org |
| ImageJ | Schneider et al. | https://imagej.nih.gov/ij/ |
| Visual Studio Code | Microsoft Corporation | https://code.visualstudio.com |
| PyMol | Schrödinger | https://pymol.org |
| Other | ||
| Ni-NTA Superflow resin | QIAGEN | Cat# 30410 |
| Talon Superflow metal affinity resin | Clontech | Cat# 635670 |
| Nitrocellulose blotting membrane | GE Healthcare | Cat# 10600009 |
| Source 15S cation-exchanger | GE Healthcare | Cat# 17-0944-01 |
| Source 15Q anion-exchanger | GE Healthcare | Cat# 17-0947-01 |
| Superdex 200 Increase 10/300 GL | GE Healthcare | Cat# 28-9909-44 |
| Vivaspin 500 centrifugal concentrator MWCO:30kDa | Sartorius | Cat# VS0122 |
| Vivaspin 20 centrifugal concentrator MWCO:30kDa | Sartorius | Cat# VS2022 |
| Quantifoil R1.2/1.3 Cu 300 mesh grid | Quantifoil | Cat# N1-C14nCu30-01 |
| Vitrobot Mark IV | Thermo Fisher Scientific | N/A |
| 384-well non-binding microplate | Greiner Bio-One | Cat# GBO-784904 |
| VICTOR Nivo Multimode Microplate Reader | Revvity, Inc. | N/A |