Skip to main content
. 2026 Aug 6;23(5):e00970. doi: 10.1016/j.neurot.2026.e00970

Fig. 4.

Fig. 4

C9orf72 promotes mHTT aggregation through activation of Stat1 signaling. (a) Representative immunoblots of N2a cells transfected with control vector or C9orf72, in the presence or absence of GFP–mHTT. Immunoblotting shows phosphorylated Stat1 (p-Stat1), total Stat1, C9orf72, and γ-tubulin. (b, c) Quantification of p-Stat1 (b) and total Stat1 (c) levels normalized to γ-tubulin in cells transfected with control or C9orf72. Both p-Stat1 and total Stat1 levels were significantly increased upon C9orf72 overexpression. (d, e) Quantification of p-Stat1 (d) and total Stat1 (e) levels normalized to γ-tubulin in cells co-expressing GFP-mHTT with either control vector or C9orf72. (n = 3). ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001 by unpaired t-test. (f–h) Stat1 knockdown attenuates C9orf72-induced mHTT aggregation. N2a cells were co-transfected with GFP-mHTT, either C9orf72 or control vector, together with shScramble or shStat1 targeting on GCTCACTCAGAACACTCTGAT, and analyzed 48 h post-transfection. (f) Representative fluorescence images showing Hoechst-stained nuclei (blue) and GFP-mHTT (green). Stat1 knockdown reduced GFP–mHTT aggregation under C9orf72 overexpression conditions. Scale bar = 200 μm. (g) Representative immunoblots showing C9orf72, p-Stat1, Stat1, insoluble GFP-mHTT (stacking gel), soluble GFP-mHTT and γ-tubulin. (h) Quantification of insoluble GFP-mHTT normalized to γ-tubulin. Stat1 knockdown significantly reduced C9orf72-induced mHTT aggregation. (n = 5). ∗p < 0.05, ∗∗p < 0.01 by one-way ANOVA with Tukey’s post hoc test. Data are presented as mean ± SD.