Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for gene expression analysis
| Primer | Sequence (5' to 3') | Tm | Amplicon size | NCBI Ref Seq |
| CCR2 (Forward) CCR2 (Reverse) | GGAGAAGTTCAGAAGCCTTTTTC GGACCTCCACACACTGGTTTT | 58 60 | 78 | NM_001123041.3 |
| CXCR3 (Forward) CXCR3 (Reverse) | TGCCAATACAACTTCCCACA CGGAACTTGACCCCTACAAA | 57 57 | 371 | NM_001142797.2 |
| HPRT1 (Forward) HPRT1 (Reverse) | GACCAGTCAACAGGGGACAT CCTGACCAAGGAAAGCAAAG | 59 57 | 132 | NM_000194.3 |
