Structure of orf73 and orf72 spliced transcripts. (A) Schematic illustration of the steps involved in the RNA ligase-mediated 5′ RACE protocol. Using the GeneRacer reagents (Invitrogen), polyadenylated RNA from S11E lymphoma cells was treated as described to generate adapted RNA templates for reverse transcription into cDNA. Following nested RT-PCRs using primers specific to the RNA adaptor region and orf73 (73RTo, ATCGTCTGTCTCTCCTACATCTAAA, and 73RTi, TCAACATCAACATCTGGTGATGGTG) products were subcloned and sequenced. (B) The region of the genome encoding γHV68 orf72 and orf73 is shown. Two major spliced orf73 transcripts were identified. The larger orf73 spliced transcript contained at least one copy of a 91-bp exon (E1) located within the viral terminal repeat, a 106-bp exon (E2) and the orf73 coding exon (E3). The second, smaller orf73 transcript identified contained only E2 and E3. RT-PCR performed with a primer specific to orf72 (72RTi, TCAACATCAACATCTGGTGATGGTG) and a primer specific to exon 2 of the orf73 transcript (73E2i, TCCCGACTCGTGAGTAGCGCCGACTAG) amplified a spliced product that contains the sequences encoding orf72 as well as an additional exon from within the orf73 coding region. Products were subsequently subcloned and sequenced. The positions of the 73p1 and 73p2 promoters are also indicated.