TABLE 1.

Experimentally verified C. elegans miRNA candidates

miRNA	Sequence	Chr	Location	Arm	Sim
miR-353	caauugccauguguugguauu	I	intron of D1007.12 (s)	5′	+
miR-354	accuuguuuguugcugcuccu	I	intron of Y105E8A.16 (s)	3′	+++
miR-355	uuuguuuuagccugagcuaug	II	1 kb ds of T27D12.3	5′	+++
miR-356	uugagcaacgcgaacaaauca	III	intron of ZK652.2 (s)	5′	++
miR-357	uaaaugccagucguugcagga	V	0.6 kb us of C10B5.1	3′	+
miR-358	caauugguaucccugucaagg	V	0.9 kb us of C10B5.1	3′	+
miR-359	ucacuggucuuucucugacga	X	0.5 kb ds of Y41G9A.6	3′	+
miR-360	ugaccguaaucccguucacaa	X	0.5 kb us of Y23B4A.2	3′	+++
miR-392	uaucaucgaucacgugugaug	X	1.0 kb us of F54B11.5	3′	+
miR-239b	uuguacuacacaaaaguacug	X	7.0 kb us of C34E11.1	5′	++
miR-259	aaaucucauccuaaucuggua	V	1.2 kb us of F25D1.4	5′	+++
lsy-6 miRNA	uuuuguaugagacgcauuucg	V	0.5 kb us of C32C4.3	3′	++

The first nine rows show newly identified genes, the last three rows show the revised sequences for the successfully cloned, but previously described miRNAs miR-239b, miR-259, and lsy-6. The miRNAs are shown as 21-nt RNAs, but their actual length is generally not known because the PCR assay and sequencing validation determined the 5′ but not 3′ termini. The exception is the lsy-6 miRNA for which the 21-nt length was deduced from the 5′ terminus of the miRNA* and assuming Drosha processing leaving a 2-nt 3′ overhang. For miR-358 and miR-360, some of the observed clones showed 5′ ends shifted by 2 nt toward the 3′ end. “Arm” denotes the side of the foldback on which the miRNA is located. The level of similarity (sim) with the miRNAs in the C. briggsae foldbacks are shown as +++ (100%), ++ (>90%), and + (>75%). For predicted stem–loops, see Supplementary Material at http://genes.mit.edu/burgelab/MiRscanII. (us) Upstream; (ds) downstream; (s) sense