Table 1.
Genome island | Genome (Accession no.) | Length (location) | Integration site | Direct repeata | Promoter |
---|---|---|---|---|---|
T-1 | S.flexneri 2457T (NC_004741) | 7762 (1674124-1666363) | ynfE | gtagttccagatg(g/a)act | K1F |
T-2 | S.flexneri 2457T (NC_004741) | 3762 (1914374-239927)b | tRNA-Gly | tcgattcccgctgcccgctcca | T7 |
T-3 | S.flexneri 2457T (NC_004741) | 6380 (2951093-2944714) | tRNA-Gly | tcccttcgcccgctcca | T7/K1F |
301-1 | S.flexneri 301 (NC_004337) | 7760 (1634495-1626736) | ynfE | gtagttccagatg(g/a)act | K1F |
301-3 | S.flexneri 301 (NC_004337) | 7636 (2957668-2950033) | tRNA-Gly | tcccttcgcccgctcca | T7/K1F |
Ty2 | S.enterica Ty2 (NC_004631) | 5900 (3045460-3039561) | tRNA-Gly | tcgattcccttcgcccgctcca | T7 |
CT18 | S.enterica CT18 (NC_003198) | 6307 (3059960-3053654) | tRNA-Gly | tcccttcgcccgctcca | K1F |
ECA | E.carotovora SCRI1043 (NC_004547) | 6676 (2612648-2619323) | ECA2305/ispZ | gtaattttctgcaaattat | unknown |
Ye8081 | Y.enterocolitica 8081 (Sanger)c | 3946 (3685769-3681824) | tRNA-Gly | ttcgattcccttcacccgctcca | T7 |
E22 | E.coli E22 (NZ_AAJV01000013) | 13121 (159-13279) | GTPase | ctgacacaaggctgacacaaa | T3/K1F |
BS512 | S.boydii BS512 (NZ_AAKA01000004) | 7893 (103574-95682) | tRNA-Gly | tcccttcgcccgctcca | K1F |
CR | C.rodentium ICC168 (rod123h06.q1k) | 5371 (228046-233416)d | tRNA-Gly | gttcgattcccttcgcccgctcca | T3 |
aDirect repeats (DR) are located at the ends of each island. One kind of repeat is the 3′ end of the tRNA gene. For the most part the others do not resemble each other and are possibly duplications created during island integration. In this study the direct repeats were used to mark the endpoints of the corresponding islands.
bThis island was broken by insertion sequences (IS) and rearranged. To reconstruct this island, several pieces, 1 914 374 to 1 912 009, 1 910 756 to 1 910 232, and 240797 to 239927, were joined together, giving a length of 3762 bases. Some parts have been lost and cannot be found in the bacterial genome.
cThis sequence (with annotation) was obtained from the Sanger Institute (http://www.sanger.ac.uk/Projects/Microbes/); it has not been deposited in GenBank.
dThis is an unfinished genome obtained from the Sanger Institute. The island CR was found in one of the sequence contigs, so the coordinates given here are based on the contig rod123h06.q1k.