TABLE 1.
Primera | Sequence (5′-3′)b | Positionsc | Target | Referenced |
---|---|---|---|---|
U341If | CCTACGGGIIGCIICAG | 341-357 | Universal | 17 |
B342If | CTACGGGIGGCIGCAGT | 342-358 | Bacteria | 52 |
A348If | GGIGCAICAGGCGCGAAA | 348-365 | Archaea | 6 |
U806Ir | GGACTACCIGGGTITCTAA | 788-806 | Universal | 47 |
A1399r | GTGTGTGCAAGGAGCAG | 1383-1399 | Archaea | 17 |
Mc412f | CTGGGTGTCTAAAACACACCCAA | 412-435 | Methanoculleus | This study |
Mc578r | ATTGCCAGTATCTCTTAG | 578-598 | Methanoculleus | This study |
Ms413f | CAGATGTGTAAAATACATCTGTT | 413-436 | Methanosarcina | This study |
Ms578r | TCTGGCAGTATCCACCGA | 578-598 | Methanosarcina | This study |
Mt392f | ACTCTTAACGGGGTGGCTTTT | 392-413 | Methanothermobacter | This study |
Mt578r | TCATGATAGTATCTCCAGC | 578-598 | Methanothermobacter | This study |
f, forward primer; r, reverse primer.
I, inosine.
The numbering is based on the E. coli 16S rRNA gene.
The original primers in the literature were modified (see the text for details).