Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Designed primers
| Primer | Position | Polarity | Sequence (5′-3′) | Gene |
|---|---|---|---|---|
| Z752 | 752-774 | Sense | CAGGTCTCATCCCAGAAAGTTG | VP4 |
| Z1461 | 1461-1483 | Antisense | GGGTGTCGTTTGGTTATTGTCT | VP2 |
| Z1196 | 1196-1216 | Sense | ACCGAACACACTAAGGGACA | VP2 |
| Z1941 | 1941-1963 | Antisense | GGTAGCACTCAAATCAAAAGGA | VP3 |
| Z1814 | 1814-1836 | Sense | GACAACTTTCAGTCTCCGTGTG | VP3 |
| Z2478 | 2478-2500 | Antisense | GCCTTGTGCTATTGCTTTTTGT | VP3 |
| Z2378 | 2378-2400 | Sense | GAAATGGATATTCTCGGGTTTG | VP3 |
| Z3021 | 3021-3043 | Antisense | TTGATGGGTTTGATGAAGTCTG | VP1 |
