Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
SDR units in Oltmannsiellopsis cpDNA
| Numbera | ||||
| Designation | Size (bp) | Sequence | 100% | 90% |
| A | 11 | CAACACTYCCA | 252 | 426 |
| B | 11 | AWAGCGAAGCW | 89 | 126 |
| C | 7 | GCCCCCC | 126 | 126 |
| D | 8 | GGGGAGGG | 45 | 45 |
| E | 21 | AGGGGCTTTGCTTCGCGGTTT | 17 | 17 |
a Numbers of SDR units were determined in searches performed using 100% or 90% sequence identity. The genomic locations of these repeated elements are reported in [GenBank: DQ291132].
